ID: 928916982

View in Genome Browser
Species Human (GRCh38)
Location 2:36482848-36482870
Sequence ATAAGGTTCTTCCTCCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928916982_928916986 -5 Left 928916982 2:36482848-36482870 CCTCCAGGGAGGAAGAACCTTAT 0: 1
1: 0
2: 3
3: 13
4: 147
Right 928916986 2:36482866-36482888 CTTATTGTGGCTGTTGTTACTGG 0: 1
1: 0
2: 2
3: 46
4: 540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928916982 Original CRISPR ATAAGGTTCTTCCTCCCTGG AGG (reversed) Intronic
901591256 1:10345299-10345321 ACAAAGTTCTTCCTCCATGAGGG - Intronic
901762918 1:11482194-11482216 TTAAGGTCCTTCCTCCCAAGTGG + Intronic
903277853 1:22233091-22233113 TGAAGGCGCTTCCTCCCTGGTGG - Intergenic
905395688 1:37665048-37665070 ATGAGGTCCTTCCTTCCTGCAGG + Intergenic
915888425 1:159748157-159748179 TTCAGGATCTTCCTCCCTGGGGG + Intergenic
916489012 1:165285130-165285152 ATAAGGATCTCCCAGCCTGGAGG + Intronic
916576542 1:166072089-166072111 ATAAAGTTCTTCCTCCTATGAGG + Intronic
919000651 1:191827216-191827238 ATATGGTTCCTACTACCTGGAGG - Intergenic
920684159 1:208096336-208096358 ATCTGCTTCTTCCTCCCTGCAGG - Intronic
923439013 1:233997604-233997626 ATAAGCATCGTTCTCCCTGGGGG + Intronic
1065257888 10:23892614-23892636 ATGAGATTTCTCCTCCCTGGAGG - Intronic
1065266166 10:23978306-23978328 AGGAGGTTCTTCCTTCCTCGAGG - Intronic
1066469132 10:35681018-35681040 ATATAGTTGTTCCTCCATGGGGG - Intergenic
1067691764 10:48506526-48506548 ATAAGCTGCCTCCTTCCTGGAGG + Intronic
1069302471 10:66925976-66925998 ATAATGTTCTTCACCACTGGGGG + Intronic
1071879801 10:89884180-89884202 AAAAGCTTCCTCCTCCTTGGAGG - Intergenic
1071887948 10:89971090-89971112 GTAAGGGTCTTCATGCCTGGTGG - Intergenic
1073052545 10:100677417-100677439 CTAAGGTTCTTCCTGCCTGGGGG + Intergenic
1073538396 10:104298087-104298109 ATAAGGTTATTCCTATCTGGGGG - Intronic
1073546822 10:104356070-104356092 ATATGGTTTTTCCTCCTTTGTGG + Intronic
1074788245 10:116860787-116860809 ATAGTATCCTTCCTCCCTGGAGG - Exonic
1075215098 10:120525633-120525655 AAAGGGCTTTTCCTCCCTGGAGG - Intronic
1075864586 10:125706705-125706727 ACATGGTTCTTCCTCCCTGTGGG + Intergenic
1077829392 11:5848290-5848312 CTAATGTTCTCCCTCCCAGGAGG - Intronic
1079072399 11:17358653-17358675 CTTATGTTCTTCCTCCTTGGAGG + Intronic
1079109997 11:17599961-17599983 ATGGGGTTTTTCCTTCCTGGTGG - Intronic
1081255500 11:40888990-40889012 AAAGGGTCCTTCCTTCCTGGAGG + Intronic
1081499353 11:43650689-43650711 CTGAGGTTCTTCATCACTGGAGG + Intronic
1083617188 11:64032116-64032138 AACAGGGTCTTCCTCACTGGGGG - Intronic
1085708857 11:78811249-78811271 ATAAGGCTCTTCCTCTCAGCTGG + Intronic
1085829059 11:79880289-79880311 TTAAGGTTCTTCCTGCTTGGAGG + Intergenic
1089043752 11:115480796-115480818 AGAAGGTTCTCCCTCCCTCCAGG + Intronic
1090615269 11:128508490-128508512 ATAATGATATTCCTCACTGGAGG - Intronic
1090722389 11:129488318-129488340 ATAAGGTAGTCCCTCCCTGAGGG - Intergenic
1091333593 11:134750338-134750360 ATGAGTTTCTTCCTCCCAAGGGG - Intergenic
1094426372 12:30320978-30321000 ATGTGGTTCTTCCTCCCTCTAGG - Intergenic
1097386727 12:58958700-58958722 ATTAGGGTTTTCCTACCTGGGGG + Intergenic
1098389761 12:69957144-69957166 GTACGGTTCTTCTTCTCTGGAGG - Intronic
1099709728 12:86208056-86208078 ATAAGCTTCTTCCTGCCTCTAGG + Intronic
1101480879 12:105095726-105095748 ATAAGGTTCTGACTGCCTGTGGG - Intergenic
1101586986 12:106093766-106093788 AAAAGACTCTTCCTCCCTGGAGG - Intronic
1101843255 12:108342499-108342521 ACATGCCTCTTCCTCCCTGGAGG + Intergenic
1103975975 12:124703039-124703061 AGCAGGATCTTCCTACCTGGAGG + Intergenic
1104719797 12:131038972-131038994 ATAGGCTTCCTCCTCCCTAGGGG - Intronic
1109352431 13:61202027-61202049 ATAATGTTTTTCCTTCCTGATGG - Intergenic
1122806459 14:104262538-104262560 AAAAGGTCCTTCCTCCCCAGTGG + Intergenic
1124667362 15:31604927-31604949 AGAAGCTTCTGGCTCCCTGGTGG - Intronic
1126655288 15:50970489-50970511 ATCAGGTTCTTTCTCCCTTTGGG + Intronic
1127675356 15:61232836-61232858 ATTTGCTTTTTCCTCCCTGGTGG + Intergenic
1128151850 15:65368264-65368286 AAAAAGTCCTTTCTCCCTGGGGG + Intronic
1128155755 15:65390827-65390849 ATAAGGTTCTTGCTCTCTTGGGG - Intronic
1129525366 15:76210242-76210264 ATAAGGTGCCTCCTGTCTGGGGG - Intronic
1130913921 15:88290334-88290356 AGAAGGGTATTCCTCCATGGTGG - Intergenic
1137612577 16:49828841-49828863 ATACGGTTCATTCTCCCTGGGGG - Intronic
1137847638 16:51707669-51707691 ATAAGGTGCTGCCTCAGTGGTGG - Intergenic
1138155277 16:54697118-54697140 AGAAGGTTTGTCTTCCCTGGCGG + Intergenic
1140636579 16:76922026-76922048 ATAAGCTTTTTCCCCCCTGCAGG + Intergenic
1141308355 16:82888373-82888395 ATCAAGTTCTTCTTCTCTGGAGG + Intronic
1142432018 16:90034105-90034127 CTAAGGTTCTTCCTGGCTGCTGG + Intronic
1143798135 17:9355043-9355065 AGAAGTTTCTGCCTCCCTAGGGG - Intronic
1144003879 17:11082012-11082034 CTAAGATTCTTGGTCCCTGGTGG - Intergenic
1144082916 17:11781056-11781078 ATGAGTTTCTTGTTCCCTGGAGG - Exonic
1144164252 17:12592642-12592664 AAAATGTTCTTCCTTCCTGTAGG - Intergenic
1145870551 17:28269902-28269924 AGAAGGTTCTGCCTCCATAGAGG + Intergenic
1146175220 17:30661845-30661867 AGAAAATTCTTCCTCCCTCGGGG - Intergenic
1146223758 17:31048727-31048749 AGAAGGTTCTGCCTCCTTAGGGG + Intergenic
1146348672 17:32077888-32077910 AGAAAATTCTTCCTCCCTCGGGG - Intergenic
1146811908 17:35910563-35910585 AGAAGGTTCTACCTCCTTAGGGG + Intergenic
1147232621 17:39030278-39030300 AGAAGGTTCTACCTCCTTAGGGG - Intergenic
1147232701 17:39030696-39030718 AGAAGGTTCTGCCTCCATAGGGG - Intergenic
1147587979 17:41663821-41663843 ATGTGGTTCTTCCACCCTGTCGG - Intergenic
1147922060 17:43923785-43923807 AGAAGGTTCTGCCTCCATAGGGG + Intergenic
1147922137 17:43924203-43924225 AAAAGGTTCTACCTCCTTAGGGG + Intergenic
1150784315 17:68150595-68150617 AGAAGGTTCTGCCTCCATAGAGG + Intergenic
1150784393 17:68151011-68151033 AGAAGGTTCTGCCTCCCTAGGGG + Intergenic
1150941601 17:69699332-69699354 AGAAGGTGCTTCTTACCTGGTGG + Intergenic
1151076900 17:71284240-71284262 ATAATTTTGTTCCACCCTGGTGG + Intergenic
1151367343 17:73626165-73626187 AGAAGGTCCTTCCTCCCTCCTGG - Intronic
1152816617 17:82411939-82411961 AGGAGGGTTTTCCTCCCTGGTGG - Intronic
1152816639 17:82412020-82412042 AGGAGGGTCTTCCTCTCTGGTGG - Intronic
1155932942 18:31725536-31725558 AGAAGGTTCTACCTCCTTAGGGG - Intergenic
1157625119 18:49044749-49044771 CTCAGTCTCTTCCTCCCTGGAGG + Intronic
1157977922 18:52346925-52346947 TAAAGGGTCTTCCTCCCTGGAGG - Intronic
1159370461 18:67521481-67521503 ATAATGTCCTTCATCTCTGGAGG - Intergenic
1161945716 19:7435338-7435360 ATAAACTTCTTCCTTCCTGACGG - Intronic
1162762623 19:12897498-12897520 GAAAGGTCCTTCCTGCCTGGTGG + Intronic
1165826686 19:38709692-38709714 ATACGCTTCTTCATCCCTGAAGG - Intronic
1165843565 19:38803828-38803850 GTGAGGGTCTTCCTCCCTAGTGG - Intronic
926402875 2:12516686-12516708 ATAAGGTTCTTCTTACTTGTTGG + Intergenic
928739138 2:34329134-34329156 TTAAGGTTCCTGCTCTCTGGGGG - Intergenic
928916982 2:36482848-36482870 ATAAGGTTCTTCCTCCCTGGAGG - Intronic
931579906 2:63761027-63761049 ACATGGTTCATCCTCCCTTGAGG - Intronic
935019720 2:99218123-99218145 AAATGGGGCTTCCTCCCTGGTGG - Intronic
935280411 2:101512566-101512588 AGAAGGTTCTTCCTCTCTTTGGG + Intergenic
942060572 2:172225219-172225241 ACAAGGTCCTTCCCACCTGGAGG - Intergenic
944049104 2:195446519-195446541 AAAAGGATCTTCCTCTCTGCAGG + Intergenic
945230181 2:207580104-207580126 ATAAGCTTCTACCTCACTGTAGG - Intronic
946446103 2:219740998-219741020 ATATGGTTCTGTCTCACTGGTGG - Intergenic
946965595 2:225034180-225034202 ATGAGGTCCTTCCTGCCTGGTGG + Intronic
947472045 2:230409631-230409653 ATTAGGTGCTTCCCCACTGGGGG - Intergenic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1171034476 20:21704773-21704795 ACAAGTTCCTTTCTCCCTGGCGG - Intergenic
1171078187 20:22150318-22150340 ATTAGGTTCTATCTCCCTGGGGG + Intergenic
1172180483 20:33000542-33000564 ATGCTGTTCTTCCTGCCTGGAGG - Intronic
1173615041 20:44397256-44397278 ATAATGTTCTTCCTCACTGGAGG + Intronic
1174895932 20:54449973-54449995 AGAAGGTTCTTACTCCAGGGGGG - Intergenic
1174957868 20:55120871-55120893 AAAATTTTCTTTCTCCCTGGGGG - Intergenic
1175500606 20:59447726-59447748 AGAAGGGTCCTCCTTCCTGGAGG + Intergenic
1177181178 21:17746184-17746206 ATAAGGATGTTCCTTCCTGTGGG + Intergenic
1179094855 21:38304551-38304573 TTAATTTTCTTCCTCCCAGGAGG + Exonic
1181673255 22:24435916-24435938 ATGATGTTCATCCTCCCTTGAGG + Intronic
950082741 3:10235027-10235049 ATCAGGTTCTCCCTCTGTGGTGG - Intronic
951739026 3:25899443-25899465 ATAAAGTTCTTCCTCAAAGGAGG - Intergenic
955012615 3:55033140-55033162 CTAAGGGGCTTCCTCCCTGTAGG - Intronic
962705496 3:138039316-138039338 ATAAGGGGCTTGCTGCCTGGTGG - Intergenic
968181223 3:196596853-196596875 ATAAGTTTCTCCCTCTCTTGTGG + Intergenic
968914622 4:3492026-3492048 ATAAGCTTTTGCCTTCCTGGGGG + Intronic
970176520 4:13345259-13345281 ATAAAGTTCTTCCTCCCTGTAGG + Intergenic
973766349 4:54166740-54166762 ATAGCGTTCATCCTCTCTGGAGG - Intronic
974760931 4:66272355-66272377 ATAAGGTTAATCCTACCTTGGGG + Intergenic
975892976 4:79050943-79050965 ATCATGTTTTTCCTCCCAGGTGG - Intergenic
979395673 4:120186247-120186269 AAAATGTTCTTCCTCACTGAAGG + Intergenic
982346610 4:154367189-154367211 ACATGGTTCTTCCTCACAGGAGG + Intronic
983444085 4:167826436-167826458 ATAAGTTACTTCCTCTCTAGGGG - Intergenic
986016361 5:3761052-3761074 TTAAGATTCTTCCTCTCTGAAGG - Intergenic
986033299 5:3913448-3913470 ATGAGGATCATCCACCCTGGCGG - Intergenic
988482976 5:31645157-31645179 CTAAGTTTATTCCTCCCTGAAGG - Intronic
990216204 5:53535172-53535194 ATAATCTTCCTCCTCTCTGGAGG - Intergenic
990809224 5:59703407-59703429 ATAAGGTACTTCCTCCATTAAGG - Intronic
993083796 5:83337828-83337850 ATAAGGACCTTCTTTCCTGGAGG + Intronic
995833029 5:116374609-116374631 ATGAGGTTCTTCCTTCCTCTTGG - Intronic
997721287 5:136080038-136080060 CCAAGTTTCTTCCTCCCTGGCGG - Intergenic
1001966037 5:175910562-175910584 AGGAGGCTCTTCCTGCCTGGAGG - Intergenic
1002250909 5:177928638-177928660 AGGAGGCTCTTCCTGCCTGGAGG + Intergenic
1004154992 6:13159465-13159487 ACATGGTACTTCCTCCCAGGAGG - Intronic
1007275397 6:40669589-40669611 ATAGTGTTCCTCCTCTCTGGAGG + Intergenic
1013796683 6:113896364-113896386 TTAAGGGTGATCCTCCCTGGAGG + Intergenic
1014204771 6:118645736-118645758 ATAAGGTTCTTGCTCTACGGAGG - Intronic
1014568198 6:122977193-122977215 AGAATGTTCTTCCACCCTGATGG - Intergenic
1020096688 7:5373583-5373605 ACTGTGTTCTTCCTCCCTGGGGG - Intronic
1020880223 7:13752261-13752283 ATAAGTTGCTTCTTCCTTGGAGG - Intergenic
1022328713 7:29357365-29357387 AGAGAGTTCTTCCTCACTGGTGG - Intronic
1023786322 7:43712102-43712124 AAAAGTTTCTTTTTCCCTGGAGG - Intronic
1030948947 7:115765067-115765089 ATAAAGTTCTTCATCCCAAGAGG - Intergenic
1033364149 7:140658675-140658697 TTAAAGTTATACCTCCCTGGGGG - Intronic
1034373678 7:150625036-150625058 ACAGGGTTTTTCCTCCTTGGTGG - Intergenic
1035954680 8:4063639-4063661 ATCAGGTGCTGCCTCCCTGAGGG + Intronic
1037502214 8:19496996-19497018 ATAAGGTTTTTGCTCCATAGAGG - Intronic
1038044905 8:23758006-23758028 ATAGGGTTCTTCAGCCCTGGGGG + Intergenic
1044011468 8:86999209-86999231 CTAAGGTTCTTCCCCTCTTGGGG + Intronic
1044122702 8:88417284-88417306 ATACAGTTCTTTCTCCCTGAAGG - Intergenic
1044247721 8:89968708-89968730 ATAAGCTTCTTCCCCACTGCCGG + Intronic
1046877678 8:119274516-119274538 ATGAAGTTCCTCCTCTCTGGAGG - Intergenic
1047381690 8:124371399-124371421 AAAAGTTTCTTCCTGCCAGGCGG + Intronic
1047589254 8:126309774-126309796 AATATGTTCTTCATCCCTGGAGG + Intergenic
1052254288 9:26435843-26435865 ATGAGGATCTTCAACCCTGGAGG - Intergenic
1056135827 9:83628722-83628744 ACAAGGTGCTTCCCTCCTGGGGG + Intronic
1057604030 9:96485797-96485819 AGCAGGTTCTTCCTCTCTGTGGG + Intronic
1060197663 9:121633981-121634003 ATTAGTTACTTCCTCCCTTGTGG + Intronic
1061386205 9:130290652-130290674 ACAAGGTTCTTCGTCCATGTGGG - Intronic
1187635585 X:21224473-21224495 ATTAAGTTATTCCTCCGTGGTGG + Intergenic
1190764945 X:53468204-53468226 AAAAGGATCTAACTCCCTGGTGG - Intergenic
1195960691 X:110383216-110383238 ATGAGGGTCTTCTTCCCAGGAGG + Intronic
1201237259 Y:11923336-11923358 TTAAGGTCATTGCTCCCTGGAGG - Intergenic