ID: 928919655

View in Genome Browser
Species Human (GRCh38)
Location 2:36513481-36513503
Sequence CAGGCTACAGAGTCTGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 581
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 540}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928919655_928919658 10 Left 928919655 2:36513481-36513503 CCATGTACAGACTCTGTAGCCTG 0: 1
1: 0
2: 1
3: 39
4: 540
Right 928919658 2:36513514-36513536 GCAGTAGCCACTTCTTTACCAGG 0: 1
1: 0
2: 0
3: 18
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928919655 Original CRISPR CAGGCTACAGAGTCTGTACA TGG (reversed) Intronic
900175910 1:1291273-1291295 CAGGCTGCAGAGGCTGCCCATGG - Exonic
900722701 1:4187758-4187780 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
900749063 1:4382608-4382630 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
900817211 1:4857626-4857648 CAGGCAAGAGAGCATGTACAGGG - Intergenic
900833509 1:4982074-4982096 CAGGCAAGAGAGTGTGTGCATGG + Intergenic
900901672 1:5520862-5520884 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
902827269 1:18985189-18985211 CAAGCTATGGAGTCTGCACATGG - Intergenic
903190533 1:21653309-21653331 CAGGGTTCAGAGCCTGGACAGGG + Intronic
903611449 1:24617687-24617709 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
903862547 1:26373521-26373543 GAGGCTGCAGAATCTGTGCAGGG + Intronic
903874564 1:26464664-26464686 CATGATACAGGGTCTGTAAAAGG - Intronic
904358360 1:29956177-29956199 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
904431541 1:30467733-30467755 CAGGCAAGATAGTCTGTGCAGGG - Intergenic
904852117 1:33467195-33467217 CAGGCTTCAGAGACTGAACCTGG + Intergenic
905428780 1:37906202-37906224 TTGGCTACAGACTCTGTACAGGG + Intronic
905931920 1:41794209-41794231 CAGGCAAGAGAGTTTGTGCAGGG + Intronic
907562706 1:55405555-55405577 CAGGCAAGAGAGTGTGTTCAGGG + Intergenic
907928436 1:58976483-58976505 CTGGCTCCAGGGCCTGTACATGG - Intergenic
908933251 1:69341641-69341663 CAGGCAAGAGAGTGTGTTCAGGG - Intergenic
909296625 1:73957331-73957353 CAGGCAAGAGAGCCTGTGCAGGG - Intergenic
909719951 1:78755622-78755644 CAGGCAAGAGAGCATGTACAGGG - Intergenic
909813510 1:79960668-79960690 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
909887686 1:80963008-80963030 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
911584116 1:99670468-99670490 AAGGCCACAGAGTCAGTAAAGGG + Intronic
911587946 1:99712802-99712824 AAGGTCACAGAGTATGTACATGG + Intronic
912274281 1:108240224-108240246 CAGGATACAGAGCCTGTGCGTGG - Intronic
912286986 1:108379638-108379660 CAGGATACAGAGCCTGTGCGTGG + Intronic
912293938 1:108454099-108454121 CAGGATACAGAGCCTGTGCGTGG + Intronic
912607173 1:111003108-111003130 CAGGCAAGAGAGCATGTACAGGG - Intergenic
913490529 1:119375772-119375794 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
916002217 1:160627988-160628010 CAGGCAAGAGAGTTTGTGCAGGG - Intronic
916384417 1:164251248-164251270 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
916757213 1:167783998-167784020 CAGGCTACAGAGACTGTGAAAGG + Intronic
917178326 1:172263600-172263622 CAGGCAAGAGAGTATGTGCAGGG + Intronic
918015396 1:180628714-180628736 CAGGCAAGAGAGTATGTGCAGGG + Intergenic
920514423 1:206574189-206574211 CATGCCCCAGAGTCTGGACACGG - Intronic
920903719 1:210138243-210138265 CAGGCAAGAGAGCCTGTGCAGGG + Intronic
921775559 1:219096208-219096230 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
922156778 1:223046655-223046677 CAGGCAAGAGAGCCTGTGCAGGG + Intergenic
923433369 1:233945754-233945776 CAGGCCAGAGAGCCTGTGCAGGG - Intronic
924272842 1:242351513-242351535 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
924467210 1:244309392-244309414 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
924473682 1:244365427-244365449 CAGGCAAGAGAGTTTGTTCAGGG - Intronic
1063025182 10:2171108-2171130 CAGGCAAGAGAGCCTGTGCAGGG + Intergenic
1063064154 10:2591565-2591587 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1063095088 10:2902104-2902126 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1063262013 10:4400291-4400313 CAGGCAAGAGAGTGTGTACAGGG - Intergenic
1063587193 10:7363228-7363250 CAGGCAAGAGAGCCTGTGCAGGG - Intronic
1063806795 10:9653881-9653903 CAGGCCAGAGAGTGTGTGCAGGG - Intergenic
1063870838 10:10416087-10416109 CAGGCAAGAGAGCCTGTGCAGGG - Intergenic
1064161202 10:12948176-12948198 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1065167522 10:22995141-22995163 CAGGCTTCAGCTTGTGTACAGGG + Intronic
1065260737 10:23920936-23920958 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1065781533 10:29173142-29173164 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1066188968 10:33037762-33037784 CAGGCACCAGTGTCTGGACAAGG - Intergenic
1066539449 10:36429361-36429383 CAGGCCACAGAGTCATGACATGG - Intergenic
1068647175 10:59480691-59480713 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1069147590 10:64915268-64915290 CAGGCAAGAGAGCATGTACAGGG + Intergenic
1069681229 10:70286955-70286977 CAGGCAACAGAGCATGTGCAGGG - Intergenic
1071673379 10:87632409-87632431 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1073791675 10:106946502-106946524 CAGGCGAGAGAGTTTGTGCAGGG - Intronic
1074102876 10:110367412-110367434 CAGGGTGCAGAATCTGGACAGGG - Intergenic
1075941867 10:126396675-126396697 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1075957705 10:126538170-126538192 CAGGCAAGAGAGTGTGTTCAGGG + Intronic
1076025074 10:127105118-127105140 CAGGCAACAAAGTTTGTGCAAGG - Intronic
1076281806 10:129252683-129252705 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1078084373 11:8224919-8224941 CAGGCTACAGGGCCTGGCCAAGG - Intronic
1078515107 11:12015163-12015185 CAGGCAAGAGAGCGTGTACAGGG - Intergenic
1079015407 11:16864671-16864693 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1079359384 11:19757883-19757905 CAGGCTGCAGAGTCTGAATTTGG - Intronic
1079515759 11:21266394-21266416 CAGGCTACAGAGGTTGCACATGG + Intronic
1079538749 11:21546591-21546613 CAGGCAATAGAGTGTGTGCAGGG - Intronic
1080401554 11:31941090-31941112 CAGGCAAGAGAGCATGTACAGGG + Intronic
1081234124 11:40625418-40625440 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
1081291192 11:41327798-41327820 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1081386765 11:42481145-42481167 CAGGCAAGAGAGTATGTGCAGGG - Intergenic
1081737390 11:45413589-45413611 CAGGCAAGAGAGCTTGTACAGGG + Intergenic
1082763889 11:57151216-57151238 CAGGCTACATAGTCTGAGAAAGG + Intergenic
1082898979 11:58225584-58225606 CAGGCAAGAGAGTGTGCACAGGG + Intergenic
1083515226 11:63251250-63251272 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
1085445393 11:76597763-76597785 CAGAGGACAGAGTCTGTACAGGG - Intergenic
1085875890 11:80405562-80405584 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1086797154 11:91120338-91120360 CAGCCTCCAGAGACTGTAAAAGG - Intergenic
1088998336 11:115024997-115025019 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1089851564 11:121501632-121501654 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
1090381475 11:126330610-126330632 CTGGCTGCAGAGTCTGTGCCTGG + Intronic
1090661185 11:128882745-128882767 GAGGAAACAGGGTCTGTACAGGG + Intergenic
1093238325 12:16639496-16639518 CAGGCAAGAGAGCCTGTGCAGGG + Intergenic
1093780722 12:23133716-23133738 CAGGCAAGAGAGCTTGTACAGGG - Intergenic
1094234307 12:28146072-28146094 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1094353152 12:29548542-29548564 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1094397747 12:30025965-30025987 CAGGCAAGAGAGCCTGTGCAGGG + Intergenic
1095188951 12:39233769-39233791 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1095209769 12:39478793-39478815 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1095314296 12:40740824-40740846 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1095343805 12:41125000-41125022 CAGGCAAGAGAGCTTGTACAGGG - Intergenic
1096123425 12:49103221-49103243 CAGGCCTCAGAGTCTAGACAAGG + Intronic
1097445449 12:59666627-59666649 CAGGCAAGAGAGTATGTGCAGGG - Intronic
1097797553 12:63880120-63880142 CAGGCTAGAGAGTGTGTGCAGGG - Intronic
1098141294 12:67452651-67452673 CAGGCAAGAGAGCGTGTACAGGG + Intergenic
1098368874 12:69736769-69736791 CAGCCTACAAAGTATGTAAAGGG - Intergenic
1098461262 12:70735393-70735415 CAGGCAAGAGAGTGTGTGCAAGG + Intronic
1098628225 12:72698964-72698986 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1098628468 12:72700877-72700899 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1098763411 12:74453709-74453731 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1099011333 12:77294972-77294994 CAGGCCAGAGAGCTTGTACAGGG + Intergenic
1099416302 12:82391098-82391120 CTGGATACAGGTTCTGTACATGG + Intronic
1099441096 12:82700929-82700951 CAGGCAAGAGAGTATGTGCAGGG + Intronic
1100578910 12:95920275-95920297 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1100658104 12:96668458-96668480 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
1101423020 12:104564871-104564893 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
1101724734 12:107379446-107379468 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1102944233 12:116971485-116971507 CAGGCCACAGAGACTGTATTAGG + Intronic
1103598729 12:122040686-122040708 CAGACTGCAGAGTGTGTAAATGG + Intronic
1104068132 12:125322250-125322272 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1104146403 12:126037971-126037993 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1105635454 13:22211527-22211549 CAGGCCACAGAGTCCCTTCATGG + Intergenic
1106942653 13:34794951-34794973 CAGGCAAGAGAGCTTGTACAGGG - Intergenic
1107474366 13:40720988-40721010 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1108686643 13:52825935-52825957 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1108821380 13:54354835-54354857 CGGGCAAAAGAGTGTGTACAGGG + Intergenic
1108824060 13:54390388-54390410 CAGGCAAGAGAGTGTGTGCAAGG - Intergenic
1109579907 13:64316606-64316628 CAGGCAAGAGAGTTTGTGCAGGG + Intergenic
1110037564 13:70707663-70707685 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1110073306 13:71206695-71206717 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1110075123 13:71230753-71230775 CAGGCAAGAGAGTGTGTACAGGG + Intergenic
1110732540 13:78895807-78895829 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1110970666 13:81757568-81757590 CAGGCTAGAGAGCTTGTGCAGGG + Intergenic
1111065044 13:83079701-83079723 CAGGCAATAGAGTGTGTGCAGGG + Intergenic
1111166304 13:84461913-84461935 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1111219711 13:85188466-85188488 CAGGCAACAGAGTGTGTGCAGGG - Intergenic
1111494381 13:89029158-89029180 CAGGCAAGAGAGTGTGTTCAGGG + Intergenic
1111569541 13:90064389-90064411 CAGGCAACAGAGTGTGTGCAGGG - Intergenic
1112608318 13:100929940-100929962 CAGTCTACAGAAGCTGCACATGG - Intergenic
1112645860 13:101330838-101330860 CAGGCAAGAGAGCCTGTGCAGGG - Intronic
1112900292 13:104350269-104350291 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1112904617 13:104401354-104401376 CAGGCAAGAGAATGTGTACAGGG - Intergenic
1114345518 14:21790315-21790337 CAGGCAAAAGAGTCTGTGCAGGG - Intergenic
1116296521 14:43118786-43118808 CAGGCAACAGAGCATGTTCAAGG + Intergenic
1117827824 14:59721852-59721874 CAGGCTAATGAGTCTTTACTTGG + Intronic
1118051730 14:62036663-62036685 CAGGCAAGAGAGCCTGTGCAGGG + Intronic
1119649431 14:76373344-76373366 CAGAAAACAGAGGCTGTACAGGG - Intronic
1120716984 14:87850803-87850825 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1121840631 14:97130882-97130904 CAGGTGACAGAGTCTGCACCCGG - Intergenic
1121864761 14:97352417-97352439 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1122394456 14:101413449-101413471 CAGGCAAGAGAGTTTGTGCAGGG + Intergenic
1122583878 14:102790559-102790581 CAGGCAAGAGAGTCTGTGCAGGG + Intronic
1122832589 14:104407618-104407640 CAGGCAAGAGAGTTTGTGCAGGG - Intergenic
1124465853 15:29939359-29939381 CAGACTGCAGAGTGTGTACCAGG - Intronic
1124832982 15:33167293-33167315 CAGGCAACAGACCTTGTACAGGG - Intronic
1124858147 15:33410912-33410934 CAGGCAACAGAGCTTGTGCAAGG + Intronic
1124992517 15:34689986-34690008 CAGGCAAGAGAGCCTGTGCAGGG - Intergenic
1126332041 15:47543408-47543430 CAGGCAAGAGAGTGTGTACAGGG - Intronic
1126841808 15:52724639-52724661 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1126918214 15:53489772-53489794 CAGGCAAGAGAGTGTGTACAGGG - Intergenic
1126942262 15:53780052-53780074 CAGGCAAGAGAGTGTGTACAGGG + Intergenic
1127006050 15:54571300-54571322 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
1127136640 15:55930782-55930804 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1129322801 15:74783936-74783958 CAGGCTACAGACTGGGGACATGG + Intronic
1129543772 15:76373628-76373650 CTGGCAACAGGGTCTGTAAAAGG + Intronic
1129596090 15:76965588-76965610 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1131821840 15:96281769-96281791 CAGGCAAGAGAGTTTGTGCAGGG - Intergenic
1131994434 15:98120457-98120479 CAGGCAAGAGAGTCTGTGCAGGG - Intergenic
1132133786 15:99311704-99311726 TATGCAACAGAATCTGTACATGG + Intronic
1133363340 16:5191421-5191443 CAGGCAAGAGAGTTTGTGCAGGG - Intergenic
1134327694 16:13222062-13222084 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
1134569273 16:15277728-15277750 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1134733104 16:16478317-16478339 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1134934335 16:18233656-18233678 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1135209769 16:20514929-20514951 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1136387186 16:29936088-29936110 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1137843586 16:51664867-51664889 CAGGCCAGAGAGCATGTACAGGG - Intergenic
1138094062 16:54198461-54198483 CAGGCAAGAGAGCTTGTACAGGG - Intergenic
1138745766 16:59361929-59361951 CAGGCAAGAGAGCATGTACAGGG - Intergenic
1139350457 16:66331772-66331794 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1140478020 16:75248681-75248703 CAGACTACATAGCCTGTGCACGG + Intronic
1140645402 16:77024325-77024347 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1140795120 16:78430152-78430174 CAGGCAACAGAGTATGTGCAGGG + Intronic
1140850639 16:78931962-78931984 CAGGCAAGAGAGTTTGTGCAGGG - Intronic
1141920383 16:87131856-87131878 CAGGCTGCAGAGGCTGTACTTGG + Intronic
1143337967 17:6187786-6187808 CATGCTATAGAGTCTGATCAAGG - Intergenic
1144017307 17:11208349-11208371 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1146468409 17:33105335-33105357 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1146571553 17:33957530-33957552 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
1147949323 17:44098185-44098207 CAGGCTCCAGGGTCTGTGCCTGG - Intronic
1149325145 17:55522510-55522532 CAGGCAAGAGAGTTTGTGCAGGG + Intergenic
1150469565 17:65425219-65425241 CAGGCAACAGAGCTTGTGCAGGG - Intergenic
1150626835 17:66847454-66847476 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
1150649582 17:67001135-67001157 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1150920284 17:69475663-69475685 CAGGCTACAGAGCATGGATATGG - Intronic
1150992716 17:70279268-70279290 CAGGCAACAGACTCTCCACAGGG + Intergenic
1151075351 17:71266005-71266027 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1151105006 17:71602959-71602981 CAGGCAAGAGAGTGTGTGCAAGG + Intergenic
1151112001 17:71689476-71689498 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1151206870 17:72514291-72514313 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1151497279 17:74466413-74466435 CAAGCTACGGAGTCACTACAGGG + Exonic
1151643033 17:75410387-75410409 CAGGCTGCAGACTCTGTGGAGGG - Intergenic
1152015142 17:77745675-77745697 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1152230311 17:79111028-79111050 CAGGCTTCACAGTCTGGCCAAGG - Intronic
1152326830 17:79646507-79646529 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1152984365 18:308307-308329 CAGGCAACAGAGCATGTGCAGGG - Intergenic
1153077435 18:1180975-1180997 CAGGCAAGAGAGTTTGTGCAGGG + Intergenic
1153233986 18:2968159-2968181 TCGTTTACAGAGTCTGTACAGGG - Intronic
1153514682 18:5892294-5892316 CTGGCTCCAGCCTCTGTACACGG - Intronic
1155528070 18:26737413-26737435 CAGGCAAGAGAGCATGTACAGGG - Intergenic
1155722796 18:29039647-29039669 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1155748447 18:29390379-29390401 CAGGCAACAGAGCTTGTACAGGG - Intergenic
1155748664 18:29392005-29392027 CAGGCAACAGAGCTTGTGCAGGG - Intergenic
1156359439 18:36371421-36371443 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
1156382666 18:36578298-36578320 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
1157108157 18:44794096-44794118 CAGCCTGCAGAGTATGAACAGGG + Intronic
1157581627 18:48777176-48777198 CAGGCCCCAGACTCTGTAAATGG - Intronic
1157782937 18:50456419-50456441 CAGGCAAGAGAGTTTGTGCAAGG + Intergenic
1158179695 18:54700175-54700197 CAGGCAAGAGAGTTTGTGCAGGG - Intergenic
1158525801 18:58212428-58212450 CAGGCAACAGAGTGTATGCAGGG + Intronic
1158684579 18:59601404-59601426 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1159718655 18:71858254-71858276 CAGGCAAGAGAGTTTGTATAAGG + Intergenic
1160268343 18:77360706-77360728 CAGACCAGAGAGTCTGTGCAGGG + Intergenic
1162612168 19:11765303-11765325 CAGGCAAGAGAGCATGTACAGGG + Intergenic
1163257959 19:16169070-16169092 CAGGCAACAAATTCAGTACAGGG - Intronic
1163354768 19:16803094-16803116 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
1165290503 19:34880525-34880547 CAGGCAACAGAGCATGTGCAGGG - Intergenic
1166271074 19:41714473-41714495 CAGGCTGCACAATATGTACAGGG + Intronic
1166820182 19:45574432-45574454 CAGGCTACAGGGGGTATACATGG - Intronic
924965923 2:76503-76525 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
925025471 2:603630-603652 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
925056000 2:857823-857845 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
925207474 2:2019285-2019307 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
925261460 2:2531945-2531967 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
925338389 2:3115348-3115370 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
925434270 2:3822941-3822963 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
925580372 2:5404342-5404364 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
925666054 2:6257606-6257628 GAGGCTACAGAGACAGTTCAGGG - Intergenic
925678946 2:6396541-6396563 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
925807002 2:7660443-7660465 CAGGCTAGAGAGCGTGTGCAGGG - Intergenic
926483826 2:13431514-13431536 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
928919655 2:36513481-36513503 CAGGCTACAGAGTCTGTACATGG - Intronic
929372002 2:41236747-41236769 CAGGCAACAGAGCATGTGCAGGG + Intergenic
929452131 2:42045099-42045121 CAGACCACAGTGTCTGTGCAAGG - Intergenic
930081314 2:47451289-47451311 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
930390973 2:50761423-50761445 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
930540899 2:52705284-52705306 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
932162066 2:69469654-69469676 CTGGCTTCATAGTCTGCACAGGG + Exonic
932749672 2:74363391-74363413 CAGGCTCCAGGGTCTGTGCCAGG - Exonic
933235342 2:79858460-79858482 TAGTCTACAGAGCCTGGACAGGG + Intronic
933428932 2:82150002-82150024 CAGGCAAGAGAGTTTGTGCAGGG - Intergenic
934124760 2:88877432-88877454 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
934918377 2:98320191-98320213 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
935342202 2:102068275-102068297 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
935385071 2:102491493-102491515 CAGGCAAGAGAGCATGTACAGGG + Intronic
935385353 2:102493461-102493483 CAGGCAAGAGAGCATGTACAGGG + Intronic
935416115 2:102821163-102821185 CAGGCTACACATTATGTTCAAGG - Intronic
936175201 2:110213701-110213723 CAGGCAAGAGAGCCTGTGCAGGG + Intergenic
936778890 2:116007838-116007860 CAGAGTACAGAGGCTGTCCACGG - Intergenic
936805680 2:116329453-116329475 CCGGCATCAGAGTCTGCACAAGG + Intergenic
936830983 2:116646533-116646555 CAGGCTATGGAGTCTGAAGAAGG + Intergenic
937106592 2:119321500-119321522 CAGGCAAGAGGGTCTGTGCATGG + Intronic
937800759 2:126077866-126077888 CAGGCAACAGAGTGTGTGCAGGG - Intergenic
938193084 2:129300482-129300504 CAGGCAACAGAGCCTGTCCTCGG - Intergenic
938796198 2:134719459-134719481 CAGGCTTCAGAGGCTGTACAGGG + Intergenic
939780933 2:146446629-146446651 CAGGCAAGAGAGTATGTGCAGGG + Intergenic
940500381 2:154486398-154486420 CAGGCAAGAGAGTTTGTGCAGGG - Intergenic
941192245 2:162399538-162399560 CAGGCCCCAGTGTGTGTACATGG + Intronic
941203455 2:162542997-162543019 CAGGCTAAACAGACTATACATGG - Intronic
941282344 2:163568709-163568731 CACACTACAGATTCTGTAAATGG + Intergenic
941355314 2:164483664-164483686 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
942773267 2:179548685-179548707 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
942911796 2:181252870-181252892 CAGGCTACAGAGCAAGGACAGGG - Intergenic
943150398 2:184105562-184105584 GAGGCTTCATAGTTTGTACAAGG - Intergenic
943307130 2:186276723-186276745 CAGGCAAGAGAGTTTGTGCAGGG + Intergenic
943815000 2:192242246-192242268 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
943957285 2:194208232-194208254 CAGGCAAGAGAGTTTGTGCAGGG + Intergenic
943976761 2:194489866-194489888 CAGGAAACAGAGCCTGTTCATGG + Intergenic
944454987 2:199883997-199884019 CAGGCAAGAGAGCCTGTGCAGGG - Intergenic
944501565 2:200365474-200365496 CAGTCTTCAAAGTCTATACATGG + Intronic
945140383 2:206680209-206680231 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
945166511 2:206952915-206952937 CAGGCAAGAGAGTGTGTGCAAGG + Intronic
946472537 2:219975580-219975602 CAGGCAAGAGAGCATGTACAGGG - Intergenic
946521574 2:220470241-220470263 CAGGCAACAGAACTTGTACAGGG - Intergenic
946824950 2:223668258-223668280 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
948705071 2:239785811-239785833 CAGGCTAGAGAGCATGTGCAGGG - Intronic
949063039 2:241972458-241972480 CAGGCAAGAGAGCCTGTGCAGGG - Intergenic
1170399978 20:15971421-15971443 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1172716804 20:36970329-36970351 CAGGCAAGAGAGTATGTTCAGGG + Intergenic
1172756900 20:37291788-37291810 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1172882889 20:38213229-38213251 CAGGCTGCAGAGGCTGAAGACGG - Exonic
1173341475 20:42156328-42156350 CAGGGTACAGACACTGTACTAGG - Intronic
1173592887 20:44239172-44239194 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1173743978 20:45422426-45422448 AAGGCTGCAGGGTGTGTACAGGG - Intronic
1175052782 20:56170311-56170333 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1175143502 20:56878458-56878480 CAGGCAACAGAGCGTGTGCAGGG - Intergenic
1175252694 20:57619012-57619034 CAGGCTACTGTGTCTGAAAATGG + Intronic
1177387216 21:20424174-20424196 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1177459283 21:21389233-21389255 CAGGCAAGAGAGTGTGTGCACGG + Intronic
1177641375 21:23848123-23848145 GAGACAAGAGAGTCTGTACAGGG - Intergenic
1177695763 21:24568382-24568404 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1177759744 21:25389864-25389886 CAGGCAACAGAGCGTGTGCAGGG - Intergenic
1178741786 21:35207742-35207764 TAGGCTCCAGAGCCTGTACAAGG - Intronic
1179067986 21:38044180-38044202 CAGGCCAGAGAGTGTGTGCAGGG + Intronic
1179068186 21:38046209-38046231 CAGGCAACAGAGCATGTGCAGGG - Intronic
1179962462 21:44776731-44776753 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1181834287 22:25589878-25589900 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
1182173992 22:28264245-28264267 CAGGCAAGAGAGTATGTGCAGGG - Intronic
1182472420 22:30556668-30556690 CAGGTAACACTGTCTGTACAGGG - Intronic
1183279149 22:36922904-36922926 CAGGCTGCACAGTCGGTCCAGGG + Intronic
1183398685 22:37588308-37588330 CAGGCCACACAGTCTTTCCATGG + Intergenic
1183900589 22:41003020-41003042 CAGGCCACAGAGCCAGTAAATGG - Intergenic
949146399 3:705759-705781 CAGGCAAGAGAGCTTGTACAGGG - Intergenic
949203233 3:1406295-1406317 CAGGCAAGAGAGTGTGTATAGGG + Intergenic
950139043 3:10602394-10602416 CAGGCCACACAGTCAGGACATGG + Intronic
950442038 3:13015877-13015899 CAGGCACCAGAGACTGTCCAGGG - Intronic
950606681 3:14087655-14087677 CAGGCAACAGAGCATGTGCAGGG + Intergenic
950806239 3:15605279-15605301 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
950908872 3:16566711-16566733 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
951002606 3:17581143-17581165 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
951024241 3:17813316-17813338 CAGGCAACAGAGCTTGGACAGGG - Intronic
951275904 3:20685742-20685764 CAGGCTACTGAATCTCTAGAGGG + Intergenic
952152796 3:30610604-30610626 CAGGCTACACAGCCAGTACATGG - Intronic
952281500 3:31927833-31927855 CGGGCTACAGACTCTGTGCCTGG - Intronic
952844105 3:37672379-37672401 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
954739015 3:52731963-52731985 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
955036931 3:55277125-55277147 CAGGCAAGAGAGCATGTACAGGG + Intergenic
955100187 3:55841362-55841384 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
955468799 3:59264524-59264546 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
956291854 3:67668859-67668881 CAGGCAAGAGAGTATGTGCAGGG - Intergenic
957336162 3:78831808-78831830 CAGGCAAGAGAGGGTGTACAGGG + Intronic
957457514 3:80471710-80471732 CTGGCAAGAGAGTATGTACAGGG - Intergenic
957457773 3:80473660-80473682 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
957502282 3:81072668-81072690 CAGGCAAAAGAGTGTGTGCAGGG + Intergenic
958801853 3:98765126-98765148 CAGGCTCAAGAGTCTGCACCAGG - Intronic
958908368 3:99966222-99966244 CAGGCTGCAGAGGCTGGGCATGG + Intronic
959719489 3:109470690-109470712 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
960082331 3:113554517-113554539 CAGGCAAGAGAGCGTGTACAGGG - Intronic
961342704 3:126239281-126239303 CAGGCAACAGAGTATGTGCAGGG + Intergenic
961816377 3:129552797-129552819 CAAGCAACAGAGTCTCTGCAGGG + Intergenic
962098203 3:132314314-132314336 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
962460857 3:135611560-135611582 CAGGCAACAGAGCATGTGCAGGG - Intergenic
962461149 3:135613636-135613658 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
964164136 3:153681239-153681261 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
965752473 3:171990387-171990409 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
967770881 3:193332207-193332229 CAGGCAAGAGAGTTTGTGCAGGG - Intronic
967957454 3:194888205-194888227 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
968584909 4:1411816-1411838 CAGGCTGCAGAGCCTAGACATGG - Intergenic
969056437 4:4405654-4405676 CCAGCTCCAGAGTCTGCACAGGG + Intronic
969490188 4:7495250-7495272 CAGGCTCCAGAGCCTGTCCTGGG + Intronic
969783858 4:9436109-9436131 CAGGCAAGAGAGTTTGTGCAGGG + Intergenic
969874086 4:10123280-10123302 CACACCACAGGGTCTGTACAAGG - Intergenic
970146794 4:13044363-13044385 CAGGCAAGAGAGTGTGTTCAGGG + Intergenic
970217492 4:13775537-13775559 CAGGCAAAAGAGTTTGTGCAGGG + Intergenic
970233254 4:13932811-13932833 CAGGCAAAAGCGTGTGTACAGGG + Intergenic
970531732 4:16991899-16991921 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
970671919 4:18406568-18406590 AAGGCTACAGGGTTAGTACAGGG - Intergenic
970739402 4:19216436-19216458 CAGGCAAGAGAGCATGTACAAGG - Intergenic
972523215 4:39881963-39881985 CAGGCAAGAGAGTATGTGCAGGG - Intronic
972817330 4:42657785-42657807 CAGGCTGCAGAGCCTGAACTAGG - Intergenic
974153661 4:58043307-58043329 CAGGCAAAAGAGCTTGTACAGGG - Intergenic
974253128 4:59414803-59414825 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
974455388 4:62123900-62123922 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
974758692 4:66247387-66247409 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
974900250 4:67988017-67988039 CAGGCTAGAGAGCTTGTGCAGGG - Intergenic
975397978 4:73899715-73899737 CAGGCAAGAGAGTGTGTGCAAGG - Intergenic
975899081 4:79128890-79128912 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
976108544 4:81645321-81645343 CAGGCAAGAGAGCCTGTGCAAGG + Intronic
976137198 4:81951232-81951254 CTGGCTGCAGAGGCTGTGCATGG - Intronic
977037777 4:91976690-91976712 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
977073100 4:92417897-92417919 CAGGCAACAGAGCCTGCACAGGG - Intronic
977111877 4:92966643-92966665 CAGGCAAGAGAGTTTGTGCAGGG - Intronic
977139548 4:93350984-93351006 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
977360036 4:95991246-95991268 CAGGCAAGAGAGCTTGTACAGGG + Intergenic
977907375 4:102493631-102493653 CAGGCTCCAGGGTCTCTAAAAGG + Intergenic
978240065 4:106504647-106504669 CAGGCAAAAGAGTCTGTGCCAGG - Intergenic
978715232 4:111834208-111834230 CAGGCAACAGAGTGTGTGCAGGG - Intergenic
978832845 4:113110200-113110222 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
978913127 4:114089360-114089382 CAGGCAAGAAAGTGTGTACAAGG - Intergenic
979218679 4:118195408-118195430 CAGGCAAGAGAGCTTGTACAGGG - Intronic
979442490 4:120767898-120767920 CAGGCAACAGAGCATGTGCAGGG - Intronic
979840724 4:125436694-125436716 CAGGCAAGAGAGCTTGTACAGGG + Intronic
980273293 4:130615305-130615327 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
981549132 4:145925074-145925096 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
981821921 4:148897201-148897223 CAGGCAAGAGAGCCTGTGCAGGG + Intergenic
981857796 4:149315275-149315297 CAGGCAAAAGAGTGTGTGCAGGG - Intergenic
982389776 4:154851836-154851858 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
982390050 4:154853859-154853881 CAGGCAAGAGAGTATGTGCAGGG + Intergenic
983048017 4:163010415-163010437 CAGGCAAGAGAGTATGTACAGGG + Intergenic
983863155 4:172733658-172733680 CAGGCAAGAGAGCATGTACAGGG - Intronic
983874574 4:172861767-172861789 CAGGCAAGAGAGTGTGTACGGGG - Intronic
984269604 4:177535167-177535189 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
984279917 4:177658142-177658164 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
984650685 4:182267508-182267530 CAGGCTAGAAACCCTGTACAGGG - Intronic
986021851 5:3812018-3812040 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
986220379 5:5763591-5763613 CAGGCAAGACAGTGTGTACAGGG - Intergenic
986405772 5:7423519-7423541 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
986407354 5:7439329-7439351 CAGGCAAGAGAGCTTGTACAGGG + Intronic
986848426 5:11782100-11782122 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
986907747 5:12516102-12516124 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
987148664 5:15017297-15017319 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
987262682 5:16219529-16219551 CAGGCGAGAGAGCTTGTACAGGG - Intergenic
987603036 5:20097385-20097407 CAGGCAAGAGAGTATGTGCAGGG + Intronic
987817561 5:22922668-22922690 CAGGCTAGAGAGCATGTGCAGGG + Intergenic
987821061 5:22967364-22967386 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
987893443 5:23913826-23913848 CAGGCAAGAGAGTTTGTGCAAGG + Intergenic
988356861 5:30187789-30187811 CAGGCAAAGGAGTGTGTACAGGG - Intergenic
988858413 5:35252024-35252046 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
989681480 5:44034415-44034437 CAGGCAAGAGAGCCTGTGCAGGG - Intergenic
989793223 5:45432955-45432977 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
989966744 5:50474099-50474121 CAGGCAACAGAGTGTGTGCTGGG - Intergenic
990700935 5:58474526-58474548 CAGGCAAGAGAGTGTGTGCAAGG + Intergenic
990701185 5:58476444-58476466 CAAGCAACAGAGTGTGTGCAGGG + Intergenic
992604810 5:78444380-78444402 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
993208940 5:84922324-84922346 CAGGCAAGAGAGCTTGTACAGGG - Intergenic
993431377 5:87836285-87836307 CAGGCAAGAGAGTTTGTGCAGGG + Intergenic
994762671 5:103876507-103876529 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
995641190 5:114259313-114259335 CAGGCTATGGAAGCTGTACAGGG - Intergenic
995842360 5:116454855-116454877 CAGGCTACAGATTAGGTACCAGG + Intronic
996560198 5:124820254-124820276 CAGGCAAGAGAGCCTGTGCAGGG - Intergenic
996683075 5:126249499-126249521 CAGGCTACATAGTCTATTAAGGG + Intergenic
997656227 5:135556729-135556751 CAGGCAAGAGAGTATGTGCAGGG + Intergenic
998544441 5:143014644-143014666 CAGTCTACAGAGGCTGCCCAGGG - Intronic
999127116 5:149253993-149254015 CAGGCAAGAGAGCTTGTACAGGG + Intronic
999513950 5:152281549-152281571 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
999686223 5:154105718-154105740 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
999911005 5:156199138-156199160 CTGCCTGTAGAGTCTGTACATGG + Intronic
1000238964 5:159391244-159391266 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1000768457 5:165320115-165320137 CAGGCAACAGAGCATGTGCAGGG + Intergenic
1001663888 5:173416549-173416571 CAGGCAAGAGAGTGTTTACAGGG - Intergenic
1001851840 5:174974599-174974621 CAAGCAAGAGAGCCTGTACAGGG + Intergenic
1001938655 5:175725761-175725783 CAGGCAAGAGAGTCTGTGCAGGG + Intergenic
1002843836 6:928442-928464 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1003024741 6:2544134-2544156 CAGGCAAGAGAGTTTGTACAGGG + Intergenic
1003352106 6:5327537-5327559 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1003439096 6:6122826-6122848 CAGGCACCAGTGTCTGGACAAGG - Intergenic
1003857785 6:10293557-10293579 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1004194090 6:13488214-13488236 CAGGCCCCAGAGTCTGGGCACGG + Intergenic
1005902671 6:30231382-30231404 CAGGCTGCAAAATCTGTACGGGG + Intergenic
1006670262 6:35725969-35725991 CAGGGTACAGAGTGTGAGCAGGG - Intronic
1007912280 6:45528046-45528068 CAGGCAAGAGAATGTGTACAGGG + Intronic
1008383091 6:50855797-50855819 CAGGCAAGAGAGCCTGTGCAGGG - Intergenic
1008579164 6:52890217-52890239 CAGGCAAGAGAGTGTGTACAGGG - Intronic
1008751593 6:54740067-54740089 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1009486334 6:64227524-64227546 AAGGTCACACAGTCTGTACATGG - Intronic
1010279098 6:74003272-74003294 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1010347644 6:74830809-74830831 CAGACAAGAGAGTGTGTACAGGG + Intergenic
1010630363 6:78191039-78191061 CAGGCAAGAGAGTGTGTGCAAGG + Intergenic
1010917057 6:81633134-81633156 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
1012297664 6:97545495-97545517 CAGGCAAGAGAGTATGTTCAGGG + Intergenic
1013698602 6:112734356-112734378 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1013819395 6:114136345-114136367 CAGCCAACAGAGTGTGTGCAGGG - Intronic
1014134112 6:117867632-117867654 CAGTCAAGAGAGTGTGTACAGGG + Intergenic
1015400178 6:132779883-132779905 CAGGCAAGAGAGCCTGTGCAAGG + Intronic
1016142368 6:140627996-140628018 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1016151640 6:140748383-140748405 CAGGCAACAGAGCCTGTGCAGGG - Intergenic
1016236327 6:141871720-141871742 CAGGAAACAGAGTGTGTGCAGGG + Intergenic
1016927486 6:149366181-149366203 CAGAATCCAGAGTCTCTACATGG - Intronic
1017084409 6:150700510-150700532 CAGGCTTCAGAGTCTATGAAAGG + Intronic
1019798580 7:3070990-3071012 CAGGCAAGAGAGTGTGTGCAAGG + Intergenic
1019954794 7:4405099-4405121 CAGGCAAGAGAGTATGTGCAGGG + Intergenic
1020015629 7:4829751-4829773 CAGGCGAGAGAGTGTGTTCAGGG - Intronic
1020493675 7:8821384-8821406 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1020493934 7:8823237-8823259 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1020605675 7:10333688-10333710 CAGGTAACAGAGTCTGTCCCAGG - Intergenic
1020942684 7:14561216-14561238 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1021165179 7:17330045-17330067 CAGTGTACAGAGTCTGGACAAGG + Exonic
1021980145 7:26046252-26046274 CAGGATACAGAGTATGGATATGG + Intergenic
1022038762 7:26559371-26559393 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1024220876 7:47285467-47285489 CAGGCAAGAGAGTATGTGCAGGG - Intronic
1026155754 7:67824211-67824233 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1026220250 7:68390069-68390091 CAGGCAAGAGAGCTTGTACAGGG + Intergenic
1026276883 7:68887397-68887419 CAGGCAAGAGAGTTTGTGCAGGG - Intergenic
1026573685 7:71554321-71554343 CAGGCAACAGAGAGTGTGCAGGG - Intronic
1026928551 7:74210292-74210314 AAGGCTACACAGGCTGGACAGGG - Intronic
1030160605 7:106504785-106504807 CAGGCAAGAGAGTATGTGCAGGG + Intergenic
1030808098 7:113941012-113941034 CACCCTGCAGAGTCTGTAGATGG + Intronic
1030990694 7:116296090-116296112 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
1031716073 7:125110061-125110083 CAGGCAAGAGAGCATGTACAGGG + Intergenic
1031818907 7:126473860-126473882 CAGGCAAGAGAGTGTGTTCAGGG - Intronic
1032440223 7:131937105-131937127 CAGGCAAGAGAGCATGTACAGGG - Intergenic
1032876497 7:136044103-136044125 CAGGCAAGAGAGTGTGTGCAAGG - Intergenic
1032962452 7:137052418-137052440 CAGGCAAGAGAGTCTGTGCAAGG - Intergenic
1033385774 7:140873685-140873707 CGTGCTACAGGGTCTGGACAGGG + Intronic
1033491570 7:141848593-141848615 CAGGCTACAGACTCTTTTCCTGG - Intergenic
1034040874 7:147875341-147875363 CAGGCAAGAGATTGTGTACAGGG + Intronic
1035337804 7:158141288-158141310 CAGCCTGCAGTGTCTGCACAGGG + Intronic
1035691182 8:1561127-1561149 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1035840651 8:2809288-2809310 CAGGCAAGAGAGTTTGTGCAGGG + Intergenic
1036008651 8:4695279-4695301 CAGACTATAAAGGCTGTACAGGG - Intronic
1036100909 8:5783645-5783667 CAGGCAAGAGAGTCTGTGCAGGG - Intergenic
1036705355 8:11042466-11042488 CAGACAACAGAGTATGTGCAGGG - Intronic
1036835188 8:12058008-12058030 CAGGCAAGAGAGTTTGTGCAGGG - Intergenic
1036857031 8:12304572-12304594 CAGGCAAGAGAGTTTGTGCAGGG - Intergenic
1036993811 8:13631202-13631224 CAGGCAAGAGAGTGTATACAGGG + Intergenic
1037055951 8:14442320-14442342 CAGGCAAGAGAGTGTGTGCAAGG - Intronic
1037080253 8:14776351-14776373 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1037235980 8:16719977-16719999 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1037388966 8:18372789-18372811 CAGGCAAAAGAGTATGTGCAGGG - Intergenic
1038002057 8:23400358-23400380 CAGGCAAGAGAGCATGTACAGGG + Intronic
1038070396 8:24006713-24006735 CAGGCAAGAGAGTTTGTGCACGG - Intergenic
1038878107 8:31574486-31574508 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1039023514 8:33232679-33232701 CAGGCAAGAGAGTGTGTGCAAGG - Intergenic
1039682210 8:39752802-39752824 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1039902122 8:41760363-41760385 CAGGCAAGAGAGTATGTGCAGGG - Intronic
1040350527 8:46562228-46562250 CAGGCAAGAGAGTGTGTGCATGG - Intergenic
1040532125 8:48274543-48274565 CAGACCTCAGAGACTGTACAGGG - Intergenic
1040813556 8:51482708-51482730 CAGGCAAGAGAGCCTGTGCAGGG - Intronic
1040919802 8:52603836-52603858 CAGGTTACAAACCCTGTACAGGG - Intergenic
1041896823 8:62934577-62934599 CAGGCTGTAGAGTCCTTACAGGG - Intronic
1042001539 8:64127923-64127945 CAGGCAAGAGAGCCTGTGCAGGG + Intergenic
1042868418 8:73376250-73376272 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1044273364 8:90272501-90272523 CAGATTTCAGGGTCTGTACACGG - Intergenic
1044304068 8:90617490-90617512 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1044648471 8:94469341-94469363 CAGGCAAGAGAGTTTGTGCAGGG - Intronic
1044858869 8:96502196-96502218 CAGGCAAGAGAGCTTGTACAGGG + Intronic
1046249538 8:111611944-111611966 CAGGCACCAGGGTCTGGACAAGG + Intergenic
1046734679 8:117764537-117764559 CAGGCAAGAGAGCCTGTGCAGGG - Intergenic
1047084981 8:121506229-121506251 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1047528953 8:125657983-125658005 CACGGTACAGATTCTATACATGG - Intergenic
1047623324 8:126630777-126630799 CAGGCTTCATAGTCTTCACAAGG - Intergenic
1048525890 8:135202057-135202079 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1048773811 8:137923388-137923410 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1049539984 8:143204107-143204129 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1049676505 8:143891585-143891607 CAGGCTACAGGGTCTGTCCTGGG - Intergenic
1051361393 9:16284775-16284797 CAGGCAAGAGAATCTGTGCAGGG - Intergenic
1051914906 9:22197165-22197187 CAGGCAACAGAGGGTGTACAGGG - Intergenic
1052023713 9:23552645-23552667 GAGGCCACAGAGTTTGTACATGG + Intergenic
1052526973 9:29630473-29630495 CAGGCAAGAGAGTTTGTGCAGGG - Intergenic
1052557246 9:30033086-30033108 CAGGCAACAGAGCATGTGCAGGG + Intergenic
1055413060 9:76052443-76052465 CAGGCAAGAGAGTGTGTGCAGGG + Intronic
1055754026 9:79537928-79537950 CAGACAACAGAGTGTGTACAGGG - Intergenic
1055774239 9:79751138-79751160 CAGGCAAGAGAGTGTGTTCAAGG + Intergenic
1055890779 9:81121776-81121798 CAGGCAAGAGAATGTGTACAGGG - Intergenic
1056092386 9:83217582-83217604 CAGGCAAGAGAGTGTGTGCAAGG - Intergenic
1057318916 9:93994115-93994137 CAGTCCACAGAGGCTGTGCATGG - Intergenic
1057583754 9:96311152-96311174 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1058047289 9:100370275-100370297 CAGGCAAGAGAGCTTGTACAGGG + Intergenic
1058189165 9:101891913-101891935 CAGTTTACAGAGGCTGTGCACGG + Intergenic
1058583818 9:106485768-106485790 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1059054197 9:110961749-110961771 CAGGCAAGAGAGTGTGTACAGGG + Intronic
1059501284 9:114756390-114756412 CAGGATCCAGAGGCTGAACAAGG + Intergenic
1059971739 9:119675607-119675629 GAGGTCACAGAGTCAGTACAGGG + Intergenic
1061260734 9:129479597-129479619 CACGCTACAGAGTCACTACAGGG - Intergenic
1061436029 9:130562703-130562725 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1185673554 X:1830749-1830771 CAGGCAAGAGAGAGTGTACAGGG + Intergenic
1185699941 X:2223284-2223306 CAGGCAAGAGAGTGTGTGCAGGG - Intronic
1185886328 X:3786615-3786637 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1185924190 X:4128340-4128362 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1185931037 X:4203692-4203714 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1185952849 X:4455597-4455619 CAGGCAAGAGAGCCTGTGCAGGG - Intergenic
1185958368 X:4518085-4518107 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1186067069 X:5777627-5777649 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1186169183 X:6859078-6859100 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1186263506 X:7806668-7806690 CAGGCTACAGATTCAGTGAATGG + Intergenic
1186313992 X:8349332-8349354 CAGGCAAGAGAGCATGTACAGGG + Intergenic
1186926344 X:14336895-14336917 CAGGCAAGAGAGCGTGTACAGGG + Intergenic
1187678772 X:21744924-21744946 CTGGCAACAGAGCTTGTACAAGG - Intronic
1187726795 X:22211848-22211870 CAGGCAAGAGAGCTTGTACAGGG + Intronic
1187796323 X:23007707-23007729 CAGGCAAGAGAGCTTGTACAGGG + Intergenic
1188467720 X:30500934-30500956 CAGGATACAGAGACTGACCAAGG + Intergenic
1190973363 X:55374852-55374874 CAGGCAAGAGAGCATGTACAGGG + Intergenic
1193511394 X:82404585-82404607 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1193516115 X:82466447-82466469 CAGGCAAGAGAGCTTGTACAGGG + Intergenic
1193566197 X:83080089-83080111 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1193939636 X:87665392-87665414 CAGTCTACACAGTCTCTATATGG - Intronic
1194870365 X:99124270-99124292 CAGGCAAGAGAGTATGTGCAGGG - Intergenic
1194959947 X:100223780-100223802 CAGGCTGCAGAGGCTGTAGGAGG - Intergenic
1196371047 X:114980277-114980299 CAGGCAAGAGAGTGTGTATAGGG + Intergenic
1196455701 X:115890044-115890066 CGGGCTAAGGAGTCTGTAAATGG + Intergenic
1196616786 X:117775513-117775535 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1197371798 X:125635979-125636001 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1198578097 X:138032879-138032901 CAGGCAAGAGAGCCTGTGCAGGG - Intergenic
1198590435 X:138174595-138174617 CAGGCAAGAGGGTATGTACAGGG + Intergenic
1198883574 X:141308078-141308100 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1198966762 X:142236118-142236140 CAGGCAAGAGAGTGTATACAGGG - Intergenic
1199003166 X:142663884-142663906 CAGGCCAAAGAGCCTGTGCAGGG - Intergenic
1199177415 X:144806986-144807008 CAGGATAGAGAGTGTGTGCAGGG + Intergenic
1199182621 X:144876515-144876537 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1199203713 X:145123635-145123657 CAGGCGAGAGAGTTTGTACAGGG + Intergenic
1199683508 X:150243812-150243834 CAGGCAAGAGAGTGTGTGCAGGG + Intergenic
1199795023 X:151186206-151186228 CAGGCAAGAGAGTATGTGCAGGG + Intergenic
1200777845 Y:7185638-7185660 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic
1201510059 Y:14749294-14749316 CAGGCTGCACAGTGTGTCCAGGG - Intronic
1201559529 Y:15301377-15301399 CAGGCAAGAGAGTGTGTGCAGGG - Intergenic