ID: 928923478

View in Genome Browser
Species Human (GRCh38)
Location 2:36551701-36551723
Sequence CTGTGTAAGTACATGTATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928923478 Original CRISPR CTGTGTAAGTACATGTATCT GGG Intronic
900293776 1:1938304-1938326 GTGTGTGAGTGCATGTATGTGGG - Intronic
900978214 1:6030824-6030846 ATGTGTAAGTATATGTGTGTAGG + Intronic
901864945 1:12099695-12099717 GTGTGTAAGTACACTAATCTAGG - Intronic
903197120 1:21699032-21699054 CTGTGCATGTACATGCATTTGGG - Intronic
903803700 1:25989173-25989195 CTGTCTAAATACATGTCTTTGGG - Intronic
905008472 1:34730193-34730215 CTGTGTATGCACATCTATTTGGG - Intronic
905652001 1:39662804-39662826 CTTTGTCAGTACTTGCATCTGGG + Intronic
906006154 1:42472933-42472955 ATGTGTATGTATATATATCTTGG - Intronic
910028917 1:82691961-82691983 CTGTGTACGGACAGGAATCTAGG - Intergenic
910354266 1:86337516-86337538 TTGAATAAGTACATGTATATGGG - Intergenic
912244766 1:107949723-107949745 CTGTGTGTGTACATGTACTTTGG - Intronic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
913693291 1:121300129-121300151 ATTTGTATGCACATGTATCTAGG - Intronic
914144264 1:144979951-144979973 ATTTGTATGCACATGTATCTAGG + Intronic
918165055 1:181937051-181937073 CTGTGTAAGTTCAGCTCTCTGGG + Intergenic
918775240 1:188620417-188620439 CTGTGGAAGTAAATGGAACTGGG + Intergenic
919444010 1:197678190-197678212 CTCTGTAATTACATGTGTCATGG - Intronic
920480613 1:206318498-206318520 ATTTGTATGCACATGTATCTAGG - Intronic
922226133 1:223647329-223647351 CTGTGAAATTACAACTATCTGGG - Intronic
1063482380 10:6386910-6386932 CTGTGTATGTGCCTGTATGTGGG - Intergenic
1066999776 10:42598682-42598704 CAGTGTAATTCCCTGTATCTCGG - Intronic
1068865621 10:61892596-61892618 CTATATCAGTGCATGTATCTGGG - Intergenic
1069605850 10:69738120-69738142 CTGTGAAAGTCCAGGTTTCTGGG + Intergenic
1071853555 10:89600213-89600235 CTGTGTAAGCACCTCTTTCTTGG - Intronic
1072785974 10:98282546-98282568 CTGTGTGTGTACATGTGTGTTGG + Intergenic
1073588547 10:104734084-104734106 GTGTGTGAGTAGATGTATGTTGG + Intronic
1073982416 10:109169556-109169578 CTGTGTAAGTTAATGTAAGTTGG - Intergenic
1076283150 10:129267504-129267526 CAGTGTAGGTACATTTATATGGG + Intergenic
1076535842 10:131176417-131176439 CTCTGTGTGTACATGTGTCTTGG - Intronic
1076535851 10:131176641-131176663 CTCTGTGTGTACATGTGTCTTGG - Intronic
1079162357 11:18006875-18006897 CTGTGTATGTTCATGTATTCTGG + Intronic
1079641143 11:22806981-22807003 ATGGGTAAGTACATGAATCATGG + Intronic
1081513152 11:43796424-43796446 CTGTATTAGTACATGATTCTGGG + Intronic
1082230572 11:49760910-49760932 TTGTCTAAGGTCATGTATCTAGG + Intergenic
1084503824 11:69553005-69553027 CTGTCAAGGTACATGTGTCTGGG + Intergenic
1085137368 11:74104500-74104522 ATGTGTATGTACATGTATGGGGG + Intronic
1086619481 11:88868060-88868082 TTGTCTAAGGTCATGTATCTAGG - Intronic
1087401350 11:97670348-97670370 CTGTGTGTGTGCATGTATGTAGG - Intergenic
1088156259 11:106807572-106807594 GCTAGTAAGTACATGTATCTAGG - Intronic
1092581976 12:9851674-9851696 ATTTGTAACTACATTTATCTAGG + Intergenic
1095170171 12:39025751-39025773 CTGTTTGAGTACATTTATATGGG + Intergenic
1097501868 12:60413166-60413188 CTATGCAACTATATGTATCTAGG + Intergenic
1098527868 12:71507429-71507451 CTGTGTCTGTGCATGTGTCTGGG + Intronic
1101287622 12:103331791-103331813 CTATTTAATTCCATGTATCTAGG - Intronic
1104929608 12:132331263-132331285 CTGTGTATGCACATGTGTGTAGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106951470 13:34889219-34889241 TTGTGTAAGTTCAGGAATCTAGG - Intergenic
1107387819 13:39931553-39931575 ATGTCTAAGTACATGGATATAGG + Intergenic
1108425854 13:50299430-50299452 ATGTGTGTGTACATGTATATGGG - Intronic
1109528607 13:63608794-63608816 CTGTGTATGTATATGTGTTTTGG + Intergenic
1112511743 13:100015912-100015934 CTGGGAAAGTACTTTTATCTAGG - Intergenic
1112542101 13:100324372-100324394 CTGTGCAGGTCCATTTATCTTGG + Intronic
1113354018 13:109560823-109560845 ATGTATCTGTACATGTATCTAGG + Intergenic
1113354020 13:109560850-109560872 ATGTATCTGTACATGTATCTGGG + Intergenic
1113354022 13:109560877-109560899 ATGTATCTGTACATGTATCTGGG + Intergenic
1113354024 13:109560904-109560926 ATGTATCTGTACATGTATCTGGG + Intergenic
1114287384 14:21257929-21257951 ATGTTTAGGTAGATGTATCTTGG - Intronic
1115629194 14:35226871-35226893 GTGTGTTAGTGCATGTCTCTAGG - Intronic
1118107686 14:62678751-62678773 CTGTGTAACTACAAGTATTTTGG - Intergenic
1118826378 14:69386535-69386557 CTGTGTAAGTACGTATATTTTGG - Intronic
1125770163 15:42159873-42159895 CTCTGTGGGAACATGTATCTAGG + Exonic
1126360272 15:47838392-47838414 CTATGTATTTACATTTATCTGGG + Intergenic
1127034298 15:54897921-54897943 GTGTGTCAGCACATATATCTAGG - Intergenic
1127110018 15:55658905-55658927 TTGTGTAAATACATCTAACTGGG - Intronic
1127197024 15:56598521-56598543 CTGTGAAAGAACATTCATCTCGG + Intergenic
1127604517 15:60573005-60573027 CTGAGTAAGTACATGAGTGTGGG + Intronic
1129217756 15:74110063-74110085 CTTTTTAAATACATGTATTTAGG + Intronic
1129840678 15:78741635-78741657 CTTTTTAAGTACATTTATTTAGG - Intergenic
1130836082 15:87651452-87651474 CTCTGTATGTACACGTATGTGGG + Intergenic
1131493237 15:92881127-92881149 CTGTGTAAGGGAATGTCTCTTGG + Intergenic
1133012910 16:2924861-2924883 CTGTTGAAGCACATGTGTCTTGG + Intronic
1135853275 16:25983789-25983811 CTGTGTGAGTCCATGATTCTGGG - Intronic
1138056884 16:53844423-53844445 CTTTATAAGAACATGTAACTAGG + Intronic
1138242345 16:55437250-55437272 CTGTGTGAGTAAATGGATTTAGG + Intronic
1140722940 16:77787863-77787885 CTGTGTATGTGCATGCATGTTGG + Intergenic
1141909849 16:87051219-87051241 GTGTGTGTGTACATGTATGTTGG + Intergenic
1142321322 16:89384833-89384855 GTGTGTAAGAACATGTGTGTGGG + Intronic
1143693444 17:8590702-8590724 CTGTGTAAGTAAATGAATAAAGG - Intronic
1143755918 17:9067512-9067534 CTGTGTAAATTAATGTATCCCGG - Intronic
1145977974 17:28995328-28995350 CTGTGTGTGTGCATGTATGTGGG + Intronic
1145990829 17:29078545-29078567 GTGTGTTAGTTCATGCATCTGGG + Exonic
1146134963 17:30311585-30311607 CTGTATATGTACATATATGTGGG + Intergenic
1147664192 17:42135613-42135635 ATGTGTAAGTCCATGAATGTGGG + Intronic
1148746807 17:49922953-49922975 TTGTGTGTGTACATGTGTCTGGG + Intergenic
1153212327 18:2780712-2780734 TGGTGTAAGTACTTGTATCATGG + Intronic
1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG + Intronic
1155195183 18:23467577-23467599 CTGTGTAAATTCATTAATCTTGG - Intronic
1155456983 18:26028049-26028071 CTGATTAAGGACTTGTATCTAGG + Intronic
1155783366 18:29868350-29868372 GTGTGTGGGTATATGTATCTAGG + Intergenic
1156499436 18:37547849-37547871 CTGTGTGAGGGTATGTATCTGGG + Intronic
1158282896 18:55847288-55847310 GTGTGTAAGTAAATTCATCTTGG - Intergenic
1158738387 18:60110474-60110496 GTAGGTAAGTACATGAATCTGGG + Intergenic
1159249098 18:65850465-65850487 CTCTGTAAATACATGTAGCGAGG + Intronic
1159363748 18:67438657-67438679 CTGTGTGAGGACATCTAACTTGG - Intergenic
1162530406 19:11232773-11232795 CTGTGTAGGTATATGCATGTGGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
933556154 2:83833405-83833427 ATGTGTACGTATATGTATATAGG - Intergenic
933600428 2:84323724-84323746 TTGTGTAAGTACAGTGATCTGGG + Intergenic
934638142 2:96009728-96009750 CTGTCTAAGGAAAGGTATCTGGG - Intergenic
936162700 2:110096694-110096716 GTGTGTAGGTACATTTTTCTTGG - Intronic
939014718 2:136888973-136888995 GTGTGTGTGTACATGTATTTAGG + Intronic
939949215 2:148448380-148448402 CTGTGTCTGAATATGTATCTAGG - Intronic
942082769 2:172416924-172416946 CTGTGGAAGTAAAGCTATCTTGG - Intergenic
944497965 2:200327758-200327780 TTGTGAAAGCAAATGTATCTAGG + Intronic
944965871 2:204932661-204932683 CTTTGGAAGTAAATGTGTCTAGG + Intronic
946756166 2:222949964-222949986 CTGTGTCAGTACATATATAATGG + Intergenic
946820161 2:223620772-223620794 CTGTGAGAGTACATGTATTAAGG - Intergenic
1171283468 20:23919786-23919808 ATGTGTACATACATGTATGTGGG - Intergenic
1172278752 20:33695633-33695655 CTGTCTAAGTTCATGGAACTTGG - Intergenic
1174980317 20:55387130-55387152 CCTTGTAAGTACCTGGATCTAGG + Intergenic
1175024193 20:55884167-55884189 CTGTTTCAGTACATGTATAGAGG + Intergenic
1176979662 21:15366477-15366499 CTTTTTCAGTAAATGTATCTGGG + Intergenic
1179191441 21:39125671-39125693 GTGTGTGAGTACATGTGTGTTGG - Intergenic
1181488165 22:23244689-23244711 CTCAGTAAGTACATTTGTCTGGG + Intronic
1183186972 22:36297647-36297669 ATGTGTAAGGACATTTGTCTAGG + Intronic
1183708571 22:39489401-39489423 CTCTGTAAGTAGATGCATTTGGG + Exonic
1183807261 22:40221830-40221852 CTGGGTAAGGACAGGTATTTGGG - Intronic
949248998 3:1960131-1960153 CTGTGTAGTTGCATTTATCTTGG - Intergenic
950824645 3:15805000-15805022 CTACGTAAGTACATGTGTGTTGG - Intronic
951045742 3:18036277-18036299 CTGTGTTAGGACATGGCTCTTGG + Intronic
951991577 3:28681039-28681061 CTGTATATGTATGTGTATCTAGG + Intergenic
952796136 3:37241155-37241177 CTGTGTTTGTACATATATGTGGG - Intergenic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
954891609 3:53935516-53935538 CAGTGTGAGTAAATGTATGTAGG + Intergenic
956488464 3:69746346-69746368 CAGTGTAAAAAAATGTATCTTGG + Intronic
959764944 3:110014385-110014407 TTATATAAGTACATGTAACTTGG + Intergenic
961666237 3:128494642-128494664 GTGTGTATGTGCATGTATCTAGG + Intergenic
961983841 3:131111012-131111034 CTGTGTACATACATTTATATTGG + Intronic
965185836 3:165461987-165462009 CTGTCAAAGGACATGTATGTGGG + Intergenic
970692659 4:18637633-18637655 ATGTGTGTGTACATGTATCTTGG + Intergenic
976165423 4:82249303-82249325 GTGTGTGAGTATATTTATCTTGG - Intergenic
978339808 4:107710340-107710362 CAGTGTAAGTATGTGTACCTAGG + Intronic
979991869 4:127384333-127384355 ATGTGTATGTATATGTATATAGG - Intergenic
980294135 4:130888405-130888427 CTGTGTAAGGACAAGTGTCCTGG - Intergenic
980676100 4:136083614-136083636 CTGTGTAAATATCTGTATCAAGG + Intergenic
983003890 4:162458126-162458148 CTGTGTAAGAAAAGGTTTCTGGG + Intergenic
983332896 4:166354185-166354207 CTGTGTAAGTACATGTAGGATGG + Intergenic
983893829 4:173059926-173059948 CAGTTTGAATACATGTATCTTGG - Intergenic
986186341 5:5444702-5444724 CTATCTAAATACATGTTTCTTGG - Intronic
987953626 5:24708108-24708130 GTGTGTATGTATATGTATTTAGG + Intergenic
988163792 5:27556387-27556409 ATGTGTATGTGTATGTATCTGGG + Intergenic
988175705 5:27721992-27722014 CTGTGTAAGAACAACTATTTGGG - Intergenic
988843255 5:35103965-35103987 CTGTGTAAGTGCATGTGCCCAGG + Intronic
989207082 5:38821620-38821642 ATGTGTATATACATGTATATAGG - Intergenic
989323572 5:40165061-40165083 CTGTGTAGGTTCAAGTCTCTGGG - Intergenic
989367508 5:40673383-40673405 GTGTGTATCTACATGTATATAGG + Intergenic
989819287 5:45775753-45775775 CTCTGTGAGTACATGTATATGGG - Intergenic
990242090 5:53826028-53826050 CTGTGTGATTACATTTATATGGG + Intergenic
990482975 5:56229551-56229573 TTGTGCAAGTTCATGTAACTAGG + Intronic
995887476 5:116912302-116912324 CTGTGTAAGTATATTTTTCAGGG + Intergenic
997098819 5:130945199-130945221 CTCTGAAAGAAAATGTATCTAGG + Intergenic
997170425 5:131713696-131713718 CTGTTTAATTGCATGTATATTGG - Intronic
998542769 5:142998497-142998519 CTGTGTTTGTAAATGTATGTTGG + Intronic
1000433730 5:161182153-161182175 CTTTGTAGTTATATGTATCTAGG - Intergenic
1001209035 5:169793196-169793218 CTGTGTAAGCATATGCATTTTGG - Intronic
1002948150 6:1782220-1782242 CTTTTTAAATACATGTAACTGGG - Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004123705 6:12851594-12851616 CTGTGTAATTACATATATGCCGG - Intronic
1005725667 6:28645307-28645329 CTGTGTGTATACATGTATATAGG + Intergenic
1007052311 6:38844684-38844706 CTGAGCAACTAGATGTATCTGGG - Intronic
1009995575 6:70891776-70891798 GTGTGTGTGTACATGTAACTTGG + Intronic
1011437191 6:87351098-87351120 CTGTTCAAGTACATGACTCTAGG + Intronic
1012058450 6:94446080-94446102 CTGTGTCAGTTGATGTTTCTGGG - Intergenic
1013914334 6:115316662-115316684 ATGTGTACATACATGTATGTGGG + Intergenic
1015369267 6:132432960-132432982 CTGTGGAGGTACATGACTCTGGG - Intergenic
1016345323 6:143106816-143106838 ATCTGTAAGTACCTTTATCTTGG - Intronic
1020688527 7:11326103-11326125 CAGTGCAAGTACATGTTTCCAGG + Intergenic
1024340071 7:48248441-48248463 CAGTGTAAGTACATGTTTGGTGG + Exonic
1024534977 7:50422931-50422953 CTGAGTGTGTACATGTAGCTGGG - Intergenic
1030515893 7:110537294-110537316 CTGTGTTAGTAGGTTTATCTTGG + Intergenic
1030653300 7:112138981-112139003 CTGTGCAGGTACATTGATCTTGG + Intronic
1032425124 7:131816443-131816465 CTGTGTAAACACATGTGTATGGG + Intergenic
1032632142 7:133664942-133664964 TTTTGTAAGTACATGCATTTTGG + Intronic
1034210095 7:149355936-149355958 CTGAGTAAGTGCAGGGATCTGGG + Intergenic
1037436762 8:18871151-18871173 CTGTGTTCATACATGTATGTCGG + Intronic
1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG + Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1039620194 8:38989907-38989929 CTGTGTATGTAGATTTTTCTGGG + Exonic
1043068509 8:75607786-75607808 TGGTGTATGAACATGTATCTGGG - Intergenic
1044087876 8:87963515-87963537 ATGTGTAAGTATATATGTCTAGG + Intergenic
1046273692 8:111928821-111928843 CTGTGTAAGTGTATTTATCCTGG - Intergenic
1050485487 9:6129977-6129999 TTGTTTAAGTACATTTATTTAGG - Intergenic
1051375247 9:16395769-16395791 ATGTGTAAGTACATTTTCCTTGG - Intergenic
1052374028 9:27697646-27697668 TTGTCAAAGTACATGGATCTTGG - Intergenic
1052614644 9:30822016-30822038 CTGTGGAAGTAATTGAATCTTGG + Intergenic
1056804345 9:89717168-89717190 GTGTGTGAGTATATGTATGTGGG - Intergenic
1058661206 9:107271024-107271046 CTGTGTAAGTTCAGGTACCTGGG - Intergenic
1059196801 9:112378319-112378341 TAGTGTAAGTACAGGTATTTAGG + Intergenic
1060116587 9:120946190-120946212 GTGTGTATGTGCATGTTTCTGGG + Intergenic
1060575507 9:124688810-124688832 GTGTTTATGTACATGTATTTAGG + Intronic
1194746272 X:97631824-97631846 CTGAGAAAGTATATGTATATCGG - Intergenic
1197136260 X:123063462-123063484 CTGTGTAAATAAATATATATGGG - Intergenic
1202365883 Y:24164394-24164416 CTGTGGCAGTAAATGTATCCTGG + Intergenic
1202504899 Y:25505728-25505750 CTGTGGCAGTAAATGTATCCTGG - Intergenic