ID: 928924020

View in Genome Browser
Species Human (GRCh38)
Location 2:36557866-36557888
Sequence ACAAAGATAATGCACCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928924020_928924021 18 Left 928924020 2:36557866-36557888 CCTTGAAGGTGCATTATCTTTGT 0: 1
1: 0
2: 1
3: 11
4: 243
Right 928924021 2:36557907-36557929 TATCCCAAGTGCCCAGATCATGG 0: 1
1: 0
2: 2
3: 42
4: 297
928924020_928924024 23 Left 928924020 2:36557866-36557888 CCTTGAAGGTGCATTATCTTTGT 0: 1
1: 0
2: 1
3: 11
4: 243
Right 928924024 2:36557912-36557934 CAAGTGCCCAGATCATGGCCTGG 0: 1
1: 0
2: 3
3: 34
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928924020 Original CRISPR ACAAAGATAATGCACCTTCA AGG (reversed) Intronic
908445835 1:64198836-64198858 AAAAAGATAATGCAGTTTAATGG + Intergenic
908744896 1:67367064-67367086 ACAAAGATTAGGCACCTTTGAGG + Intronic
910640537 1:89456641-89456663 ACAAAGGGAATGAACTTTCAGGG + Intergenic
910796005 1:91098618-91098640 ACACAGATAATGCCAGTTCAGGG - Intergenic
911784803 1:101932845-101932867 ACAAAGATCATCAACATTCAAGG + Intronic
912187061 1:107290546-107290568 ACAAATATAATACACTTTTAAGG - Intronic
912886485 1:113480156-113480178 ACAAAGATCATGAATCATCAGGG - Intronic
913241088 1:116829927-116829949 TCAGAAATAATGCACATTCAAGG - Intergenic
913695951 1:121325846-121325868 ACACAGGGAAAGCACCTTCACGG - Intronic
914141613 1:144954213-144954235 ACACAGGGAAAGCACCTTCACGG + Intronic
915180884 1:154058643-154058665 ACAAAGATCATAGACCTCCAAGG + Exonic
917056997 1:170994032-170994054 ACAGTGACAATGCATCTTCATGG - Intronic
917387948 1:174498005-174498027 TCTAAGGTAATGCACTTTCAGGG - Intronic
917544011 1:175943588-175943610 ATAAAGATAATGCACGATGAAGG - Intergenic
919085462 1:192916210-192916232 TCATAGATATTGCAACTTCAAGG + Intergenic
920483277 1:206344214-206344236 ACACAGGGAAAGCACCTTCACGG - Intronic
922423837 1:225476221-225476243 ACACTGAAAATGAACCTTCATGG - Intergenic
923195951 1:231667479-231667501 ACAAAGATGAAGCACATCCAGGG - Intronic
924702497 1:246468172-246468194 AAAAAGATAATTCACCATGATGG + Intronic
1063026547 10:2184492-2184514 CCAAAGATATTTCACCCTCAAGG + Intergenic
1063823597 10:9867212-9867234 AGAAAGATAATTCATGTTCATGG - Intergenic
1064325451 10:14347008-14347030 ACAAATACAATGCTCCTTGAGGG - Intronic
1066224211 10:33366473-33366495 ACAAATATAATGCAACATCAAGG + Intergenic
1066515663 10:36157460-36157482 AAAAACACAATGAACCTTCATGG + Intergenic
1066958362 10:42194834-42194856 ACAAAGATTATACATATTCATGG + Intergenic
1067464549 10:46487885-46487907 ACAAAGATAATGCTCACTGAAGG - Intergenic
1067622646 10:47896768-47896790 ACAAAGATAATGCTCACTGAAGG + Intergenic
1068540692 10:58291853-58291875 ACAAAGGTACTGCAAGTTCAGGG - Intergenic
1069701036 10:70426231-70426253 AAAAAGATATTGCATCTTTAAGG - Exonic
1070817214 10:79332082-79332104 GGAGAGATAATGCACCTTCTGGG + Intergenic
1071605912 10:86989107-86989129 GGAAAGATATTCCACCTTCATGG - Intergenic
1074698362 10:116071263-116071285 ACAGAGACAAAGCATCTTCAGGG - Intronic
1075170928 10:120113553-120113575 ACAGAGAAAATACACTTTCAAGG - Intergenic
1076346708 10:129784361-129784383 ACAAACATAATGCATTTCCATGG - Intergenic
1076386593 10:130061680-130061702 ACAAAGATGAAGCACTTTAAAGG + Intergenic
1078647416 11:13154068-13154090 ACACAGCTAATGCATTTTCAAGG + Intergenic
1078663117 11:13303119-13303141 ATAAAGAAAATGAGCCTTCAAGG + Intronic
1078862120 11:15258421-15258443 ACAATTATAAAGAACCTTCAAGG - Intergenic
1080107925 11:28530736-28530758 ACAAAAATAATATATCTTCATGG - Intergenic
1080400609 11:31931816-31931838 ACAACTATCATGCTCCTTCAAGG - Intronic
1080555443 11:33411988-33412010 AGAAAGATGTTTCACCTTCAAGG - Intergenic
1081711317 11:45217903-45217925 ACAAAGATGATCCACCTGTAAGG + Intronic
1082185747 11:49178556-49178578 AAAAAAATAATGCACATACATGG + Intronic
1084388198 11:68857514-68857536 ATAAAGTTAATGAACCTTAATGG - Intergenic
1086245636 11:84748817-84748839 ACAAAGATTATCTTCCTTCAGGG + Intronic
1086361081 11:86060201-86060223 ACTAAAAAAATGCACCTTTAGGG - Intronic
1086680575 11:89666785-89666807 AAAAAAATAATGCACATACATGG - Intergenic
1086738518 11:90337981-90338003 ATAAAGATCATATACCTTCAAGG - Intergenic
1087918666 11:103840434-103840456 ACACAGATATTTCACATTCATGG + Intergenic
1088637307 11:111835274-111835296 ATAAAGATAATGCTCCTTTTGGG - Intronic
1089860984 11:121589899-121589921 AAAGAGATAAGGCAGCTTCATGG - Intronic
1090476178 11:127023037-127023059 ATAAAGAAAATCCACCTTCAAGG + Intergenic
1093552683 12:20434111-20434133 ACAAAGATAAAGCATGTTAATGG - Intronic
1094012845 12:25827234-25827256 TCTTAGATTATGCACCTTCACGG + Intergenic
1095722602 12:45416936-45416958 GCAAATCTAATGCATCTTCAAGG - Intronic
1096172871 12:49487535-49487557 TTAAAAATATTGCACCTTCAGGG - Intronic
1096752609 12:53771588-53771610 AGAAAAATAATGGACCTACATGG - Intergenic
1097063482 12:56302932-56302954 ATTAAGATAATGCACATTCCAGG - Intronic
1098013892 12:66083778-66083800 ACCACCATAATACACCTTCAAGG - Intergenic
1098049247 12:66436116-66436138 ACAAAGATAAAGCAAAATCAGGG - Intronic
1098996325 12:77125041-77125063 ACAAAGATAATGCCCCATGTGGG - Intergenic
1100049523 12:90429557-90429579 AGAAAGAAAATACCCCTTCAGGG - Intergenic
1100781259 12:98029149-98029171 ACAAAAATAATTCACTTTCTGGG + Intergenic
1101531654 12:105578935-105578957 ATTGTGATAATGCACCTTCATGG - Intergenic
1102522734 12:113488751-113488773 ACAGAGGAAATGCACCTTCAGGG + Intergenic
1102853474 12:116273323-116273345 AGAAAGAAAATGAACCATCATGG + Intronic
1104209124 12:126670311-126670333 ACAAACATAATGAACTTTAATGG - Intergenic
1104383908 12:128332433-128332455 AGAAAGAGAATACATCTTCAAGG - Intronic
1104495696 12:129235973-129235995 AGAAAGATATTCCACGTTCATGG - Intronic
1107261869 13:38501651-38501673 AGAAATATTTTGCACCTTCAAGG - Intergenic
1110173489 13:72530404-72530426 AAACAGATAATCCAACTTCATGG + Intergenic
1110385960 13:74911228-74911250 TCAAGGAAAATGTACCTTCAAGG + Intergenic
1111815332 13:93145888-93145910 ACAAAGTGAATGCATCTTTAGGG - Intergenic
1112378698 13:98867993-98868015 ACAGAGATGTTTCACCTTCATGG - Exonic
1114397781 14:22382655-22382677 TCAAAGATATGGCAACTTCATGG + Intergenic
1114972064 14:28043908-28043930 ACAAAGAAATTGCAATTTCAGGG - Intergenic
1115492132 14:33967761-33967783 ATAAAGTGAAGGCACCTTCAGGG - Intronic
1119054509 14:71405547-71405569 AGAAAGAGAATGCCCCTTCTGGG + Intronic
1119267115 14:73269430-73269452 ACAAAAATAATGCATCTTACAGG - Intronic
1120800810 14:88686428-88686450 ATAAAGAAAATGCACCCTCTGGG + Intronic
1202934763 14_KI270725v1_random:77048-77070 ACAAAGATTATACATATTCATGG - Intergenic
1123692525 15:22850450-22850472 GGAACGATAATGCACCTTAATGG + Intronic
1125699858 15:41672599-41672621 ACAAAGATAATGCTATTTCTTGG - Intronic
1126059338 15:44764542-44764564 ACAAAGACCATACACCTGCAAGG - Intronic
1126892582 15:53222425-53222447 AGAAAGATAAGGCAGCATCAGGG + Intergenic
1127030808 15:54859872-54859894 ACAAGGATTATGAACTTTCAGGG + Intergenic
1131588177 15:93718588-93718610 ACAGAGATCATGGACATTCAAGG + Intergenic
1132509534 16:331695-331717 ACAAAGATAAAGCATTTCCATGG - Intronic
1132509981 16:335142-335164 ACAAAGATAAAGCATTTCCATGG - Intronic
1133700172 16:8301292-8301314 ACAAAGAGCATAAACCTTCAAGG - Intergenic
1135627147 16:24005906-24005928 TCAAAAATAATGCTCCTTCCAGG + Intronic
1136018353 16:27422171-27422193 AAAAAGACACTTCACCTTCAAGG - Intronic
1142833226 17:2564914-2564936 CCACAGGTAATGCAGCTTCAGGG - Intergenic
1143838364 17:9711116-9711138 ATAAAGATAATGTATCTTTATGG + Intronic
1144075467 17:11715720-11715742 ACAAAGAAAATGCAATGTCATGG + Intronic
1148519248 17:48253988-48254010 AATGAGATTATGCACCTTCAGGG + Intronic
1148729191 17:49820810-49820832 ACAAAGGGAATGCACTTGCAGGG + Intronic
1151807206 17:76413252-76413274 ACAATGTTAATGCAGCTTGATGG + Intronic
1155536000 18:26818937-26818959 ACAAAGATAAAGAACAATCAAGG - Intergenic
1155742842 18:29311513-29311535 ACCAGGATAATGTACCTTCAAGG - Intergenic
1157698300 18:49742566-49742588 ACAAAAATAATTCACTTACAAGG - Intergenic
1157997547 18:52576904-52576926 ACAAATATAATGCTCATTGAAGG - Intronic
1158119741 18:54035894-54035916 AAAAAGTTAATGAACCTTGAAGG + Intergenic
1158685459 18:59610216-59610238 ATAAAGCTAATGCACCTGCTTGG - Intronic
1158868581 18:61661953-61661975 ACAAAGATAATTGACTTTCAGGG - Intergenic
1167882540 19:52472217-52472239 ACAATAATAATGCACCATTAGGG - Intronic
925978001 2:9154634-9154656 ACAAAGATAATTAGCCTCCAAGG + Intergenic
926466994 2:13203521-13203543 ACAAAGAGATTGCATCTACAAGG - Intergenic
928739039 2:34328120-34328142 ACAATAATAATGGACCTACATGG + Intergenic
928791521 2:34961239-34961261 AAAAAGATAGGGCATCTTCATGG + Intergenic
928924020 2:36557866-36557888 ACAAAGATAATGCACCTTCAAGG - Intronic
933316149 2:80718156-80718178 ACAAAGATAATGCAGATGAATGG + Intergenic
933536734 2:83584844-83584866 ACAGAGATAATACAATTTCAGGG + Intergenic
934306484 2:91827249-91827271 ACAAAGATTATACATATTCATGG + Intergenic
934326772 2:92025493-92025515 ACAAAGATTATACATATTCATGG - Intergenic
934465146 2:94256041-94256063 ACAAAGATTATACATATTCATGG - Intergenic
935882740 2:107582451-107582473 AAAAAAATAATGCAGCTTCATGG + Intergenic
937447167 2:121968216-121968238 ACGCAGCTAATGCTCCTTCATGG + Intergenic
940574123 2:155478231-155478253 ACAAGGAGAATCCAACTTCAAGG + Intergenic
941851251 2:170183984-170184006 GCAAAGATAATGCAACATTAGGG - Intronic
941938111 2:171002617-171002639 ACAAAGAAAATGCAGCTTTCTGG - Intronic
942205132 2:173612480-173612502 ACTGAGATAATGCCCCTTCTTGG + Intergenic
943463804 2:188203343-188203365 ACAAAGATTATGAAACTACAAGG - Intergenic
944595163 2:201254570-201254592 ACAAAGGGCATGCACATTCAGGG + Intronic
947221707 2:227799870-227799892 AAAACAATAATGAACCTTCAAGG - Intergenic
1169917032 20:10693481-10693503 ACAATGCTAATGCTGCTTCAAGG - Intergenic
1169966556 20:11224244-11224266 CCAAAGTGAATGCACCTTCCAGG + Intergenic
1172558105 20:35860655-35860677 ACAAAGAAAAAGCATCATCAGGG - Intronic
1176596177 21:8699261-8699283 ACAAAGATTATACATATTCATGG - Intergenic
1177371326 21:20207630-20207652 ACACACAAAATGCTCCTTCAGGG - Intergenic
1177846080 21:26288568-26288590 ACATAGATACTGCAAGTTCATGG + Intergenic
1178830108 21:36048871-36048893 ACAAAAATTAGGCACCATCATGG - Intronic
1179299900 21:40098313-40098335 ACAAAACTAATGGAACTTCAAGG + Intronic
1180065888 21:45412097-45412119 GGAAAGAGAATGCACCTGCAGGG - Intronic
1180279088 22:10676709-10676731 ACAAAGATTATACATATTCATGG - Intergenic
1181763101 22:25071530-25071552 ACAAAAATAATGCATGTGCATGG + Intronic
1183403006 22:37615771-37615793 ATAAAGTAAATGCACCTTCTTGG + Intronic
949500840 3:4678726-4678748 ACAAAGCCCATGCACCTTAAAGG - Intronic
951144245 3:19207188-19207210 TCAAAGATAATGAAGCATCAGGG + Intronic
952151730 3:30600856-30600878 ACAAAGCTAGTGCAGATTCAAGG + Intergenic
953699057 3:45181971-45181993 ACAAAGGAAATGCAGCTTCCAGG + Intergenic
953968022 3:47325154-47325176 AAGAAAATGATGCACCTTCAAGG - Intronic
956495201 3:69818197-69818219 ACAAAGTTCATGCAACTTAAGGG + Intronic
956599324 3:71002375-71002397 ACAACAGTGATGCACCTTCAAGG + Intronic
957582393 3:82091074-82091096 ACAGAGATAATGCAGCATTAGGG + Intergenic
957838099 3:85626419-85626441 AGAAAGATAATTACCCTTCATGG - Intronic
960295778 3:115941961-115941983 ACAAAGATTATACATATTCAAGG - Intronic
962211848 3:133486225-133486247 AAAAAGATCAGGCCCCTTCAGGG + Intergenic
963273253 3:143306149-143306171 ACAATGCTAATGCACCATCAGGG + Intronic
963341721 3:144043373-144043395 ATAAAAATAATGCAATTTCAGGG - Intronic
963942651 3:151110547-151110569 ACCAAAAAAATGCACCTTGATGG - Intronic
965406714 3:168277924-168277946 ACAAAAATTCTTCACCTTCATGG - Intergenic
967031503 3:185611580-185611602 ACAGAGATAATGCATATTAATGG + Intronic
967099346 3:186203435-186203457 ACAAAGGTAATCCAAATTCATGG - Intronic
968740382 4:2326667-2326689 ACAAAGATATTCCATGTTCATGG - Intronic
970689481 4:18606089-18606111 ACAAAGATATTGCACATTTAAGG + Intergenic
970763735 4:19521700-19521722 ACAAAGGTATTGCATCTGCATGG + Intergenic
970827126 4:20289526-20289548 AAAAAGAAAACACACCTTCATGG - Intronic
971762401 4:30783417-30783439 AAAAAGATAATGAATATTCATGG + Intronic
972942224 4:44210172-44210194 AGAAAGAGAATACACTTTCAGGG - Intronic
974683245 4:65192241-65192263 ACAAATATAGTACACCTTTATGG + Intergenic
974803563 4:66851158-66851180 ACAAAGATAATGTGCCTTGATGG - Intergenic
975935342 4:79572916-79572938 ACCAATATAATGCATCTTCCAGG - Intergenic
976782906 4:88781318-88781340 ACAAAGAAAATACTCCTTCTGGG - Exonic
978370383 4:108024030-108024052 AAAAACATAATGCAACTTCCCGG - Intronic
981429389 4:144643031-144643053 ACAAACATAATTCACATACATGG + Intergenic
981674615 4:147327344-147327366 ACATAGATATTGAACATTCAAGG - Intergenic
983994770 4:174168758-174168780 ACAAAGATACTGCATATTCCTGG - Intergenic
984574979 4:181437612-181437634 TCAAAAATATTCCACCTTCAAGG - Intergenic
984979987 4:185271115-185271137 ACAAAAGGAATGCACCTTCCTGG - Intronic
986759828 5:10869805-10869827 AAACAGATAATGCCCTTTCATGG + Intergenic
987269555 5:16292407-16292429 ACACGGATACTTCACCTTCAAGG - Intergenic
987283376 5:16433589-16433611 AATAGGATAATGAACCTTCATGG - Intergenic
987303168 5:16615613-16615635 CCAAAGTTAATTCACTTTCAGGG + Intronic
987942349 5:24556085-24556107 ACAAAAATAATGCAAATTTAAGG + Intronic
991015585 5:61928783-61928805 CCAAAGACCATGTACCTTCAGGG + Intergenic
991517831 5:67458920-67458942 AGAAACATAATGAACCTGCATGG - Intergenic
993049488 5:82910134-82910156 CAAAAGATATTGGACCTTCATGG - Intergenic
995765013 5:115604907-115604929 ACAAAGATAATTCACATTCAAGG + Intronic
995906183 5:117126746-117126768 ACAAAGATATTCCATGTTCAAGG - Intergenic
996289253 5:121832114-121832136 AGGAAGAGAATGCACCTCCAAGG + Intergenic
996833583 5:127766966-127766988 ACAAAAATTAGGCAACTTCAGGG - Intergenic
996918369 5:128737146-128737168 AAAAAGAAACAGCACCTTCAAGG + Intronic
996985649 5:129560421-129560443 ACAAAGATAATGCCTGTTCAAGG - Intronic
997066905 5:130571417-130571439 ACAAAAATAATGCTACTTTAAGG + Intergenic
997855510 5:137369158-137369180 ACAAAGGCAATGCTCCTTGATGG + Intronic
999182823 5:149681906-149681928 ATAAAGAGACTGCACCTCCAGGG + Intergenic
999869184 5:155731393-155731415 ACAAAAATAATGTGTCTTCAGGG - Intergenic
1000245068 5:159442299-159442321 ATAAAGATAATGCAGGGTCAAGG + Intergenic
1000781620 5:165489946-165489968 ACAAAAATAATGAACATTTATGG + Intergenic
1001128788 5:169046134-169046156 ACAAAAATAAGGCACCTTTTGGG - Intronic
1004495464 6:16158893-16158915 ACAAAGATAATACCTGTTCATGG + Intergenic
1007262098 6:40571119-40571141 ACAATTATAATGCACCATGATGG - Intronic
1008282112 6:49609191-49609213 CCGAAGTGAATGCACCTTCAAGG + Intronic
1011240085 6:85262514-85262536 ATGAAGGTGATGCACCTTCAAGG + Intergenic
1011479802 6:87782744-87782766 TCAAAAGTAATTCACCTTCATGG + Intergenic
1011541158 6:88431804-88431826 CTAAAGATAATGCTCCTTCTTGG + Intergenic
1011907934 6:92395687-92395709 ATAAAGATACTCTACCTTCAAGG - Intergenic
1012057741 6:94435997-94436019 AAAAATATAATGAATCTTCATGG - Intergenic
1012280588 6:97323293-97323315 AAAAAGCTAATGCACTTGCATGG - Intergenic
1012293598 6:97491028-97491050 AGGAAGATAATGGAGCTTCAAGG - Intergenic
1013922838 6:115429666-115429688 ACAAAGATAATTTATATTCAAGG - Intergenic
1014860936 6:126467703-126467725 ATGCAGATACTGCACCTTCAAGG + Intergenic
1017080765 6:150666163-150666185 ATAAATATAATGCAGCTTCCTGG + Intronic
1018253268 6:161893379-161893401 ACAAAGCTAACTCAACTTCATGG - Intronic
1020153973 7:5706522-5706544 ACACAGATAAACCACCTTGAGGG - Intronic
1020200961 7:6079650-6079672 ATAAACATAAAGCACATTCAGGG - Intergenic
1021336825 7:19413400-19413422 GCAAAAATAATGAACATTCACGG - Intergenic
1021588541 7:22236541-22236563 ACAAATCTCAGGCACCTTCATGG + Intronic
1025096652 7:56100870-56100892 ACAGAGCAAAAGCACCTTCAGGG + Intergenic
1028006943 7:85584842-85584864 ACAAAGATAAGCCATATTCATGG + Intergenic
1028702947 7:93804169-93804191 AGAAAGATAATCCACATTTATGG + Intronic
1030147980 7:106375622-106375644 ACAAAGTGAATGTACCTTTACGG + Intergenic
1030853686 7:114523509-114523531 ACAAAGATTATGACCCTGCATGG - Intronic
1030905631 7:115178605-115178627 ACAGAGACACTGCAGCTTCAAGG - Intergenic
1031003743 7:116448166-116448188 AGAGAGATAATGCAGCTTAATGG - Intronic
1031271947 7:119662397-119662419 ACAAAGATATTCCATATTCATGG + Intergenic
1037049378 8:14350828-14350850 ACAATAATAATGCAAGTTCATGG - Intronic
1038946146 8:32362234-32362256 ACAAAGATTATAAACCATCAGGG - Intronic
1039761981 8:40586561-40586583 ACAAAAGTGATGCATCTTCAAGG - Intronic
1042145462 8:65723966-65723988 ACAAGGATAAAGCAAGTTCAGGG + Intronic
1042712037 8:71728331-71728353 ACAAAGAAAATTCACATTAATGG - Intergenic
1045095882 8:98798048-98798070 TCAAAGAGACTTCACCTTCATGG + Intronic
1046620433 8:116523590-116523612 AAAAAGGGAATGGACCTTCATGG + Intergenic
1047467109 8:125127648-125127670 ACAAAGATAAGGCAGATACAGGG - Intronic
1048854597 8:138675624-138675646 ACAAAGTAAATGCACTTTTAAGG + Intronic
1050188689 9:3002106-3002128 TCAAAGGTAATGCGACTTCATGG - Intergenic
1050845425 9:10211292-10211314 GGAAAAATAATGCATCTTCAAGG + Intronic
1052257432 9:26474747-26474769 ACCAAGATAAGGCACTTACAAGG + Intergenic
1052277681 9:26695927-26695949 ACACATATAAGGCACCATCAAGG + Intergenic
1053695219 9:40632835-40632857 ACAAAGATTATACATATTCATGG - Intergenic
1054306463 9:63432060-63432082 ACAAAGATTATACATATTCATGG - Intergenic
1054405202 9:64756052-64756074 ACAAAGATTATACATATTCATGG - Intergenic
1054438827 9:65241542-65241564 ACAAAGATTATACATATTCATGG - Intergenic
1054491577 9:65780404-65780426 ACAAAGATTATACATATTCATGG + Intergenic
1055638763 9:78303039-78303061 ACAGAAATAATGCACATTTATGG + Intronic
1058033717 9:100227815-100227837 ACAAAGATAATGCCAGTGCAAGG - Intronic
1058254441 9:102743541-102743563 ACCAAGAGAATGCCCCTCCAGGG - Intergenic
1058652960 9:107194273-107194295 TCAAAGACAATGCACTTTCTAGG + Intergenic
1058922600 9:109631738-109631760 AGAAAGAGAATGCACCTCTAAGG + Intergenic
1059641899 9:116225564-116225586 ATAAATATTATGCAACTTCATGG - Intronic
1202777661 9_KI270717v1_random:6453-6475 ACAAAGATTATACATATTCATGG - Intergenic
1185907770 X:3952328-3952350 AGAAAGACAATGCAGATTCATGG + Intergenic
1186358604 X:8814116-8814138 ATAAAAACAAAGCACCTTCAAGG + Intergenic
1190086333 X:47398419-47398441 ACAAAGGAAATCCACCATCATGG - Intronic
1194046585 X:89013508-89013530 ACAAAGATAAAGCAAAATCAGGG + Intergenic
1194835957 X:98683105-98683127 CCAAAGAAAATGCACCATTATGG - Intergenic
1195090662 X:101455595-101455617 AAAAAGATAATGCTCCTCCATGG + Intronic
1196047678 X:111273372-111273394 TCAAAGATCATGCTCCTTGATGG + Intergenic
1196384823 X:115138057-115138079 CCCAAGATATGGCACCTTCAAGG + Intronic
1198567444 X:137918863-137918885 ACACAGATAAAGAACCTTCCAGG + Intergenic
1199914288 X:152322292-152322314 ACATAGAGAATGCAAATTCATGG + Intronic
1200385482 X:155886063-155886085 AAAAAGATAATGCAACATAAAGG - Intronic
1200874829 Y:8142670-8142692 ACAATGTAAATGAACCTTCATGG - Intergenic
1200934928 Y:8730070-8730092 TCAAAGCTGATGCACCTCCACGG + Intergenic
1201193001 Y:11464737-11464759 ACAAAGATTATACATATTCATGG - Intergenic