ID: 928935232

View in Genome Browser
Species Human (GRCh38)
Location 2:36669454-36669476
Sequence TTCAAGGGAAGCTGTCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928935232_928935245 25 Left 928935232 2:36669454-36669476 CCACCACGACAGCTTCCCTTGAA No data
Right 928935245 2:36669502-36669524 CCCATCTGAGGGGAGATTATGGG No data
928935232_928935239 13 Left 928935232 2:36669454-36669476 CCACCACGACAGCTTCCCTTGAA No data
Right 928935239 2:36669490-36669512 CCTGTCTCCTGACCCATCTGAGG No data
928935232_928935240 14 Left 928935232 2:36669454-36669476 CCACCACGACAGCTTCCCTTGAA No data
Right 928935240 2:36669491-36669513 CTGTCTCCTGACCCATCTGAGGG No data
928935232_928935243 24 Left 928935232 2:36669454-36669476 CCACCACGACAGCTTCCCTTGAA No data
Right 928935243 2:36669501-36669523 ACCCATCTGAGGGGAGATTATGG No data
928935232_928935248 27 Left 928935232 2:36669454-36669476 CCACCACGACAGCTTCCCTTGAA No data
Right 928935248 2:36669504-36669526 CATCTGAGGGGAGATTATGGGGG No data
928935232_928935247 26 Left 928935232 2:36669454-36669476 CCACCACGACAGCTTCCCTTGAA No data
Right 928935247 2:36669503-36669525 CCATCTGAGGGGAGATTATGGGG No data
928935232_928935241 15 Left 928935232 2:36669454-36669476 CCACCACGACAGCTTCCCTTGAA No data
Right 928935241 2:36669492-36669514 TGTCTCCTGACCCATCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928935232 Original CRISPR TTCAAGGGAAGCTGTCGTGG TGG (reversed) Intergenic