ID: 928935233

View in Genome Browser
Species Human (GRCh38)
Location 2:36669457-36669479
Sequence TGCTTCAAGGGAAGCTGTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928935233_928935241 12 Left 928935233 2:36669457-36669479 CCACGACAGCTTCCCTTGAAGCA No data
Right 928935241 2:36669492-36669514 TGTCTCCTGACCCATCTGAGGGG No data
928935233_928935247 23 Left 928935233 2:36669457-36669479 CCACGACAGCTTCCCTTGAAGCA No data
Right 928935247 2:36669503-36669525 CCATCTGAGGGGAGATTATGGGG No data
928935233_928935243 21 Left 928935233 2:36669457-36669479 CCACGACAGCTTCCCTTGAAGCA No data
Right 928935243 2:36669501-36669523 ACCCATCTGAGGGGAGATTATGG No data
928935233_928935248 24 Left 928935233 2:36669457-36669479 CCACGACAGCTTCCCTTGAAGCA No data
Right 928935248 2:36669504-36669526 CATCTGAGGGGAGATTATGGGGG No data
928935233_928935239 10 Left 928935233 2:36669457-36669479 CCACGACAGCTTCCCTTGAAGCA No data
Right 928935239 2:36669490-36669512 CCTGTCTCCTGACCCATCTGAGG No data
928935233_928935245 22 Left 928935233 2:36669457-36669479 CCACGACAGCTTCCCTTGAAGCA No data
Right 928935245 2:36669502-36669524 CCCATCTGAGGGGAGATTATGGG No data
928935233_928935240 11 Left 928935233 2:36669457-36669479 CCACGACAGCTTCCCTTGAAGCA No data
Right 928935240 2:36669491-36669513 CTGTCTCCTGACCCATCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928935233 Original CRISPR TGCTTCAAGGGAAGCTGTCG TGG (reversed) Intergenic