ID: 928935235

View in Genome Browser
Species Human (GRCh38)
Location 2:36669469-36669491
Sequence GGAGGCTTCCTTTGCTTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928935235_928935251 28 Left 928935235 2:36669469-36669491 CCCTTGAAGCAAAGGAAGCCTCC No data
Right 928935251 2:36669520-36669542 ATGGGGGTATGAGGAAGTGTGGG No data
928935235_928935239 -2 Left 928935235 2:36669469-36669491 CCCTTGAAGCAAAGGAAGCCTCC No data
Right 928935239 2:36669490-36669512 CCTGTCTCCTGACCCATCTGAGG No data
928935235_928935247 11 Left 928935235 2:36669469-36669491 CCCTTGAAGCAAAGGAAGCCTCC No data
Right 928935247 2:36669503-36669525 CCATCTGAGGGGAGATTATGGGG No data
928935235_928935240 -1 Left 928935235 2:36669469-36669491 CCCTTGAAGCAAAGGAAGCCTCC No data
Right 928935240 2:36669491-36669513 CTGTCTCCTGACCCATCTGAGGG No data
928935235_928935241 0 Left 928935235 2:36669469-36669491 CCCTTGAAGCAAAGGAAGCCTCC No data
Right 928935241 2:36669492-36669514 TGTCTCCTGACCCATCTGAGGGG No data
928935235_928935249 19 Left 928935235 2:36669469-36669491 CCCTTGAAGCAAAGGAAGCCTCC No data
Right 928935249 2:36669511-36669533 GGGGAGATTATGGGGGTATGAGG No data
928935235_928935250 27 Left 928935235 2:36669469-36669491 CCCTTGAAGCAAAGGAAGCCTCC No data
Right 928935250 2:36669519-36669541 TATGGGGGTATGAGGAAGTGTGG No data
928935235_928935245 10 Left 928935235 2:36669469-36669491 CCCTTGAAGCAAAGGAAGCCTCC No data
Right 928935245 2:36669502-36669524 CCCATCTGAGGGGAGATTATGGG No data
928935235_928935243 9 Left 928935235 2:36669469-36669491 CCCTTGAAGCAAAGGAAGCCTCC No data
Right 928935243 2:36669501-36669523 ACCCATCTGAGGGGAGATTATGG No data
928935235_928935248 12 Left 928935235 2:36669469-36669491 CCCTTGAAGCAAAGGAAGCCTCC No data
Right 928935248 2:36669504-36669526 CATCTGAGGGGAGATTATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928935235 Original CRISPR GGAGGCTTCCTTTGCTTCAA GGG (reversed) Intergenic