ID: 928935236

View in Genome Browser
Species Human (GRCh38)
Location 2:36669470-36669492
Sequence AGGAGGCTTCCTTTGCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928935236_928935251 27 Left 928935236 2:36669470-36669492 CCTTGAAGCAAAGGAAGCCTCCT No data
Right 928935251 2:36669520-36669542 ATGGGGGTATGAGGAAGTGTGGG No data
928935236_928935248 11 Left 928935236 2:36669470-36669492 CCTTGAAGCAAAGGAAGCCTCCT No data
Right 928935248 2:36669504-36669526 CATCTGAGGGGAGATTATGGGGG No data
928935236_928935241 -1 Left 928935236 2:36669470-36669492 CCTTGAAGCAAAGGAAGCCTCCT No data
Right 928935241 2:36669492-36669514 TGTCTCCTGACCCATCTGAGGGG No data
928935236_928935250 26 Left 928935236 2:36669470-36669492 CCTTGAAGCAAAGGAAGCCTCCT No data
Right 928935250 2:36669519-36669541 TATGGGGGTATGAGGAAGTGTGG No data
928935236_928935249 18 Left 928935236 2:36669470-36669492 CCTTGAAGCAAAGGAAGCCTCCT No data
Right 928935249 2:36669511-36669533 GGGGAGATTATGGGGGTATGAGG No data
928935236_928935245 9 Left 928935236 2:36669470-36669492 CCTTGAAGCAAAGGAAGCCTCCT No data
Right 928935245 2:36669502-36669524 CCCATCTGAGGGGAGATTATGGG No data
928935236_928935240 -2 Left 928935236 2:36669470-36669492 CCTTGAAGCAAAGGAAGCCTCCT No data
Right 928935240 2:36669491-36669513 CTGTCTCCTGACCCATCTGAGGG No data
928935236_928935239 -3 Left 928935236 2:36669470-36669492 CCTTGAAGCAAAGGAAGCCTCCT No data
Right 928935239 2:36669490-36669512 CCTGTCTCCTGACCCATCTGAGG No data
928935236_928935247 10 Left 928935236 2:36669470-36669492 CCTTGAAGCAAAGGAAGCCTCCT No data
Right 928935247 2:36669503-36669525 CCATCTGAGGGGAGATTATGGGG No data
928935236_928935243 8 Left 928935236 2:36669470-36669492 CCTTGAAGCAAAGGAAGCCTCCT No data
Right 928935243 2:36669501-36669523 ACCCATCTGAGGGGAGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928935236 Original CRISPR AGGAGGCTTCCTTTGCTTCA AGG (reversed) Intergenic