ID: 928935240

View in Genome Browser
Species Human (GRCh38)
Location 2:36669491-36669513
Sequence CTGTCTCCTGACCCATCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928935235_928935240 -1 Left 928935235 2:36669469-36669491 CCCTTGAAGCAAAGGAAGCCTCC No data
Right 928935240 2:36669491-36669513 CTGTCTCCTGACCCATCTGAGGG No data
928935233_928935240 11 Left 928935233 2:36669457-36669479 CCACGACAGCTTCCCTTGAAGCA No data
Right 928935240 2:36669491-36669513 CTGTCTCCTGACCCATCTGAGGG No data
928935236_928935240 -2 Left 928935236 2:36669470-36669492 CCTTGAAGCAAAGGAAGCCTCCT No data
Right 928935240 2:36669491-36669513 CTGTCTCCTGACCCATCTGAGGG No data
928935232_928935240 14 Left 928935232 2:36669454-36669476 CCACCACGACAGCTTCCCTTGAA No data
Right 928935240 2:36669491-36669513 CTGTCTCCTGACCCATCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928935240 Original CRISPR CTGTCTCCTGACCCATCTGA GGG Intergenic
No off target data available for this crispr