ID: 928935968

View in Genome Browser
Species Human (GRCh38)
Location 2:36678271-36678293
Sequence GAGGGCATGGTGACCTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928935963_928935968 -3 Left 928935963 2:36678251-36678273 CCATTACATCTGGCCTTTTGGAG No data
Right 928935968 2:36678271-36678293 GAGGGCATGGTGACCTCTGCAGG No data
928935960_928935968 24 Left 928935960 2:36678224-36678246 CCAAGCATGAGGTGGACAGAGAA No data
Right 928935968 2:36678271-36678293 GAGGGCATGGTGACCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928935968 Original CRISPR GAGGGCATGGTGACCTCTGC AGG Intergenic
No off target data available for this crispr