ID: 928937146

View in Genome Browser
Species Human (GRCh38)
Location 2:36690549-36690571
Sequence CTACTATTCAACATCTCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928937146_928937149 19 Left 928937146 2:36690549-36690571 CCTCTAGAGATGTTGAATAGTAG No data
Right 928937149 2:36690591-36690613 TGTTGAATTCCTGATGTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928937146 Original CRISPR CTACTATTCAACATCTCTAG AGG (reversed) Intergenic
No off target data available for this crispr