ID: 928937478

View in Genome Browser
Species Human (GRCh38)
Location 2:36694202-36694224
Sequence TAACCATGATGAGCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928937478 Original CRISPR TAACCATGATGAGCTGCTAC TGG (reversed) Intergenic
912489399 1:110053603-110053625 AATCCATGGGGAGCTGCTACAGG + Intronic
1065984010 10:30931196-30931218 CAACCATCTTGAGCTGCTAGTGG + Intronic
1069717259 10:70529253-70529275 GATCCATGATGAGCTGCTCAAGG + Exonic
1085836638 11:79963517-79963539 GAACCATGGTGAGCTGCTGGGGG + Intergenic
1088053402 11:105546394-105546416 TAACCATCACAAGCTTCTACAGG + Intergenic
1088321285 11:108556845-108556867 TAAGCATGATGAGAAGCTGCTGG - Intronic
1088795318 11:113262513-113262535 TAACCCTGCTGTGCTGCTTCTGG + Intronic
1093300417 12:17446512-17446534 TAACCAAGGTGAGCTGATCCAGG - Intergenic
1096322617 12:50628612-50628634 TAAGCATGATGAACTGCTGAGGG - Intronic
1098038935 12:66334877-66334899 TCCCCATGATGACCTCCTACTGG - Intronic
1098094605 12:66941601-66941623 TTACCGTGAGGAGCTGCTACAGG + Intergenic
1101295820 12:103422932-103422954 TAACCATGATAAAATGCTACAGG - Intronic
1101765713 12:107697239-107697261 TAACCATGCTGTGCTGCTGCTGG - Intronic
1103104630 12:118212821-118212843 TTGTCATGATGAGCTGCCACAGG + Intronic
1106840074 13:33677676-33677698 TCACCATGGTGAACTGCTTCAGG - Intergenic
1112898759 13:104334427-104334449 TAATTATGTTGAGCTGCTCCTGG + Intergenic
1114814649 14:25943079-25943101 TAATAATGAGAAGCTGCTACAGG - Intergenic
1120094515 14:80373828-80373850 TAAACATGCTGAGCTCCTCCCGG - Intronic
1121029992 14:90649977-90649999 TAGGCATGCTGGGCTGCTACTGG + Intronic
1139067386 16:63334826-63334848 TAACCACAATGAACTGCTAATGG + Intergenic
1140748693 16:78003716-78003738 TATTCATGATGAGTTTCTACAGG - Intergenic
1144081611 17:11768688-11768710 TAGCCATGCGGGGCTGCTACTGG - Intronic
1147922877 17:43929132-43929154 TTCCCATGATGAGGTGCTTCTGG + Intergenic
1151517205 17:74604305-74604327 TCTCCCTGATGAGCTGCAACAGG + Intergenic
1155569819 18:27180683-27180705 TGATCATGATGAACTGCTAAAGG - Intronic
928937478 2:36694202-36694224 TAACCATGATGAGCTGCTACTGG - Intergenic
929299121 2:40281799-40281821 TAACCATCATTAGCTGATTCCGG - Intronic
933562230 2:83902050-83902072 TAACCCTGAAGAGCTTCTAGTGG + Intergenic
938421602 2:131151576-131151598 TGACCAGGATGAGCTGCCGCTGG + Intronic
938934240 2:136115309-136115331 CAACCATGATGTGCTGAAACTGG + Exonic
941218152 2:162739514-162739536 GAACCATGCTGAGCTGTTGCTGG + Intronic
944784342 2:203052978-203053000 TAACCAAGATGTCCTGCAACAGG - Intronic
1168853072 20:989796-989818 GAACCAAGATAAGCAGCTACAGG + Intronic
1172522085 20:35574101-35574123 TAACCATTAGGAGCTCCTTCAGG + Intergenic
1172608941 20:36235078-36235100 TAATCACAATGAGCTGCTGCAGG - Intergenic
1175359461 20:58396954-58396976 TAACTCTAATGAGCTGATACTGG - Intronic
1175587423 20:60153459-60153481 TAATCAGGATGAGTTGATACTGG - Intergenic
1180136239 21:45863658-45863680 TAGACAAGATGAGATGCTACCGG - Intronic
1184808919 22:46815718-46815740 CAACATGGATGAGCTGCTACAGG - Intronic
952432992 3:33243793-33243815 TAACCAAGATGTTCTCCTACAGG + Intergenic
953837337 3:46358163-46358185 TGACCATGATGAGCAGCGGCAGG - Exonic
954308020 3:49741419-49741441 TAATCATGTTGATGTGCTACTGG + Intronic
956949953 3:74271144-74271166 TAACCATGATTAGATGAAACTGG + Intronic
958639135 3:96781724-96781746 TAACCAAGATGACATGATACTGG + Intergenic
960390314 3:117070215-117070237 TAAGCTTGATGAGATTCTACTGG - Intronic
960402165 3:117214305-117214327 TCACCATGATAAGCTACAACAGG + Intergenic
961987419 3:131152688-131152710 TTACCTTGATGAGCAGCTACAGG + Exonic
963042984 3:141082864-141082886 TGACCATGATGAGCTGCACCAGG + Intronic
963043009 3:141083027-141083049 AGACCATGATGAGCTGCACCAGG + Intronic
964798468 3:160526453-160526475 TAACCTTGATGCTCTGATACGGG - Intronic
966298676 3:178454027-178454049 AAACCATAATGAGGTACTACTGG - Intronic
966515844 3:180820528-180820550 TATCCATGATGAGCTGGCAGTGG - Intronic
967441945 3:189518237-189518259 GAACCAGGGTGAGCTGCTACGGG + Intergenic
975374987 4:73632707-73632729 TAACCATGCTGAGCTCCCAAGGG - Intergenic
986105976 5:4659866-4659888 TTACAATGTTGAGCTGCTAATGG - Intergenic
991337617 5:65566599-65566621 TAAACATGACGAGCTGTTTCAGG - Intronic
994302441 5:98161343-98161365 TAACCTTTATGAGCTGAGACTGG + Intergenic
995579219 5:113576990-113577012 TAACCATGTTGAGTTGATTCTGG + Intronic
998153495 5:139770666-139770688 TAATCATGATGAGCTAGGACAGG + Intergenic
1000976317 5:167768561-167768583 TAACCATTATGAGCTCCTGATGG - Intronic
1002789746 6:428339-428361 GAACCAGGATGCCCTGCTACAGG + Intergenic
1005867376 6:29946238-29946260 TAACCATGATGAGAAACTATGGG - Intergenic
1006153922 6:32004015-32004037 CCACCATGCTGAGCAGCTACTGG - Intergenic
1006160230 6:32036752-32036774 CCACCATGCTGAGCAGCTACTGG - Intergenic
1009998331 6:70921895-70921917 TAACGCTGATGGGCTGGTACTGG + Intronic
1017225965 6:152021632-152021654 CAAACATGATGAGATGTTACGGG + Intronic
1027794717 7:82678207-82678229 TCACCATCAAAAGCTGCTACAGG - Intergenic
1035713352 8:1735392-1735414 TAACCATGAAGAGATTGTACAGG + Intergenic
1039411503 8:37358934-37358956 TAACCACAAAGTGCTGCTACAGG + Intergenic
1042704974 8:71656676-71656698 GAACCAAGATTAGCTTCTACAGG - Intergenic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1060601327 9:124880158-124880180 TCACCATGTAGCGCTGCTACTGG - Exonic
1192167556 X:68835243-68835265 TTACCATGGTGACCTGCTTCAGG + Intronic
1195732957 X:107983876-107983898 TTACAATGATCAGCTGTTACTGG - Intergenic
1196768136 X:119268256-119268278 AAAACATGATGAGATGCTGCTGG - Intergenic
1198032077 X:132762847-132762869 TAACCATGATGCTCTGTTGCTGG - Intronic
1198373830 X:136017797-136017819 TCACCCAGATGAGCTGCTCCAGG - Intronic