ID: 928942554

View in Genome Browser
Species Human (GRCh38)
Location 2:36741463-36741485
Sequence CCTGAGTAGCAAAGATTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 152}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928942542_928942554 15 Left 928942542 2:36741425-36741447 CCCCTCGGTTCCCAGCAGAAGTT 0: 1
1: 0
2: 0
3: 11
4: 99
Right 928942554 2:36741463-36741485 CCTGAGTAGCAAAGATTGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 152
928942547_928942554 4 Left 928942547 2:36741436-36741458 CCAGCAGAAGTTCCCTGTTGGCC 0: 1
1: 0
2: 0
3: 16
4: 263
Right 928942554 2:36741463-36741485 CCTGAGTAGCAAAGATTGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 152
928942546_928942554 5 Left 928942546 2:36741435-36741457 CCCAGCAGAAGTTCCCTGTTGGC 0: 1
1: 0
2: 2
3: 17
4: 142
Right 928942554 2:36741463-36741485 CCTGAGTAGCAAAGATTGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 152
928942549_928942554 -9 Left 928942549 2:36741449-36741471 CCTGTTGGCCCAGCCCTGAGTAG 0: 1
1: 0
2: 0
3: 13
4: 188
Right 928942554 2:36741463-36741485 CCTGAGTAGCAAAGATTGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 152
928942544_928942554 13 Left 928942544 2:36741427-36741449 CCTCGGTTCCCAGCAGAAGTTCC 0: 1
1: 0
2: 1
3: 10
4: 170
Right 928942554 2:36741463-36741485 CCTGAGTAGCAAAGATTGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 152
928942543_928942554 14 Left 928942543 2:36741426-36741448 CCCTCGGTTCCCAGCAGAAGTTC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 928942554 2:36741463-36741485 CCTGAGTAGCAAAGATTGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 152
928942548_928942554 -8 Left 928942548 2:36741448-36741470 CCCTGTTGGCCCAGCCCTGAGTA 0: 1
1: 0
2: 2
3: 14
4: 146
Right 928942554 2:36741463-36741485 CCTGAGTAGCAAAGATTGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928942554 Original CRISPR CCTGAGTAGCAAAGATTGTC TGG Intronic
902088754 1:13885017-13885039 CCTGAGAGGCAGAGATTGTAGGG - Intergenic
904918829 1:33990538-33990560 CCAGAGCAGCAAAGAGTGTGAGG - Intronic
908326867 1:63031654-63031676 TGTGAGTAGAAAAGAATGTCTGG + Intergenic
909833222 1:80220835-80220857 CCGGAGCAGCAAAGAGTTTCAGG - Intergenic
910791975 1:91060744-91060766 CCTGAGTAGCAAGGATTAACAGG - Intergenic
911698199 1:100918377-100918399 CCTGAGTAGCTGGGATTGTGGGG - Intronic
919935875 1:202250528-202250550 CCTGAGTAGCTAAGATTACAGGG + Intronic
920196821 1:204233463-204233485 CCTGAGTAGCTAAGATTACAGGG + Intronic
1063695346 10:8329843-8329865 CCAGGCTAGCAAAGATTGGCAGG + Intergenic
1065208831 10:23382730-23382752 CCTGAGTAGCTAAGACTTACAGG - Intergenic
1069065833 10:63941125-63941147 CAGGAGTAGCAAAGAGTGTTTGG - Intergenic
1069073494 10:64014225-64014247 CCTGAGGAGAAGAGATTATCTGG - Intergenic
1069895850 10:71679594-71679616 CCTGAGTAGCCCAGAGTGTCAGG - Intronic
1069970621 10:72165238-72165260 CCTGAGTAGCTGGGATTGACAGG + Intronic
1071537431 10:86446093-86446115 CTTAAGTATCAAAGCTTGTCTGG + Intronic
1072712778 10:97728090-97728112 CCTGAGTAGCTAAGATTACCAGG - Intergenic
1074357665 10:112800297-112800319 CCTGATTAGCTTGGATTGTCCGG - Intronic
1079218797 11:18539793-18539815 CCTGACTAGCATAGAATGCCTGG + Intronic
1079739633 11:24040925-24040947 CCTGAGTAGCTGAGATTATAGGG + Intergenic
1081824723 11:46038249-46038271 CCTGAGTAGCTGAGATTATAAGG + Intronic
1082824708 11:57568898-57568920 CCTGAGTAGCTGAGATTTACAGG + Intergenic
1083390092 11:62342631-62342653 CCTGAGTAGCTGGGATTGCCAGG - Intronic
1086024042 11:82268592-82268614 CCAGAGTAGCCAAGATTTACAGG - Intergenic
1087110208 11:94457916-94457938 CCTGAGCAGCAAAGTCTGTGTGG - Intronic
1090863679 11:130676414-130676436 TCTGAGCACCAAAGATTGTCAGG - Intronic
1092173833 12:6389828-6389850 CCTGAGTAGCTGGGACTGTCTGG - Intronic
1092818474 12:12331493-12331515 CCTGAGCAGGAAAGGTTGGCAGG + Intronic
1092979719 12:13782427-13782449 CCTCAGTGGCAAAGATCATCTGG - Intronic
1093279064 12:17168483-17168505 ACTGAGTAGCAAAGAGTTACAGG - Intergenic
1094535285 12:31316043-31316065 CCTGAGTAGCTGAGATTTACAGG - Intronic
1100433241 12:94548936-94548958 CCTGAGTAGCATCAATTTTCAGG - Intergenic
1101316013 12:103629526-103629548 CCAGAGGAGCACAGATTGTTTGG + Intronic
1103643542 12:122372293-122372315 CCTGAGTAGCTGGGATTATCTGG - Intronic
1107618220 13:42195375-42195397 CCTGAGTAGCTAAGATTACAGGG - Intronic
1109194151 13:59359611-59359633 CCTGAGTAGCTGGGATTGACAGG + Intergenic
1109204647 13:59467719-59467741 ACAGAGAATCAAAGATTGTCAGG - Intergenic
1112723140 13:102269646-102269668 CCTGAGTAGCTAGGACTGCCAGG + Intronic
1114523689 14:23354555-23354577 CCTGTGTAGCAAAGATGTTTAGG - Intergenic
1116060497 14:39918584-39918606 CCTGAGTAGCTGTGATTATCCGG + Intergenic
1116550940 14:46236840-46236862 CATGAGTAGATAAGTTTGTCTGG + Intergenic
1119877784 14:78075184-78075206 CCTGAGAAGCAAAGGGGGTCGGG - Intergenic
1126230617 15:46319248-46319270 CCTGGGTAGAAAAAATTGGCTGG + Intergenic
1129749884 15:78055110-78055132 CCTGAGAAGGCAAAATTGTCAGG + Intronic
1130065644 15:80602708-80602730 CCTGAGTAGCTAAGATTACTAGG - Intergenic
1132990342 16:2789252-2789274 CCTGAGTAGCAGGGATTTACAGG + Intergenic
1133199137 16:4191747-4191769 CCTGAGTCGTAGAGATTGTCAGG - Exonic
1133793494 16:9027779-9027801 CCTGAGTAGCTAAGATTATAGGG + Intergenic
1135031660 16:19043693-19043715 CCTGAGTAGCTGAGATTGCAGGG + Intronic
1135193224 16:20372372-20372394 GGGGAGTAGCACAGATTGTCTGG - Intronic
1137821568 16:51450443-51450465 CCTGAGCAGGAAAGATAGTGAGG - Intergenic
1137894326 16:52194754-52194776 CGAGAGCAGCAAAGTTTGTCAGG - Intergenic
1138171920 16:54859515-54859537 CCTGAGTAGCTGAGATTTACAGG - Intergenic
1143387962 17:6543310-6543332 CCTGAGTGGGAAAGATGGCCAGG - Intronic
1146025093 17:29313521-29313543 CCTGAGTAGCTAGGATTAACAGG + Intergenic
1146268121 17:31466556-31466578 TCTGAGTAGCAAAGTTGGTTGGG + Intronic
1146737116 17:35247961-35247983 ACTGAGGGGCACAGATTGTCTGG + Intronic
1151310250 17:73288364-73288386 CCTGAGTAGCTGAGATTTACAGG + Intronic
1152858568 17:82680473-82680495 CTTCAGAAGCAAAGAGTGTCAGG - Intronic
1153574547 18:6507509-6507531 CCCGAGTAGCTAAGACTGACTGG - Intergenic
1158392329 18:57053514-57053536 CCTGATTTGCAAAGATGGTCAGG - Intergenic
1161887223 19:7006150-7006172 CCTGGTTAGCAAAGTTTGTAGGG - Intergenic
1163565140 19:18046632-18046654 CCTAAGGAGCAATGATAGTCTGG + Intergenic
1163673124 19:18640661-18640683 CCTGAGTAGCTGGGATTGTAAGG + Intronic
1163800803 19:19363994-19364016 CCTGAGTAGCTAGGATTTACAGG - Intergenic
1165434300 19:35788004-35788026 GCTGAGTAGCCAAGGTGGTCAGG - Exonic
1165470432 19:36000835-36000857 CCCGAGTAGCTAAGATTAACAGG + Intergenic
1167013827 19:46826610-46826632 CCTGAGTAGCTGAGATTTACAGG - Intergenic
1168633205 19:57973335-57973357 GCTGAGCTTCAAAGATTGTCGGG + Intronic
928942554 2:36741463-36741485 CCTGAGTAGCAAAGATTGTCTGG + Intronic
928976703 2:37094814-37094836 CCTGAGTAGCTAGGATTATTGGG - Intronic
930805490 2:55485293-55485315 CATGAGTAGAAAAGATTCTTAGG + Intergenic
931678226 2:64719258-64719280 ACAGATTAGCAAAGATTGCCCGG - Intronic
932097238 2:68862084-68862106 CATGAGAAGCAAATATTGTCAGG - Intergenic
936778805 2:116006826-116006848 CCTGAGTAGCTAAGATTACAGGG - Intergenic
938666170 2:133540054-133540076 CCTGAGTAGCTGGGACTGTCAGG - Intronic
942773002 2:179545335-179545357 TCTTAATAGCAAAGAGTGTCTGG - Intronic
943605155 2:189968571-189968593 CTTAAGCAACAAAGATTGTCTGG + Intronic
943872096 2:193012395-193012417 CCTGAGCAGCAAAGGTGGTGTGG - Intergenic
945809499 2:214531295-214531317 CCTCAGTAGAAAAATTTGTCTGG - Intronic
948393778 2:237630146-237630168 GCTGAGTAGCACAGATTGATAGG + Intronic
1171477062 20:25418999-25419021 CCTGAGTAGCACATACTCTCAGG + Intronic
1174751301 20:53113967-53113989 CCTGAGTAGCTGAGATTATAAGG - Intronic
1175076558 20:56379836-56379858 CCTGAGTAGCTAGGATTAACAGG - Intronic
1179375934 21:40849707-40849729 CCTGAACAGGAAAGAGTGTCTGG - Intergenic
1182166839 22:28183315-28183337 CCTGAGTAGCCAAGATTTCAGGG + Intronic
1185303989 22:50102059-50102081 CCTGAGTAATAAAGATGGGCAGG + Intronic
951826109 3:26870938-26870960 CATGAGAAGAAAAGATTGTTGGG + Intergenic
952332639 3:32378378-32378400 CTTGAGTAGTAAAGAGTGGCAGG + Intergenic
953868698 3:46607435-46607457 CCTGAGTAGCCGAGATTATAGGG + Intronic
956276618 3:67508846-67508868 CCTGAGTAGCATCAATTTTCAGG + Exonic
960523395 3:118681569-118681591 TCTGAGTAGAAAAGACTGGCAGG + Intergenic
964728973 3:159844856-159844878 CCACAGTAGCTAAGAATGTCAGG - Intronic
966016281 3:175141516-175141538 CATCAGTAGCAAAGCTTGACTGG + Intronic
966793085 3:183691198-183691220 CCTGAGTAGCTGGGATTGTAGGG + Intergenic
967584644 3:191197043-191197065 CCTGAGTAGAGAAAGTTGTCTGG - Intergenic
967744294 3:193037629-193037651 TCTGAGATGCAAAGATTTTCTGG - Intergenic
967867389 3:194201589-194201611 CCTGAGCAGCAAAGACTGCTGGG + Intergenic
968823797 4:2877849-2877871 CCTGAGTAGCTGGGATTGCCGGG - Intronic
970943085 4:21658538-21658560 CCTGAGTAGCTGAGATTACCAGG + Intronic
971999243 4:34008679-34008701 CTTCAGTAGCAAAGATTATATGG - Intergenic
972097911 4:35371711-35371733 CCTGAGTAGCTAGGATTTACAGG + Intergenic
973226188 4:47787318-47787340 CCTGAGTAGCAAACAATGACCGG - Intronic
974344430 4:60660881-60660903 CCTGAGTAGCTGAGATTGCAGGG - Intergenic
975141693 4:70925166-70925188 CCTGAGTAGCAGAGACTTACAGG + Intronic
975481913 4:74890259-74890281 ACAGAGTAGCAGAGAATGTCTGG + Intergenic
975915627 4:79322197-79322219 CCTGAGGATCAAAGATTGGATGG + Intronic
977825223 4:101523469-101523491 CCTGAGCAGCTAGGATTGGCAGG - Intronic
978725529 4:111965006-111965028 CCTGAGTAGAAAATATTTTCTGG - Intergenic
980719121 4:136670282-136670304 TCTGAGAATTAAAGATTGTCTGG + Intergenic
982095224 4:151916069-151916091 GCTGAATAGCACTGATTGTCCGG + Intergenic
983982706 4:174018483-174018505 CCTGAGTAGCTGAGATTGCAAGG + Intergenic
984515664 4:180735877-180735899 CCTGAGTAGCAAGGACTGTAGGG + Intergenic
984765257 4:183395617-183395639 CCTGAATGGCAAAAATTGGCAGG - Intergenic
990336239 5:54775375-54775397 CTTGAGAAGCAAAGATTATTAGG + Intergenic
990548986 5:56853760-56853782 CCTGAGTAGGAAAGATCTTGGGG + Intronic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
992641856 5:78774529-78774551 CCTGGGTAGCAGGGATGGTCAGG + Intergenic
993510347 5:88763752-88763774 GCTGAGTTGGAAGGATTGTCTGG - Intronic
995726057 5:115181072-115181094 GAAGAGAAGCAAAGATTGTCAGG - Intergenic
996946059 5:129069260-129069282 ACAGAGTAGGAAAGATTTTCAGG - Intergenic
998890904 5:146744615-146744637 CCTGAGTACAAATGATTGCCTGG - Intronic
999464053 5:151784218-151784240 CCTGAGTAGCTGAGACTTTCAGG + Intronic
1001088406 5:168718600-168718622 CCTGAGTACAAAACATTGTGTGG - Intronic
1002863758 6:1102985-1103007 CTTGAGTAGGAGACATTGTCAGG - Intergenic
1003931581 6:10929014-10929036 CCTGAGTAGCTAGGATTATAGGG + Intronic
1008648524 6:53541089-53541111 CCTGAGTAGCTAGGATTATAAGG - Intronic
1011490511 6:87886374-87886396 CCTGAGGATCAAAGATGTTCAGG - Intergenic
1013297409 6:108770058-108770080 CAAGAATAGCAAAGATTCTCAGG + Intergenic
1015679654 6:135791652-135791674 CCTGAGCTGCAACGATTGTGAGG + Intergenic
1015719590 6:136227563-136227585 CTTGAGTAGTACAAATTGTCCGG - Intergenic
1017574997 6:155792461-155792483 CCTTAGTTGCAAAGCTTGTATGG - Intergenic
1021368347 7:19809923-19809945 CCTGAGTAGAACACATTGCCTGG - Intergenic
1022189745 7:28005821-28005843 CCACAGAAGCCAAGATTGTCAGG - Intronic
1022404852 7:30079307-30079329 CCTGTGTAGTAAAGATGTTCAGG + Exonic
1026060369 7:67020256-67020278 CCTGAGTAGCAGGGATTTACAGG - Intronic
1029244311 7:99187878-99187900 ACAGAGTAGCAAAGATGGGCAGG + Intronic
1030523755 7:110629397-110629419 CCAGAGGAGGAAAGATTGTAGGG + Intergenic
1035759301 8:2057596-2057618 CCCGAGAAGCAAGGATGGTCAGG - Intronic
1038452858 8:27651043-27651065 CCTGGTTTGCTAAGATTGTCTGG - Intronic
1045881918 8:107050972-107050994 CCTGAGTAGCTAGGATTAACAGG - Intergenic
1047468048 8:125138733-125138755 CCTGGGAAGCAAAGATTCGCAGG + Intronic
1050056416 9:1660147-1660169 CTAGAGGAGCAAAGAATGTCAGG + Intergenic
1050541943 9:6678233-6678255 CCTGACTAGCAAATATCCTCAGG - Intergenic
1050638607 9:7641200-7641222 CCTGAGTTAAAAAGAATGTCTGG + Intergenic
1051938516 9:22473971-22473993 CCTGAGTAGCAAGGACTTACAGG + Intergenic
1052962555 9:34312820-34312842 CCTGAGTAGCTAGGATTCACAGG + Intronic
1053177810 9:35941567-35941589 CCTGAGCAGCAAGGTTTTTCAGG - Intergenic
1057165133 9:92919846-92919868 CCTGAGAAGCAAGGATGGGCAGG - Intergenic
1057601610 9:96463066-96463088 CCTGAGTAGCTGAGATTACCAGG + Intronic
1058235483 9:102485749-102485771 CTTGAGTTGCAAAGTTTGTTTGG - Intergenic
1062361173 9:136188932-136188954 CCTGAGTAGCTGAGATTTACAGG - Intergenic
1187757931 X:22546855-22546877 CCTGTGGAGCAAAGAGTGACAGG - Intergenic
1187887506 X:23903243-23903265 CCTGAGTAGCTGGGATTGACAGG - Intronic
1189560742 X:42189082-42189104 CCAGAGAAGCCACGATTGTCAGG + Intergenic
1191720925 X:64227911-64227933 CCTGAAGAGCACAGATGGTCTGG - Intronic
1193138358 X:77998643-77998665 CCTGTGTAGCAAACATTGAACGG + Exonic
1194544890 X:95221001-95221023 GCTGAGTATCAAAAATTATCAGG + Intergenic
1194745060 X:97619105-97619127 CCTGAGCAGTAAAGATTCTATGG - Intergenic
1195027947 X:100897158-100897180 ACTTAGAAACAAAGATTGTCAGG + Intergenic
1195246648 X:103001331-103001353 ACTGGGTAGCAGGGATTGTCAGG + Intergenic
1196270199 X:113700550-113700572 CGTGAGTAGGAAAGACAGTCTGG - Intergenic
1198139149 X:133785297-133785319 CCTGAGTAGACTAGAGTGTCAGG + Intronic
1201785625 Y:17774859-17774881 CCTGAGTAGCTAAAATTATAGGG - Intergenic
1201815928 Y:18131129-18131151 CCTGAGTAGCTAAAATTATAGGG + Intergenic