ID: 928945076

View in Genome Browser
Species Human (GRCh38)
Location 2:36764875-36764897
Sequence ATGTCAAAGGGGAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 409}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928945068_928945076 19 Left 928945068 2:36764833-36764855 CCAGGACTATGATTCTGGCACTA 0: 1
1: 0
2: 0
3: 5
4: 108
Right 928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG 0: 1
1: 0
2: 3
3: 26
4: 409
928945070_928945076 -8 Left 928945070 2:36764860-36764882 CCTGGATGTTATACAATGTCAAA 0: 1
1: 0
2: 0
3: 22
4: 142
Right 928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG 0: 1
1: 0
2: 3
3: 26
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928945076 Original CRISPR ATGTCAAAGGGGAAGGTGGA TGG Intronic
900337940 1:2174071-2174093 TTTTCAAAGGTGCAGGTGGAGGG + Intronic
900690442 1:3977498-3977520 GTGACAAGGGAGAAGGTGGAAGG + Intergenic
901363255 1:8722256-8722278 ATAGCCAAGGGGAAGGTAGATGG - Intronic
902906007 1:19557861-19557883 AAGTGAAAGGGGAAGGGGAAGGG - Intergenic
904472321 1:30743575-30743597 ATGTCATAGGGGAAGGGTGGAGG - Intronic
905272234 1:36794646-36794668 ATGTCATAGGAGAACATGGAAGG + Intergenic
905520906 1:38598957-38598979 AGGCCAAAGGGGAGAGTGGAGGG - Intergenic
905997081 1:42390563-42390585 ATGTCACAGGTGCAGGTGGGTGG + Intronic
907410730 1:54281614-54281636 AGGTCCACGGGGAATGTGGACGG - Intronic
909490723 1:76223396-76223418 ATTTCAGAGTGGAAGGTGGGAGG + Intronic
909780941 1:79546202-79546224 AAGTTAAAGAGGAAGGTAGAAGG + Intergenic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
910856155 1:91697948-91697970 AGGGGAAAGGGGAAGGGGGAAGG + Intronic
911045963 1:93628564-93628586 ATGTCTAAGGGGAAGAAGAAGGG - Intronic
915345487 1:155195042-155195064 ATGGCAAGGGGGAGGGGGGAGGG - Intergenic
916494779 1:165336632-165336654 ATGGCAACGGTGTAGGTGGAGGG - Intronic
916600717 1:166290719-166290741 ATGTGAAAGGGGAAGGGGTCTGG + Intergenic
916670247 1:167011033-167011055 AAGTGAAAGAGGAAGGGGGAAGG - Intronic
917137403 1:171800858-171800880 ATGTCACAAGGTAAGGAGGAAGG + Intronic
917929549 1:179813983-179814005 ATGTAAAAGGGGGAGCTGTATGG - Exonic
918210778 1:182349199-182349221 ATGGCAAAGAGGAGCGTGGAAGG + Intergenic
918345540 1:183604322-183604344 ATGTCAGAGAGGCAGGAGGAAGG + Intergenic
920176539 1:204105213-204105235 ATGTCAAGGGCGAAGATGGCTGG + Intronic
921155951 1:212438962-212438984 ATGACAACTGAGAAGGTGGAGGG - Intronic
921179677 1:212622154-212622176 AAGCCAAAGGGGCAGGTGGAAGG - Intergenic
921942159 1:220853518-220853540 ATGGGAAAGGGAAAGGAGGAAGG - Intergenic
924953208 1:248904843-248904865 ATGTCAAAGTGGAAAGTGCTAGG - Intergenic
1064160576 10:12942106-12942128 ATGTCAAAGGGCTAGCTGTAAGG - Intronic
1065314636 10:24451345-24451367 ATGTTAAGGCTGAAGGTGGAGGG + Intronic
1065829347 10:29600284-29600306 ATCACAAAGGGGAAGGTTGGAGG + Intronic
1066052539 10:31648798-31648820 ATTTCATTAGGGAAGGTGGAGGG + Intergenic
1069087357 10:64156824-64156846 AAGTCAAAAGGGAAGGAAGATGG + Intergenic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1072339143 10:94429664-94429686 ATAACAGAGGGGAAGTTGGATGG - Intronic
1073150675 10:101309420-101309442 AGGTCAATGGGCAAGGTGGGGGG + Intergenic
1073231485 10:101974778-101974800 ATGTCATAGGGAGAGATGGAGGG - Intronic
1073592120 10:104767605-104767627 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1073730633 10:106283189-106283211 ATCTCAAGGGGGAAGATGGGAGG + Intergenic
1073779220 10:106818826-106818848 TTGTCAAAGGAGAAGGGGAAAGG - Intronic
1074186606 10:111103692-111103714 AGGTGAAAGGGGAAATTGGAAGG + Intergenic
1074248334 10:111716619-111716641 ATGTCATAAGGGATGGGGGAAGG + Intergenic
1074418245 10:113286200-113286222 GTGTCATGGGGGAAGGAGGAAGG - Intergenic
1074696122 10:116051502-116051524 ATGCCACAGGGGAAGGGGGCTGG + Intergenic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1074775053 10:116761723-116761745 ATCTAAAACGTGAAGGTGGAAGG + Intergenic
1074900587 10:117813164-117813186 ATTTCAGAGGCCAAGGTGGAAGG - Intergenic
1075609360 10:123839323-123839345 ATGTAAGGGGGGAATGTGGAGGG - Intronic
1075856962 10:125637946-125637968 ATCACCAAGGGGAAGTTGGAGGG - Intronic
1076511314 10:131015689-131015711 CTCACAAAGGGGAAGCTGGAGGG + Intergenic
1076566124 10:131400666-131400688 AGTGCAAAGGGGAGGGTGGAGGG + Intergenic
1077651948 11:3980878-3980900 TTGTCAAACTGGAAGGGGGAAGG - Intronic
1078158805 11:8822516-8822538 AGGTCAAAGCGGAAGGTTGCAGG - Intronic
1079254696 11:18817939-18817961 AGGTCAAAAGGGCAGGTGCATGG + Intergenic
1079269580 11:18971787-18971809 ATGCCTGAGGTGAAGGTGGAGGG - Intergenic
1080007066 11:27420762-27420784 GTGTCTTGGGGGAAGGTGGAGGG + Intronic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1081182087 11:39996329-39996351 ATGCCATGGTGGAAGGTGGAAGG - Intergenic
1081590877 11:44422263-44422285 ATGTCAAAAAGGGAGGAGGAGGG + Intergenic
1081776330 11:45678276-45678298 GTGTCAAAACGGCAGGTGGAGGG - Intergenic
1081982205 11:47274813-47274835 ATCTCTAAGGAGAAGGGGGAAGG + Exonic
1083007097 11:59356753-59356775 GACTCAAAGGGTAAGGTGGAAGG - Intergenic
1083018512 11:59481791-59481813 ATGTTACTGGGGAGGGTGGAAGG + Intergenic
1083300927 11:61739331-61739353 ATGGCAAAGGGGCAGGGGAAGGG - Intronic
1083513871 11:63237454-63237476 ATCTCACAGCAGAAGGTGGAAGG - Intronic
1083997587 11:66279735-66279757 ATGTCAAAGAGCAAGGTGGCAGG - Intronic
1084545566 11:69813533-69813555 ATGTCAGATGGGTGGGTGGATGG + Intronic
1085678916 11:78552296-78552318 ATGTCTTGGGGGAACGTGGATGG - Intronic
1086592273 11:88529522-88529544 AGGTCAAAGGGGAAAGCAGATGG + Intronic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1086920943 11:92585952-92585974 ATGTGAAGGGAGAAGGTGGCTGG + Intronic
1087439221 11:98161550-98161572 ATGTCAAAGAGGCAGCTGAATGG + Intergenic
1087775501 11:102253133-102253155 ATCTCATGGTGGAAGGTGGAAGG + Intergenic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088653254 11:111976855-111976877 ACGCCAGAGGGGAAGGTGGGAGG + Intronic
1088777604 11:113100619-113100641 ATGTCAAAGAGGCAGCTGAACGG - Intronic
1089074173 11:115724774-115724796 ATGGCCAAGGGGAAGATGGGAGG - Intergenic
1089200338 11:116720856-116720878 ATGGCAGAGTGGAAGGTGGGAGG - Intergenic
1089331684 11:117693488-117693510 ATGTCAAATGGGGGGGTGCAGGG - Intronic
1089528719 11:119113138-119113160 AAGCCAGAGGGGAAGCTGGAAGG - Intronic
1090801989 11:130178808-130178830 GGGTCAAAGGGAAAGGTGGGCGG + Intronic
1090898823 11:131006608-131006630 ATGTCCCTGGGGTAGGTGGATGG + Intergenic
1091060082 11:132452922-132452944 ATGTCCAGGGGAAAGGAGGAGGG - Intronic
1091140671 11:133231832-133231854 TTGTCAAAGGAGAAGGGGCAAGG + Intronic
1091206524 11:133824979-133825001 ATGTCAGAGGTGGAGATGGAAGG + Intergenic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091873152 12:3911984-3912006 GTGTCAAAGGGGAAGAGAGACGG - Intergenic
1097251648 12:57636467-57636489 GTGTTAAAGGGTAAAGTGGAAGG + Intergenic
1097934402 12:65228977-65228999 GTGGCAAAGTGGCAGGTGGAGGG - Intronic
1101614867 12:106326351-106326373 CTGTCAACAGGGAGGGTGGATGG - Intronic
1102397054 12:112595501-112595523 AGGCAAAAGGGGAAGGAGGAGGG - Intronic
1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG + Intronic
1102566792 12:113802353-113802375 ACTTCAATGGGGGAGGTGGAGGG + Intergenic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1102956402 12:117061782-117061804 ATATCAAAGGGGATGGTTCAGGG + Intronic
1103225242 12:119281871-119281893 GTGTCGAGGGGGTAGGTGGAGGG - Intergenic
1103428263 12:120857811-120857833 CTGTCACAGGGGTGGGTGGAAGG + Intronic
1103473791 12:121203406-121203428 ATCTCAAAGGTAAAGGTGAACGG + Intergenic
1103714505 12:122936349-122936371 AATTCAAAAGGTAAGGTGGAGGG + Intronic
1105782128 13:23714729-23714751 GTGCCAAAGGGAAAAGTGGATGG - Intergenic
1105973455 13:25452263-25452285 ATGCCAGAGGGGAATGTGGGTGG - Intronic
1106265620 13:28107025-28107047 ATATGAAATGGGAAGGTTGAGGG + Intergenic
1107317699 13:39151262-39151284 ATGTAAAAGGGAAAGGTGGGGGG + Intergenic
1108644621 13:52414573-52414595 TTGTCAGTGGGTAAGGTGGAGGG - Exonic
1108800915 13:54093167-54093189 AGGCCCAAGGGGAAGGTGGTCGG + Intergenic
1111333073 13:86786371-86786393 ATCTCATGGCGGAAGGTGGAAGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1112159961 13:96856771-96856793 ATTTCAGAGTGGAAGATGGAGGG - Intergenic
1113075908 13:106467962-106467984 CTGTAAAAGGGAAAGGTTGAAGG - Intergenic
1113872036 13:113565438-113565460 ATGTCAGAGGGGAGGGTCGGAGG - Intergenic
1114441129 14:22748902-22748924 CTGTCAAAGGAGAAGGGGCACGG + Intergenic
1115078427 14:29419973-29419995 ATATCAGAGAGGAAGGAGGAAGG - Intergenic
1117031829 14:51679953-51679975 ATGCCAAAGAAGAAGGGGGAAGG + Intronic
1118615751 14:67573445-67573467 ATGTCAGATGGGACGGAGGAGGG + Intronic
1118622991 14:67631123-67631145 AGGTCAAGGGGGATGGTGGAGGG - Intronic
1118828088 14:69402626-69402648 AGGTCAAAGGGCAAGGAAGAAGG - Intronic
1119526316 14:75325197-75325219 ATGTCATGGTGGAAGGTGGCTGG + Intergenic
1120274474 14:82354142-82354164 ATATTAAGGGGTAAGGTGGAGGG - Intergenic
1120505228 14:85347486-85347508 ATAGCAAGGGGGAAGGGGGAAGG + Intergenic
1121894368 14:97632041-97632063 ATGCCAGTGGAGAAGGTGGATGG - Intergenic
1121971500 14:98361039-98361061 ATGTAATAGGGGAAGAAGGACGG + Intergenic
1122023982 14:98861191-98861213 ATGTCCAAGGTCAAGGTGCAGGG - Intergenic
1122461942 14:101903320-101903342 ATGTGACAGGGCAAGGAGGAAGG + Intronic
1124550933 15:30680735-30680757 ATCTCCAAGAGGAATGTGGATGG - Intronic
1124680320 15:31724934-31724956 ATCTCCAAGAGGAATGTGGATGG + Intronic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1130123432 15:81071873-81071895 ATGTCATTTGGGAAGATGGATGG - Intronic
1130681769 15:86003105-86003127 ATGGCAGAGGGGAAGCTAGAGGG + Intergenic
1131388713 15:92029736-92029758 TTGTCAAAAGGAAAGGTGAATGG + Intronic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1134318470 16:13140932-13140954 ATGTAAAGGGGGAAGGAGAATGG + Intronic
1134881955 16:17752757-17752779 AAGTCAAAGGTGATTGTGGATGG - Intergenic
1137272685 16:46912680-46912702 CAGTCAAAGCGGAAGGTGAAGGG + Intronic
1137615130 16:49841843-49841865 ATGTGAAAGGGAAAGAAGGAGGG + Intronic
1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG + Intergenic
1138396589 16:56709343-56709365 GAGACAAAGGGAAAGGTGGAGGG + Intronic
1138934831 16:61706292-61706314 ATTTCAAAGGGGAAGCGAGAGGG + Intronic
1139018792 16:62723204-62723226 ATTTCATAGTGGAAGATGGAAGG + Intergenic
1140139407 16:72240965-72240987 GTGGCAAAGGTGCAGGTGGAGGG + Intergenic
1140451296 16:75072882-75072904 ATCTCAGAGGGGAAGCTGGAGGG - Intronic
1140517407 16:75553978-75554000 ATGTGATAGGGGATGGTGGGAGG - Intronic
1140859253 16:79004993-79005015 ATGAAAAAGGGGAAGGGAGAGGG + Intronic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1143305123 17:5940488-5940510 TTGTCAAAGGGGAGAGAGGATGG + Intronic
1145059251 17:19722013-19722035 ATGTCAATGGGGAAACTGGTGGG + Intergenic
1145266202 17:21380719-21380741 ATGTCCAAGGGAAGGTTGGATGG - Intronic
1145825973 17:27877614-27877636 AAGTCAGAGGGCAGGGTGGAAGG + Intronic
1145972948 17:28967672-28967694 AACTCAAAGGGGAAGATGTAAGG - Intronic
1145989496 17:29070419-29070441 ATGTCCTAGGAGAAGATGGAAGG + Intergenic
1146433975 17:32825534-32825556 ATTTGAGAGGCGAAGGTGGATGG - Intronic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1146655331 17:34631633-34631655 ATCTCAGAGGGGTGGGTGGAGGG - Intronic
1148217639 17:45842042-45842064 ATTTCAAAGGGGAGGTTGGCAGG - Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149990825 17:61382727-61382749 TTGGCATAGGGGAAGGTGAATGG + Intronic
1150000505 17:61434130-61434152 ATGTCACAGCTGAAGGGGGATGG + Intergenic
1151413208 17:73944647-73944669 ATGTAAAAAAGGAAGGTGCAAGG - Intergenic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154139627 18:11811380-11811402 AGCTCACAGGGGAAGGTGGGTGG - Intronic
1155046249 18:22105959-22105981 ATGTGAAAGGGGAGAGTGGAAGG - Intergenic
1156412311 18:36842498-36842520 ATCTCAAAGCAGAGGGTGGAAGG + Intronic
1156661990 18:39357254-39357276 ATGGCAAAGGGGAATATGGGGGG - Intergenic
1156852620 18:41745898-41745920 ATGCCAAGGGGGAAGAAGGAAGG + Intergenic
1157543479 18:48530494-48530516 ATCCCATAGTGGAAGGTGGAAGG + Intergenic
1157812802 18:50709663-50709685 ATGTCATTGGGGATGGGGGAAGG + Intronic
1157967467 18:52224383-52224405 ATCTCATAGCAGAAGGTGGAAGG - Intergenic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1160203056 18:76810894-76810916 ATAGCTAAGGAGAAGGTGGAAGG - Intronic
1160466015 18:79077319-79077341 ATGTCAAAGGGGGCTGTGAAGGG - Intronic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1161438274 19:4277062-4277084 AGGTCACAGGGGAAGGTGACTGG + Intergenic
1161473260 19:4471978-4472000 AGGTGAAAGGGAAAGGTGGGAGG - Intergenic
1162331592 19:10033143-10033165 AAGTCAGAGGGGAAGAAGGAGGG + Intergenic
1162433706 19:10644227-10644249 ATGTCAGGGGGAGAGGTGGAGGG + Exonic
1162450272 19:10750100-10750122 AGGTCACTGGGGAAGGTGGGAGG + Intronic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1163058416 19:14740137-14740159 ATGGGAATGTGGAAGGTGGATGG + Intronic
1164827201 19:31292530-31292552 ATATCCAAGGGGAAGGTAAATGG + Intronic
1165974758 19:39665982-39666004 ATGTGGAAGGGAAATGTGGAAGG - Intergenic
1168259550 19:55185814-55185836 ATGTCACAGGGGAAGGCTGAGGG + Intronic
1168273523 19:55263441-55263463 ATGTTAAAGGTGAAGGTTAAAGG - Intronic
1168570075 19:57459365-57459387 ATGTCAAAGGGGTCGGGGGATGG - Intronic
925196414 2:1929412-1929434 AGGTGAAAGGGGAACATGGAGGG + Intronic
925714328 2:6771018-6771040 GTGACAAAGTGGCAGGTGGATGG - Intergenic
926036346 2:9638728-9638750 ATGACTAAGGGGAAGGAGGGCGG - Intergenic
927677481 2:25117075-25117097 AAGTCAAAGTTGAACGTGGAGGG + Intronic
927851770 2:26504044-26504066 ATGGCAAAGGCGGAAGTGGAGGG - Intronic
928723360 2:34144917-34144939 ATGGCAAAGGGAAAGATGAATGG - Intergenic
928929260 2:36607146-36607168 ATCTCAAGGCAGAAGGTGGAAGG + Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
930449853 2:51521899-51521921 ATCTCAAAGGGACAAGTGGATGG - Intergenic
930506494 2:52287996-52288018 TTGACAATGGGGATGGTGGAAGG - Intergenic
931158272 2:59659979-59660001 ATGTCACAGGTAAAGGTGGTAGG + Intergenic
931496387 2:62812132-62812154 ATCGCAAAGTGAAAGGTGGAAGG - Intronic
932077844 2:68681725-68681747 ATTTCAATGGGAAAAGTGGATGG + Intronic
932437288 2:71710004-71710026 AAGTCAAAGGGGAAGATGGAGGG - Intergenic
932488307 2:72101050-72101072 ATGTTGAAGAGCAAGGTGGATGG - Intergenic
932800390 2:74737212-74737234 AAGTCAATAGGGAGGGTGGAAGG - Intergenic
932823812 2:74922650-74922672 ATGTCAAGGGAGAAGACGGAAGG + Intergenic
933056846 2:77681125-77681147 ATTTCAAAGGAGGTGGTGGAGGG - Intergenic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
933926979 2:87102269-87102291 ATTTCAAAGGAGGTGGTGGAGGG - Intergenic
934706439 2:96484852-96484874 ATCCCAAGGTGGAAGGTGGAGGG - Intergenic
934855103 2:97724670-97724692 ATGCCAGATGGGAAGGTAGAGGG + Intronic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935037703 2:99395334-99395356 GTCTCAAAGGGAAAGGAGGAGGG - Intronic
935132913 2:100274746-100274768 ATGGCAAAGGCGAAGATGGGCGG - Exonic
936647530 2:114388972-114388994 ATGCCAAAGAGGCAGCTGGATGG + Intergenic
936907036 2:117548735-117548757 TTGTCAAAGAGGATGGTGGTAGG - Intergenic
936981471 2:118269161-118269183 GTGTCAGAAGGGGAGGTGGACGG + Intergenic
939328117 2:140721798-140721820 ATGTCAAAAGCCGAGGTGGACGG - Intronic
939357647 2:141124934-141124956 ACCACAAAGGGAAAGGTGGAAGG - Intronic
940037794 2:149329504-149329526 AAATCCAAGGAGAAGGTGGAGGG + Intergenic
940043529 2:149385709-149385731 ATGGCAAAGGGGGAGGGGAAAGG + Intronic
941579047 2:167272473-167272495 AGGACACAGGTGAAGGTGGAAGG - Intergenic
942651971 2:178178479-178178501 ATGTCACAGGGGCAGGGGCAGGG + Intergenic
943746049 2:191463711-191463733 ATGTAGAAGGGGTAGCTGGATGG - Intergenic
944537483 2:200725458-200725480 CTGTCAAAGGGTGAGGGGGAGGG - Intergenic
944884653 2:204049935-204049957 ATTTCATAAAGGAAGGTGGAGGG - Intergenic
945955455 2:216082012-216082034 ATGCCATTGGGGAGGGTGGAAGG + Intronic
946077965 2:217091534-217091556 CTGTCACAGGGGAACGTGGCAGG - Intergenic
947378129 2:229518077-229518099 ATCTCAAAGCAGAAGCTGGATGG + Intronic
948075779 2:235164171-235164193 TTCTCAAGGGGGAAGGTGGGGGG + Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
1168834663 20:870034-870056 AAGTCAACGGGGCAGATGGAGGG + Exonic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1169178644 20:3542606-3542628 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1169298680 20:4423078-4423100 AGGGCAAGGGGGAAGCTGGAAGG + Intergenic
1169431368 20:5539280-5539302 CTTTCAGAGGGGAAGGTGGGTGG + Intergenic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1170217679 20:13908873-13908895 ATGTACAAAGGGAAGCTGGATGG - Intronic
1171182716 20:23102644-23102666 ATGTCAACGGTGAAGGTGTCTGG + Intergenic
1171349672 20:24492766-24492788 AAGGCAAAGGGGAAGGAAGATGG - Intronic
1171474518 20:25397830-25397852 AAGGGAAAGGGGAAGGGGGAAGG + Intergenic
1173408192 20:42785792-42785814 GAGACAAAGGGGAAGGAGGAAGG - Intronic
1174656809 20:52178618-52178640 ATGGCACAGGGGAACGTGGTGGG - Intronic
1175086615 20:56464794-56464816 ATCCCAAGGTGGAAGGTGGAAGG + Intergenic
1175736801 20:61392850-61392872 GTGACACAGGGGATGGTGGAGGG - Intronic
1175825607 20:61934879-61934901 CTTGCAAAGGGGAAGATGGAAGG - Intronic
1175869988 20:62204560-62204582 GTGTCCAAGTGGAAGGTGGCAGG - Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1178514372 21:33233920-33233942 AAGTCAGAGAGGAAGATGGAAGG + Intronic
1179125506 21:38587297-38587319 ATGTTCAAGGGGATGGGGGAGGG + Intronic
1179429104 21:41306899-41306921 ATGTCAAATGGGAAGGAGGAAGG - Intronic
1180742147 22:18061244-18061266 ATGTCCAAGGCGACGGTGGGTGG + Intergenic
1181748132 22:24970184-24970206 AAGTCAGCGGGGGAGGTGGAAGG - Intronic
1181786180 22:25228818-25228840 ATGTCATAGGGACAGGAGGATGG + Intronic
1181818351 22:25456648-25456670 ATGTCATAGGGACAGGAGGATGG + Intergenic
1181885666 22:26020325-26020347 ATCTGAAAGGGGAAGGGGTATGG + Intronic
1182019079 22:27065793-27065815 ACGTTAAATGGAAAGGTGGAGGG + Intergenic
1182809775 22:33105875-33105897 ATGACAAAGGGGAAGGAGCCTGG + Intergenic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184478984 22:44736353-44736375 GTGTCCAAGGGGATGGTGGGAGG - Intronic
1184729814 22:46366055-46366077 AGGTGGAGGGGGAAGGTGGAGGG + Intronic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
949462646 3:4309614-4309636 GTGTGAAGGGGGAAGGTGGTGGG - Intronic
950572390 3:13809467-13809489 ATGGCAGAGGGGAAGGAGGTGGG + Intergenic
952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG + Intronic
953421098 3:42753905-42753927 ATGTGAATGGGGAAGTTGTATGG + Intronic
953483476 3:43272658-43272680 ATAAAAAGGGGGAAGGTGGAAGG - Intergenic
953606632 3:44416901-44416923 ATGTCAAAGGAGCTGCTGGAGGG + Intergenic
953677527 3:45014876-45014898 CAGTCAAAGGGGATGGGGGATGG + Intronic
954264409 3:49461502-49461524 AGGTCAAAGGGGAAGGGACATGG - Intergenic
954284103 3:49606671-49606693 ATACAAAAGGGGGAGGTGGAAGG - Intronic
954425053 3:50438790-50438812 AGGGCAAGGGGGAAGATGGAAGG + Intronic
954770078 3:52959120-52959142 CTGTCAAGGGGGACGGGGGAGGG + Intronic
956213319 3:66824186-66824208 TTGTCAAAGGTGAAGGTACAAGG - Intergenic
956365481 3:68497506-68497528 ATGTCAGTTGGGAGGGTGGAAGG + Intronic
956768556 3:72505293-72505315 AGGACAAAGGAGAAGGAGGAAGG + Intergenic
957525722 3:81376283-81376305 AAGTCAAAGGGGCATTTGGATGG + Intergenic
957540730 3:81565534-81565556 AAGCCACAGGGGAAGTTGGATGG - Intronic
957640763 3:82850316-82850338 AAGGAAAAGGGGAAGGTGAAGGG - Intergenic
960395392 3:117131090-117131112 ATGTCGAAGAGGAAGCTGGACGG + Intronic
961491767 3:127261351-127261373 AAGTCACAGGGGAAGGAGGCAGG - Intergenic
962411450 3:135144654-135144676 GTGCCAAAGGGGAATGTGGGGGG - Intronic
962467473 3:135673833-135673855 CTGACATAGCGGAAGGTGGAAGG + Intergenic
965341626 3:167498430-167498452 ATGGCAAATGGCAGGGTGGAGGG + Intronic
965871401 3:173269534-173269556 ATGTGGAAGGGGATGGTTGAAGG + Intergenic
967507200 3:190266016-190266038 ATAGAAAAGGGGAAGGAGGAGGG + Intergenic
967713072 3:192731606-192731628 ATGTCAAAGAGGAAAGTGGACGG + Intronic
967763375 3:193250764-193250786 AAGCCATAGGGGAAGGTGCAAGG + Intronic
967899495 3:194434994-194435016 TTCTCAATGGGGAAGGAGGAGGG + Intronic
968624736 4:1622036-1622058 AGGGCAGAGGGGAAGGAGGAAGG - Intronic
968917524 4:3503082-3503104 CTGACAAAAGGGAAGGTGAAAGG - Intergenic
969232816 4:5843339-5843361 GCTACAAAGGGGAAGGTGGATGG - Intronic
969531483 4:7733252-7733274 CTGCCAAAAGGGAAGGGGGATGG - Intronic
969911566 4:10451928-10451950 ATGTGAAAAGGAAAGGTGGGTGG + Intronic
970451064 4:16166865-16166887 ATGGCTAAGGAGAAGGTGGGGGG + Intronic
971076091 4:23151568-23151590 ATGTCAGAGGGGCAGCTTGACGG + Intergenic
971162190 4:24144695-24144717 ATAGAAAAGGGGAAAGTGGAGGG - Intergenic
971344307 4:25797987-25798009 AAGTCAGAGGGGAAGTGGGAGGG + Intronic
972268464 4:37485456-37485478 ATTCCATGGGGGAAGGTGGAAGG - Intronic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
975052877 4:69887884-69887906 ATATCAAGGTGGAAGGTGGAAGG + Intergenic
975201630 4:71597091-71597113 ATCTCATGGTGGAAGGTGGAAGG - Intergenic
977263099 4:94822130-94822152 ATCTCATGGTGGAAGGTGGATGG + Intronic
977360537 4:95998890-95998912 ATGTCTAGGGGGGAGGGGGAAGG + Intergenic
977732461 4:100370328-100370350 ATGTCCTGGGGGAAGGGGGAAGG + Intergenic
979624415 4:122828566-122828588 ATGTCATGAGGGGAGGTGGAGGG + Intronic
979835541 4:125362802-125362824 ATGTCAAAAGGGAAGATAGCTGG + Intronic
981554735 4:145980564-145980586 ATGACAGAGGGGAAGGTGGGGGG + Intergenic
982303459 4:153903802-153903824 ATGGGAAAAGGGAAGGTGGCTGG + Intergenic
982316527 4:154037546-154037568 ATGGCAAAGGAGAAGGAGGTTGG - Intergenic
982806485 4:159771955-159771977 ATGGCACAGGGAAAGATGGAAGG - Intergenic
983162076 4:164428600-164428622 ATGTCAAAGGGCAAAGAAGAAGG + Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986390881 5:7287240-7287262 AAGTCAAGGAGGAAGGAGGAGGG - Intergenic
986551826 5:8965018-8965040 ACTTGAAAGTGGAAGGTGGAAGG + Intergenic
986627122 5:9732494-9732516 ATGGACAAGGGGAAGATGGAAGG + Intergenic
986668071 5:10120412-10120434 AGGTCCAAGGGGAAGGGCGAAGG + Intergenic
987217435 5:15751698-15751720 ATGTCAAAGGGAGGGGTGCAAGG + Intronic
989151444 5:38303788-38303810 ATTTCAAAACGGAAGGTAGATGG + Intronic
990109173 5:52302763-52302785 CTGTCAATGGGGAAGGCTGATGG + Intergenic
990998267 5:61755517-61755539 TTGTAAAAGGGGAAGCTGAAGGG - Intergenic
992564004 5:77980208-77980230 ATGCCAAAGAGGGAGGTGCATGG + Intergenic
994028914 5:95118014-95118036 CTGTCAAGGGGTGAGGTGGAGGG + Intronic
994533831 5:101001897-101001919 ATGTCAAAAGGCAGGGTTGAAGG + Intergenic
994737626 5:103575131-103575153 AAGGCAAAGGTGAAGGTGAAGGG - Intergenic
996471536 5:123866987-123867009 ATGGCAAAGTGGAATGTAGAAGG + Intergenic
996695775 5:126393175-126393197 ATGGAAAAGGGGAAAGTGAAGGG - Intronic
997854213 5:137358534-137358556 AAGGAAGAGGGGAAGGTGGAGGG + Intronic
997871334 5:137507633-137507655 GTTGCAAAGGGGCAGGTGGAAGG - Intronic
999880069 5:155852559-155852581 ATGTCAAAGAAGTAGGAGGATGG + Intergenic
1002858510 6:1058929-1058951 GTGTCAAAAGGGAAGGAGGCCGG + Intergenic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003099530 6:3166509-3166531 ATGTGAAAGGAGGAGGTAGAAGG - Intergenic
1003291514 6:4782796-4782818 ATGTCAAAGTGGTCCGTGGAGGG - Intronic
1003337159 6:5185045-5185067 AAGACAAAGGGCAAGGAGGAAGG - Intronic
1003700058 6:8453845-8453867 TTGGCAAAGGGGAATGGGGAGGG - Intergenic
1003823651 6:9928090-9928112 AGTTCCAAGGTGAAGGTGGAAGG - Intronic
1003827841 6:9972129-9972151 CTTTCAGAGGCGAAGGTGGATGG - Intronic
1005173454 6:23015054-23015076 ATGTCATAGGAGGAAGTGGAAGG + Intergenic
1006264168 6:32903348-32903370 ATCACACAGAGGAAGGTGGAAGG - Intergenic
1006268335 6:32944243-32944265 TTGTCAAAAGAGAAAGTGGAAGG - Intronic
1006472319 6:34235941-34235963 AAGCCAAAGGGGAAGATGGCGGG - Intergenic
1006562976 6:34929777-34929799 AAGGAAAAGGGGAAGGGGGAGGG - Intronic
1007116183 6:39344985-39345007 ATGGAAAAGGGGATGGGGGAGGG - Intronic
1007289497 6:40774714-40774736 ATGTCAATGGGGAAGATGGTGGG - Intergenic
1009508168 6:64512477-64512499 ATGGCCCAGGGGAAGGGGGAGGG + Intronic
1010179189 6:73065461-73065483 ATGTCAGAGAGGAAGCTGGAAGG - Intronic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1011713307 6:90077264-90077286 ATGGCAAAGGGCAAGAGGGACGG + Intronic
1011779774 6:90774608-90774630 ATCTCATGGTGGAAGGTGGAAGG + Intergenic
1011836631 6:91439282-91439304 ATGTCACAGGGCAGGGTGCAGGG - Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1011888567 6:92127955-92127977 ATGGCAAAGGGGAAGAGAGAGGG + Intergenic
1012528889 6:100210765-100210787 AGGTCAAAGGGGCATATGGAAGG - Intergenic
1012677569 6:102136795-102136817 AAATCATAGGGGAAGGTGAAGGG + Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014684380 6:124477738-124477760 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1016032881 6:139356218-139356240 TTGTCAAAGAGGGAGGGGGAAGG + Intergenic
1016580897 6:145628586-145628608 ATTTCAAAGGGAAAGGAAGAGGG + Intronic
1016606595 6:145936136-145936158 ATGTTAAGTGGGCAGGTGGAGGG - Intronic
1016606802 6:145938292-145938314 ATCTCATGGTGGAAGGTGGAAGG - Intronic
1018446538 6:163863781-163863803 ATGTCAAAGCGAGAGGGGGAGGG - Intergenic
1018837902 6:167498812-167498834 AGGTCAGTGGGGAGGGTGGATGG - Intergenic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019535218 7:1525716-1525738 ATGTAAAAGGGACAGGTGCAAGG - Intergenic
1019782603 7:2952680-2952702 AAATTAACGGGGAAGGTGGAAGG - Intronic
1019898780 7:4003358-4003380 GTGTCACAGGGGAAGCTGGGTGG - Intronic
1020439913 7:8206346-8206368 ATGTCAAGTGGGCAGCTGGATGG - Intronic
1022239931 7:28500731-28500753 ATTTTAAGGGGGAAGCTGGAGGG + Intronic
1023013649 7:35944515-35944537 AGGACAAAGAGGAAGGAGGAGGG - Intergenic
1023309384 7:38868271-38868293 ATCTCAAAGGAGAAGGTTGCTGG + Intronic
1023684057 7:42717179-42717201 ATATCAAAGGGGAAGGCTAAGGG - Intergenic
1024077481 7:45829319-45829341 AGGACAAAGAGGAAGGAGGAGGG + Intergenic
1024532762 7:50407026-50407048 ATCTCTAAGGGGGATGTGGATGG - Intergenic
1025126929 7:56352088-56352110 AGGACAAAGAGGAAGGAGGAGGG - Intergenic
1025253961 7:57370527-57370549 AATGCCAAGGGGAAGGTGGATGG - Intergenic
1026141339 7:67709588-67709610 ATGACAAGGGTGAAGTTGGAGGG - Intergenic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1028616408 7:92772711-92772733 ATCTCAAGGGTGAGGGTGGAGGG - Intronic
1028761125 7:94497428-94497450 ATATCAAAGAGGCAGCTGGACGG - Intergenic
1029010069 7:97250445-97250467 CTGTCAGAGGGGCAGGGGGAGGG - Intergenic
1029144926 7:98439128-98439150 ATGGCAGAGGGGAAGGGGTATGG - Intergenic
1031329467 7:120446747-120446769 TTGTTATAGGGGAAGGCGGATGG + Intronic
1032155377 7:129463469-129463491 TTTTCAAAGGGGAAGATGGAAGG - Intronic
1032476220 7:132213229-132213251 ATGTCTAAGGGGAGGCAGGATGG + Intronic
1033215096 7:139487657-139487679 AAGACAAAGGGGAAGGGGAAGGG + Intergenic
1034120299 7:148620727-148620749 GAGTCAAAGGGGCAGCTGGAAGG - Intergenic
1034165422 7:149021704-149021726 ATGTCCCAGGGGAAGTTGGAGGG + Intronic
1034891721 7:154845512-154845534 ATGTCAAGGGGGAAGGGAGGAGG + Intronic
1035243319 7:157546425-157546447 CTGTCAGTGGGGAAGGGGGATGG - Intronic
1035553339 8:545563-545585 AAGGCTGAGGGGAAGGTGGAGGG + Intronic
1035685256 8:1519606-1519628 GTGTCCATGGGGAAGGTGCATGG - Intronic
1036132449 8:6128431-6128453 AGGGCAGAGGGGAAGGTAGAGGG + Intergenic
1036418345 8:8571826-8571848 ATGTCAAAGGGAAAGCAGGTCGG - Intergenic
1037652534 8:20851901-20851923 AGGGGAAAGGGGAAGATGGAGGG + Intergenic
1037674130 8:21039696-21039718 ATTTGAAAGGGAAAGATGGATGG - Intergenic
1039385618 8:37133388-37133410 ATATCAGAGTGGAAAGTGGATGG - Intergenic
1039385898 8:37135220-37135242 ATGTCAGAGTGGAAAGTAGATGG + Intergenic
1041789628 8:61678749-61678771 AGATCCAAGGGGAAGGAGGAGGG - Intronic
1041860567 8:62508350-62508372 ATGTCCAAGGTGGAGGGGGAGGG - Intronic
1042781956 8:72501056-72501078 AGCTTAAAGGGGAAGGTGAAGGG - Intergenic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1045444645 8:102248092-102248114 TTGTCAAGGTGGAGGGTGGAGGG + Intergenic
1045608164 8:103802434-103802456 GAGCCAAAGGGGAAGGTGAAAGG - Intronic
1045967469 8:108041862-108041884 AGGTCAAAGGGGAAGGGAGTAGG + Intronic
1047557174 8:125944931-125944953 ATGAGAAAGGGGAAAGTGTAGGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051697216 9:19781368-19781390 ATGAAGTAGGGGAAGGTGGAAGG + Intronic
1052642346 9:31184989-31185011 ATGGCAAAAGGGAGGGTGGGAGG + Intergenic
1053474384 9:38371457-38371479 AAGGCAAAGGTGAAGGTGGTGGG + Intergenic
1054949993 9:70839015-70839037 AACTCAAGGTGGAAGGTGGAAGG - Intronic
1056206431 9:84323786-84323808 ATGTCATTGGGGAAGGTCAAGGG - Intronic
1056486297 9:87061561-87061583 ATTTTAAAGGAGAAGGTGAAAGG - Intergenic
1057904636 9:98974494-98974516 CTGACAAAGGGCAAGGAGGAGGG + Intronic
1058743396 9:107966513-107966535 ATGTTAAAGGTGAAGATGAAGGG - Intergenic
1059975596 9:119713521-119713543 ACCTCAAGGGGGAGGGTGGAAGG - Intergenic
1060024540 9:120160183-120160205 ATGAGAAAGGGAAAGTTGGAGGG + Intergenic
1060108581 9:120890653-120890675 ATTTCAAAGGGCATGGGGGAGGG + Intronic
1060274068 9:122169020-122169042 ATGTCCAAGGGCAAGGAAGATGG + Intronic
1060600891 9:124876613-124876635 ATCTCAAAAGGGAAGCTCGAGGG + Intronic
1060675078 9:125506423-125506445 AGATCAAAGGGGCAGGAGGAGGG + Intronic
1060773303 9:126348294-126348316 AGGACAAAGGGGAATGTGGAGGG - Intronic
1062515773 9:136934710-136934732 GTGTCACTGTGGAAGGTGGAAGG - Intronic
1062645184 9:137544189-137544211 AGGTCAGAGGGGAAGTTGGGGGG - Intronic
1186228011 X:7422209-7422231 ATGTCAGGGGGTAGGGTGGAGGG - Intergenic
1186514489 X:10156444-10156466 ATTTGAAAGGCGAGGGTGGAGGG + Intergenic
1186547476 X:10465493-10465515 ATGACAAAGGCGAAGGCGAAGGG + Intronic
1187652976 X:21431278-21431300 AAGTCAAAGTGGAAGATGAAGGG - Intronic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1188136913 X:26502855-26502877 AAGCCAAAGGGGAAGGAGAAGGG + Intergenic
1188411696 X:29880684-29880706 CTGTCAAAAGGGAAGTTTGATGG - Intronic
1190128478 X:47725567-47725589 ATGTCAAAGGATGAGGTGGGTGG + Intergenic
1191717102 X:64201169-64201191 ATTCCAAAAGGGGAGGTGGAGGG + Intronic
1191842964 X:65526071-65526093 ATATCAAATGGCAAGGTGGAGGG - Intronic
1192229262 X:69253899-69253921 ATGTCAAAGGGGGAAGGGGCAGG - Intergenic
1193898675 X:87147924-87147946 ATGTTAAAGTTGATGGTGGAAGG - Intergenic
1195579566 X:106485685-106485707 AAGTCAGAGGGGCAGGTGTAGGG + Intergenic
1195800903 X:108708758-108708780 TTTTCAAGGTGGAAGGTGGAAGG + Intergenic
1197677469 X:129346093-129346115 ATTGCAAAAGGGAAGGTGGATGG + Intergenic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1198255291 X:134919116-134919138 ATGTCCTAGGGAAGGGTGGATGG - Intergenic
1199049868 X:143224474-143224496 ATTTCAAAGAGAAAGGAGGAGGG + Intergenic
1199163641 X:144645377-144645399 CTGTCAAGGTGGAAGGTGAATGG - Intergenic
1201887705 Y:18903963-18903985 AGGTAAAAGGGGATGGAGGAAGG + Intergenic