ID: 928945104

View in Genome Browser
Species Human (GRCh38)
Location 2:36765078-36765100
Sequence CCTTATATGGAAAAAATGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 242}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928945097_928945104 -2 Left 928945097 2:36765057-36765079 CCCTGGAACCATTGAATGTTTCC 0: 1
1: 0
2: 10
3: 75
4: 333
Right 928945104 2:36765078-36765100 CCTTATATGGAAAAAATGTGGGG 0: 1
1: 0
2: 4
3: 24
4: 242
928945098_928945104 -3 Left 928945098 2:36765058-36765080 CCTGGAACCATTGAATGTTTCCT 0: 1
1: 0
2: 11
3: 83
4: 413
Right 928945104 2:36765078-36765100 CCTTATATGGAAAAAATGTGGGG 0: 1
1: 0
2: 4
3: 24
4: 242
928945093_928945104 24 Left 928945093 2:36765031-36765053 CCTGGAAAAGATATCCATGTCCT 0: 1
1: 0
2: 12
3: 55
4: 365
Right 928945104 2:36765078-36765100 CCTTATATGGAAAAAATGTGGGG 0: 1
1: 0
2: 4
3: 24
4: 242
928945092_928945104 25 Left 928945092 2:36765030-36765052 CCCTGGAAAAGATATCCATGTCC 0: 1
1: 1
2: 3
3: 24
4: 236
Right 928945104 2:36765078-36765100 CCTTATATGGAAAAAATGTGGGG 0: 1
1: 0
2: 4
3: 24
4: 242
928945099_928945104 -10 Left 928945099 2:36765065-36765087 CCATTGAATGTTTCCTTATATGG 0: 1
1: 2
2: 44
3: 191
4: 951
Right 928945104 2:36765078-36765100 CCTTATATGGAAAAAATGTGGGG 0: 1
1: 0
2: 4
3: 24
4: 242
928945095_928945104 10 Left 928945095 2:36765045-36765067 CCATGTCCTAATCCCTGGAACCA 0: 1
1: 43
2: 180
3: 534
4: 1098
Right 928945104 2:36765078-36765100 CCTTATATGGAAAAAATGTGGGG 0: 1
1: 0
2: 4
3: 24
4: 242
928945096_928945104 4 Left 928945096 2:36765051-36765073 CCTAATCCCTGGAACCATTGAAT 0: 1
1: 7
2: 148
3: 587
4: 1324
Right 928945104 2:36765078-36765100 CCTTATATGGAAAAAATGTGGGG 0: 1
1: 0
2: 4
3: 24
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928945104 Original CRISPR CCTTATATGGAAAAAATGTG GGG Intronic
902408115 1:16197445-16197467 CCTCATATGACAAAAAAGTGGGG + Intergenic
906560458 1:46752911-46752933 CCTCATATGGAAATAATTTGTGG + Intergenic
907282528 1:53360494-53360516 CCTTTATTGGAAAAAAAGTGAGG - Intergenic
907610624 1:55866412-55866434 CTTTAATTGGAAAAAATGAGGGG - Intergenic
907933762 1:59023464-59023486 CCTTGTATGGAAATCATGTCTGG + Intergenic
908037156 1:60068248-60068270 GGTTATATGGAATAAATGTTTGG - Intronic
909771154 1:79423391-79423413 CTTTATATGGAAATAATGCACGG + Intergenic
911077070 1:93886838-93886860 ACTTATATGAAAAAAATGTTGGG + Exonic
911387953 1:97201195-97201217 CCTTAAATGTTAAAAATCTGTGG - Intronic
912396932 1:109352773-109352795 CCTTAAATGGAAGAAATTTCAGG + Intronic
912744291 1:112232336-112232358 CTTTCTATGGTAAACATGTGTGG + Intergenic
917740643 1:177958974-177958996 CCCTACATGGAAAAAATTTAGGG + Exonic
917993553 1:180410034-180410056 GCTGATATGGAAAAAGTGAGTGG + Intronic
918098570 1:181354341-181354363 CCTGCTATGGAGAAAATCTGGGG + Intergenic
919618143 1:199833061-199833083 TCTAATATGGAAAAAATCTGTGG - Intergenic
921117673 1:212109485-212109507 CCTTATCTGAAAAAAAAATGGGG - Intergenic
921611503 1:217217438-217217460 CCTTTCATGGAAAAAATTGGAGG + Intergenic
923640427 1:235753751-235753773 CCTTATCTGTCAAAAATATGTGG + Intronic
923869129 1:237971889-237971911 CCTTTTATAGAAAAAAATTGGGG + Intergenic
924197411 1:241622781-241622803 CCTTAAAGGGAAAAAACATGCGG - Intronic
1063113901 10:3059839-3059861 CTTTATATAGAAAACAGGTGGGG - Intergenic
1064564756 10:16628699-16628721 ACTTACAGGGAAAAAATATGGGG + Intronic
1066131892 10:32402652-32402674 CATTTTATTGAAAAAGTGTGTGG - Intergenic
1068383717 10:56295349-56295371 CCTTATAAGGGGAAAATGAGAGG - Intergenic
1069092642 10:64220153-64220175 CCTTTTATGGAAGGAATGTCAGG + Intergenic
1071675238 10:87649462-87649484 CTTTGTAAGGAAAAAATTTGTGG + Intergenic
1074229473 10:111519498-111519520 CCTTATATACAAGAAAGGTGAGG - Intergenic
1074936243 10:118184359-118184381 GCTCATATGCAAAACATGTGGGG + Intergenic
1078940469 11:15998540-15998562 CCTTATATGAAAAAACTTTGAGG - Intronic
1079472505 11:20791477-20791499 TCTTATATGGAAAAATTCTAAGG - Intronic
1080198674 11:29642674-29642696 CCTGACATGGAAAAATTGTTAGG + Intergenic
1080311080 11:30893095-30893117 AATTATATGGAAAAAATTTTAGG + Intronic
1080830242 11:35886821-35886843 CCAGAAATGGAAAATATGTGGGG - Intergenic
1082037716 11:47658708-47658730 CCTTTTAGGGATAAAAAGTGGGG + Intergenic
1084803576 11:71563863-71563885 CCTTAAATGGGAGAATTGTGTGG + Intronic
1085591290 11:77763797-77763819 CCATATATGCAAAAATTCTGAGG + Intronic
1085857601 11:80193113-80193135 CCTTACATGACAAAAATGTAAGG + Intergenic
1086310613 11:85532361-85532383 CCTCATATGGAACAAAGATGAGG - Intronic
1086855395 11:91859719-91859741 TCTTATTTGGAATCAATGTGAGG + Intergenic
1087291406 11:96324637-96324659 CATTACCTGGAGAAAATGTGGGG - Intronic
1088447022 11:109942108-109942130 GTTTATATGGAAAAAATTGGAGG + Intergenic
1089846153 11:121460262-121460284 TCTTACATGAAATAAATGTGGGG + Intronic
1092994066 12:13931499-13931521 AGTTAGATGGAAAAAATGTCAGG - Intronic
1093271820 12:17072223-17072245 CATTATATGGAAAGAAAATGTGG - Intergenic
1094004686 12:25737128-25737150 CCTGATATGGAGAAGATGTGAGG + Intergenic
1094154566 12:27325731-27325753 ATTTTTATGAAAAAAATGTGAGG + Exonic
1097854733 12:64450867-64450889 CCTTATAAGAAAACACTGTGTGG + Exonic
1098038959 12:66335069-66335091 CCTGAGATGGGAAAGATGTGAGG + Intronic
1098244221 12:68499803-68499825 GCACACATGGAAAAAATGTGTGG - Intergenic
1099843508 12:87997970-87997992 ACACATATGTAAAAAATGTGAGG + Intronic
1100048539 12:90414357-90414379 CTTTTTAAGGAAAAAAAGTGGGG + Intergenic
1100241954 12:92718573-92718595 CCTTTTAGGGAAAAATTGTATGG + Intergenic
1101178860 12:102188288-102188310 CCATATTTGGAAATAAAGTGGGG + Intronic
1103084490 12:118052054-118052076 ACTTAAATGGACAAACTGTGTGG + Intronic
1106630199 13:31463673-31463695 CCGTAGAGGGAAAAAATGTATGG + Intergenic
1108318625 13:49263992-49264014 CCTTATAAGAAAACACTGTGTGG - Intronic
1108613621 13:52108830-52108852 GGTTATATGAAAAATATGTGTGG - Intronic
1108747740 13:53412136-53412158 CATTAAATGGAAAAAATGGGAGG + Intergenic
1110190090 13:72720553-72720575 TCTGATATGGAAGAAATGGGAGG - Intronic
1110851682 13:80253091-80253113 ACTTATATGGAGACAATGTTCGG - Intergenic
1111888401 13:94051986-94052008 CCTTACATGGAGAAACTCTGTGG - Intronic
1112650754 13:101394694-101394716 CATGAGATGGAAAAAATGTCTGG - Intronic
1113840439 13:113356660-113356682 CCTTAAAAGAAAAAAATCTGAGG + Intronic
1114763827 14:25348287-25348309 TCTTATATGGCAAAAATTGGGGG - Intergenic
1114843181 14:26289973-26289995 CATTATATGGATAAAAAGTAAGG - Intergenic
1114909860 14:27177486-27177508 CCTAATATGTACAAAATGTGAGG - Intergenic
1117562158 14:56951731-56951753 GCCTGCATGGAAAAAATGTGTGG - Intergenic
1118138964 14:63058844-63058866 CCTTAGGTGGAAAAAAGTTGGGG + Intronic
1118156812 14:63250538-63250560 CCTGAGATGGGAAAGATGTGAGG - Intronic
1126398241 15:48242245-48242267 CCTACTATGGAAAAAGTATGAGG - Intronic
1126616430 15:50585885-50585907 CCTTTTGTGTAAAAAATGAGAGG + Intronic
1129925902 15:79364315-79364337 CCTTATATGCATAAAATATCTGG + Intronic
1130636448 15:85625516-85625538 CCTTTAATGAAAAAAATGTCTGG + Intronic
1131786891 15:95923074-95923096 CCTTAACTGGATAAAATTTGAGG - Intergenic
1132359925 15:101203580-101203602 CCTTATAGGGAAATATTTTGAGG - Intronic
1133076922 16:3287096-3287118 TGATATATGGAAACAATGTGCGG - Intronic
1133114736 16:3570993-3571015 CCATATATGTAAAAAATGTGTGG + Intronic
1133962893 16:10510063-10510085 CCTTATTTGGAAAAAAGGATCGG + Intergenic
1137501969 16:49018798-49018820 CCTCATAGGGAAGAAATGTTTGG - Intergenic
1139299824 16:65935498-65935520 CCCTATATGAAGAAAATGGGTGG - Intergenic
1139605938 16:68018568-68018590 TCTTAGGTGGTAAAAATGTGAGG - Intronic
1140341274 16:74165925-74165947 ACTAATATGGAACTAATGTGGGG + Intergenic
1141361428 16:83398535-83398557 TCTTATTTGGAAAATAAGTGGGG - Intronic
1141655292 16:85412826-85412848 CTTTATATGGCAAAAAGGTAAGG - Intergenic
1143128325 17:4659153-4659175 CCGAATAAGAAAAAAATGTGAGG + Intergenic
1147348495 17:39821709-39821731 CCTCTAATGGAAAAAATATGTGG + Intronic
1148042469 17:44719309-44719331 CTTTATATGGATGAATTGTGTGG - Intronic
1148177560 17:45580680-45580702 CCTTTTATGGAAAAAATGTAAGG - Intergenic
1149189092 17:54037002-54037024 CCTTATAGGGCAAAATAGTGAGG - Intergenic
1150587718 17:66533606-66533628 CCTTAGATGGGAAAAATGAATGG - Intronic
1150747772 17:67829948-67829970 CCTTTTATGGAAAAAATGTAAGG + Intronic
1151138929 17:71973308-71973330 CCTTATTTGCAGAAAGTGTGTGG + Intergenic
1152975795 18:217122-217144 TCTTAAATGGAATAAATTTGTGG - Intronic
1154217877 18:12428847-12428869 CCTTTTATGTGAAAAATTTGGGG + Intronic
1154975022 18:21448945-21448967 CTCTATCTGGGAAAAATGTGAGG + Intronic
1155039939 18:22056457-22056479 TTTAAAATGGAAAAAATGTGAGG - Intergenic
1156119392 18:33823493-33823515 CCTTGTAAGGAAAAAATATCAGG - Intergenic
1157812828 18:50709870-50709892 GTTAATATGGAAAAAATGTAAGG - Intronic
1159274750 18:66203306-66203328 TCTTACATGGAAAAAAAGGGGGG + Intergenic
1159299201 18:66540947-66540969 CCTTGTATGGTAAAAATTAGAGG - Intronic
1163000429 19:14363510-14363532 CCTTATGTGGAAAAATTTGGAGG + Intergenic
925620824 2:5791106-5791128 TCTTATAGGGAAAAAAAATGGGG - Intergenic
926125474 2:10269330-10269352 CCTTATGTGTAAAACATGTTTGG + Intergenic
926722616 2:15972425-15972447 CATTATATGGAACAAATGATAGG + Intergenic
928945104 2:36765078-36765100 CCTTATATGGAAAAAATGTGGGG + Intronic
930106097 2:47640634-47640656 CCTTATATGTAAGAAAACTGAGG - Intergenic
931940345 2:67245112-67245134 ACTTATTTGGGGAAAATGTGAGG - Intergenic
937134021 2:119536810-119536832 CCTTATCAGGCAGAAATGTGGGG - Intergenic
938780229 2:134577792-134577814 CCATAGATCGAAAACATGTGGGG + Intronic
940289406 2:152063848-152063870 ACTTTTCTGGAAAAATTGTGAGG - Intronic
943162698 2:184275788-184275810 CCATATATGGAAAAACTGCTAGG - Intergenic
943177840 2:184501174-184501196 TCTTGTATTGAAAAAGTGTGTGG + Intergenic
944462080 2:199960231-199960253 CTTTATATGGAAGGAATGAGGGG + Intronic
944758322 2:202786979-202787001 CCTTGTATAGAAAAGATCTGAGG + Intronic
944968474 2:204963249-204963271 TCTTATGTGGATAAAATGTATGG + Intronic
945516968 2:210774552-210774574 CCATAGATGGAAAATATTTGCGG - Intergenic
945879716 2:215312759-215312781 CTTTATGGGGAAAAAAAGTGAGG + Intronic
946463313 2:219889472-219889494 CAGTATAGGCAAAAAATGTGAGG - Intergenic
946854601 2:223940447-223940469 CCTTATAGGGAGGAAGTGTGAGG + Intronic
947628947 2:231639390-231639412 ACTTATATAAAATAAATGTGAGG + Intergenic
1168825359 20:809447-809469 TCTAATCAGGAAAAAATGTGGGG - Intergenic
1168881823 20:1212719-1212741 CCTTATATGGAAAGAAAGGCAGG - Intergenic
1169398742 20:5260834-5260856 CCTTCTATGGCAAAAATGAGTGG + Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1172818936 20:37714691-37714713 CCTTATAGGCAAAAAATAAGAGG + Intronic
1172889294 20:38252735-38252757 CCTTAAATGGTAACAGTGTGTGG - Intronic
1172929389 20:38573755-38573777 TCTTATAGGGAACAAAAGTGTGG - Intronic
1180295298 22:10928871-10928893 CCTAATAGGGAAAAAAGGGGGGG - Intergenic
1182916811 22:34041026-34041048 ACTTATTTCAAAAAAATGTGAGG - Intergenic
1184629788 22:45767454-45767476 AATTATATAGAAAAAATGTGTGG - Intronic
949849388 3:8407200-8407222 TCTTATATGGCAAAAAAGGGAGG + Intergenic
952453998 3:33455958-33455980 CCTTTTATTTAAAAAATGTATGG - Intergenic
953370779 3:42386514-42386536 CCTTTTATGGAAAAAAAGGGGGG - Intergenic
955789464 3:62573325-62573347 CCATGGATGGAAAATATGTGGGG - Intronic
955984812 3:64561497-64561519 CTTTATAGGGAACAGATGTGAGG + Intronic
956472731 3:69585044-69585066 CATTATCTGGAGAAAAGGTGAGG + Intergenic
958545731 3:95548146-95548168 TCTGAAATGAAAAAAATGTGAGG - Intergenic
959158103 3:102691592-102691614 CCACATGTGAAAAAAATGTGGGG - Intergenic
959429065 3:106229614-106229636 CATTATATGGCAAAAGTGAGGGG + Intergenic
960126347 3:114002568-114002590 TTTTATATTGAAAAAATATGAGG + Intronic
960446719 3:117758301-117758323 CCTCATATGAAAAAACTATGGGG - Intergenic
963986063 3:151596412-151596434 CCTTATATGGAAAGCATTTTTGG - Intergenic
964263514 3:154868535-154868557 CCTTAAATGGAATAGATTTGGGG + Intergenic
964268299 3:154925934-154925956 CCTTATTTGGTCAATATGTGAGG - Intergenic
964387677 3:156166041-156166063 CTGAATATGGAAAAAATGAGGGG - Intronic
964411249 3:156399983-156400005 CCTTATATGGAAGGCGTGTGAGG - Intronic
967701655 3:192599843-192599865 CATTATAGAGAAAAAAAGTGTGG + Intronic
968321171 3:197769927-197769949 CATTATATTTAAAATATGTGAGG - Intronic
969815222 4:9681982-9682004 CTTTAAATGGGAAAATTGTGTGG + Intergenic
969901171 4:10351098-10351120 TCTTATATGGAGAAAATTTAAGG - Intergenic
969967661 4:11013869-11013891 CCTTATTTGGAAAAAGTGTGAGG + Intergenic
970016401 4:11517178-11517200 CCTTATAAGAAAAAAAGGGGAGG - Intergenic
970499812 4:16665750-16665772 CCTTAAATGGAAAAAAAAAGGGG + Intronic
971440094 4:26676415-26676437 ACTTAAATGGAAGAAATGTCAGG + Intronic
973680196 4:53309455-53309477 ACTTTTATGGAAAAAATCTCTGG - Intronic
974693353 4:65331456-65331478 CCTTAGATTGAAAGAATGTAAGG + Intronic
978411228 4:108428343-108428365 CCTTAAATGGAAAATACATGAGG - Intergenic
979582842 4:122379963-122379985 CCATTTATGGAAATAATGGGGGG + Intronic
982430492 4:155316342-155316364 CAGTAGATGGAAAAAATGTGTGG - Intergenic
983333580 4:166362409-166362431 CTTGCTATGGAAGAAATGTGGGG + Intergenic
984073967 4:175151922-175151944 CCTAATTTGGAAAGAATGAGTGG + Intergenic
984874527 4:184355432-184355454 CCTTATGTGGCTAAAATGTGAGG + Intergenic
986569604 5:9151515-9151537 AATTATAAGGAAAAATTGTGGGG - Intronic
986627101 5:9732409-9732431 CCTTATATGTAAACGAGGTGTGG - Intergenic
986827491 5:11537430-11537452 TCTTATTTGAAAAAAATATGGGG + Intronic
986839517 5:11680117-11680139 CATTTTAAGGAAAAACTGTGAGG + Intronic
986941786 5:12960179-12960201 CCAAATATGGATAAAATATGTGG + Intergenic
987226540 5:15847623-15847645 CATTATATGGAAAAGGTGGGGGG + Intronic
987398700 5:17451696-17451718 CGTGATATGTAATAAATGTGAGG - Intergenic
987547612 5:19333239-19333261 CCTTACATGGCAGAAAGGTGAGG + Intergenic
988364415 5:30277494-30277516 CCTTCTAGGTAAAAAATGTGTGG + Intergenic
989668732 5:43888771-43888793 CCTGATATGGGACAAATGAGAGG + Intergenic
992568037 5:78022118-78022140 CCACATATGGAAAAAATATAAGG - Intronic
993396357 5:87394484-87394506 CCTAAGAAGGAAAAAAAGTGTGG + Exonic
993970749 5:94417059-94417081 CTTTATACTGAAAAAATGTAAGG + Intronic
994199253 5:96953594-96953616 CCTTATATGAACATAATATGTGG + Intronic
994818327 5:104613662-104613684 ACTAATATGAAATAAATGTGAGG + Intergenic
995008001 5:107224973-107224995 GCTTGTATGGAAAGCATGTGTGG - Intergenic
995304221 5:110624984-110625006 TCTTTTTTGGAAAATATGTGAGG + Intronic
996561144 5:124830866-124830888 CCTTTTTGGGGAAAAATGTGAGG + Intergenic
996582961 5:125052107-125052129 CTTTATATGTAAAGAATTTGAGG + Intergenic
996857596 5:128027137-128027159 CCATATATGGAAAATATGTTGGG + Intergenic
998346260 5:141466863-141466885 CATATTATGAAAAAAATGTGTGG - Intronic
998831468 5:146164008-146164030 CCTTATATGGGTACAGTGTGTGG + Intronic
999072574 5:148761863-148761885 CCTTTTATGTAAAAAAAATGTGG - Intergenic
1000744961 5:165021110-165021132 CATTATATGAAAAAGATATGTGG - Intergenic
1005169252 6:22963132-22963154 CCTTAAATGGAAAAACTATTAGG + Intergenic
1005618913 6:27602131-27602153 CCGTCTATAGAAAAAATGAGCGG - Intergenic
1006332094 6:33398943-33398965 CCATTTATGTAAAAAAGGTGGGG - Intronic
1008346369 6:50432412-50432434 CCATTCATTGAAAAAATGTGGGG + Intergenic
1008831640 6:55770891-55770913 TCTTATATGGGTAAAATTTGTGG + Intronic
1008907135 6:56691066-56691088 CCTTCAATGGAAAATATATGTGG - Intronic
1010329327 6:74604311-74604333 TCTTATCTGGAAAATGTGTGTGG + Intergenic
1010711922 6:79185047-79185069 CCTTTTGTGGAAAAAAATTGTGG + Intergenic
1011843584 6:91532578-91532600 ATTTAAATGGAAAAAATGCGTGG - Intergenic
1012095728 6:94956760-94956782 CCTTATATGTCAAGACTGTGAGG + Intergenic
1012393351 6:98768376-98768398 CCTTGTGTGGAATAAATGAGGGG - Intergenic
1012637554 6:101563564-101563586 TTTTAAATGGAAAAATTGTGTGG - Intronic
1012882772 6:104811453-104811475 CCTTATATGGATTAAAATTGTGG - Intronic
1013322076 6:109003348-109003370 CCTTTTAAAGAAAAAAAGTGGGG + Intronic
1014210201 6:118700529-118700551 CATAATATGGAGAATATGTGTGG - Intronic
1014956235 6:127620147-127620169 CCTTATAAGTGAAAAATGAGAGG + Intergenic
1016095069 6:140026643-140026665 CCAGAAATGGTAAAAATGTGAGG - Intergenic
1017749858 6:157481161-157481183 TTTTACATGGAAAAAATGAGTGG - Intronic
1018698748 6:166411009-166411031 TCTTCTATGGAGAAAATGTGAGG + Intronic
1021101709 7:16591864-16591886 CCTTATTTGGAAATAAAGTGTGG - Intergenic
1021140277 7:17015929-17015951 TCTTATTTGGAAGAAATGTGAGG + Intergenic
1022595007 7:31705023-31705045 TCTTATAATGAAAAAATATGTGG - Intronic
1023217073 7:37874109-37874131 CCTTCTGTGGAAAATAAGTGAGG + Intronic
1025535861 7:61947280-61947302 CCTTATTTGGAGAATATGAGAGG + Intergenic
1027364819 7:77446389-77446411 CCTAGTAAGCAAAAAATGTGTGG - Intergenic
1027406159 7:77863497-77863519 CCTTATATGAAATCAATGTAAGG - Intronic
1027976666 7:85165801-85165823 CCTTTTATGGAGAAAATATGTGG + Intronic
1028212545 7:88092637-88092659 CATTATAGGAAAAAAATTTGGGG + Intronic
1028372009 7:90102486-90102508 TCTTCTGTGGAAAAAAAGTGGGG + Intergenic
1029656305 7:101927244-101927266 CTTTACATGGAAGAAATGTGGGG - Intronic
1030310565 7:108064729-108064751 CCTTAGATGTAACAAATGAGGGG + Intronic
1031014300 7:116556529-116556551 CACTTTATAGAAAAAATGTGAGG - Intronic
1031121850 7:117730799-117730821 CCTGAGATGGAAAAAATTCGGGG + Intronic
1031554312 7:123153222-123153244 CCTTATTAATAAAAAATGTGTGG - Intronic
1032316032 7:130839872-130839894 CACAATATGGAAAAAATTTGAGG + Intergenic
1034565794 7:151914609-151914631 CATTATATGGCAAAAATGAGGGG + Intergenic
1037148496 8:15604793-15604815 CCAAATATAGAAAAAATGTAGGG - Intronic
1038062158 8:23925555-23925577 CCTTATTTGAAAAAAATGAAAGG - Intergenic
1038806899 8:30802343-30802365 CTTCATATGCAAAAAATATGTGG - Intronic
1039352052 8:36773683-36773705 CTTTATAAGGAAAAGTTGTGTGG - Intergenic
1040475524 8:47773821-47773843 CCGTAAATGGAGGAAATGTGGGG - Exonic
1040763912 8:50883196-50883218 GCATAAATGGAAAAAATATGAGG + Intergenic
1041599147 8:59695025-59695047 CTTTATGTAGAAAAAGTGTGGGG + Intergenic
1042364324 8:67918994-67919016 CCTGATATGGTGAAGATGTGCGG + Intergenic
1042427172 8:68661743-68661765 CCTTATCTGCAAAAAATATCTGG + Intronic
1042718016 8:71795982-71796004 CCTTTCATGGAAAATCTGTGTGG - Intergenic
1046296631 8:112228112-112228134 CCTTATCAAGAAAAAATATGTGG - Intronic
1047268632 8:123332948-123332970 CCTTCTTTTGAAAAAATGGGAGG - Intronic
1050564487 9:6868071-6868093 GCTGATATGGATGAAATGTGTGG + Intronic
1050682555 9:8130177-8130199 ACTTTTATGGAAAAAAAATGAGG - Intergenic
1050882615 9:10721776-10721798 CCTAATATGGTAAAATTCTGTGG - Intergenic
1051724965 9:20079482-20079504 TCTTAAATGGAAAAAATAAGTGG - Intergenic
1051978527 9:22984312-22984334 CTTTATATGGTAAAATTGAGTGG + Intergenic
1052369071 9:27644340-27644362 CCTTATATAGCATATATGTGAGG + Intergenic
1052949712 9:34198701-34198723 CCTCATAGGGAAGAAATGGGAGG - Intronic
1055017033 9:71629864-71629886 CCTTTTATCCAAAAAATGTGTGG + Intergenic
1055842439 9:80520897-80520919 CATTCTATGCAAACAATGTGTGG - Intergenic
1056867107 9:90237859-90237881 CCTTATAGAGAAAAAATTTCCGG + Intergenic
1057337763 9:94169520-94169542 CCTCAAATGGAAAATATTTGGGG + Intergenic
1057743581 9:97733768-97733790 CCTTGTAAGGAAATAATTTGAGG + Intergenic
1058137217 9:101320211-101320233 CCTCATATGGATACAATTTGAGG + Intronic
1058181385 9:101804583-101804605 ACTTAGATGGAAAAAAGTTGGGG - Intergenic
1186069851 X:5807761-5807783 CATTACATCCAAAAAATGTGGGG + Intergenic
1186083695 X:5962779-5962801 CCTCACATGGAAAAAGGGTGAGG - Intronic
1187139462 X:16578474-16578496 CCTTTTAAGGAAAAAAAATGTGG + Intergenic
1187505974 X:19878898-19878920 CCTTAAATGGATAAATTGTATGG + Intronic
1188537887 X:31217745-31217767 CCTTTTATTGAACATATGTGTGG - Intronic
1192258883 X:69491572-69491594 ACTTATATGGATAAATTGTGTGG + Intergenic
1192881768 X:75292695-75292717 ACTTATATGGAAGAAAGATGAGG + Intronic
1193500526 X:82268639-82268661 CCTTATATGCAAAAACTTTCTGG - Intergenic
1193902948 X:87204664-87204686 CCTTATATGGAAATTATTGGAGG - Intergenic
1193961951 X:87937201-87937223 TCTTAAATGAAAAAATTGTGAGG + Intergenic
1194737459 X:97529530-97529552 CCTTATCTGTAAAACATATGAGG - Intronic
1194806299 X:98332427-98332449 CCTTACATGGCAAAAATAGGGGG + Intergenic
1194844256 X:98783868-98783890 CATTAGATTGAAAAAATATGAGG + Intergenic
1194885573 X:99312163-99312185 CATTATCTGGAAAAAATATGAGG - Intergenic
1195001413 X:100646807-100646829 CCTCATTTGGAAAAAATAAGGGG + Intronic
1195729629 X:107953103-107953125 TTTAATATGGAAAAAATGTTTGG + Intergenic
1196009451 X:110871449-110871471 TCTTATAGCTAAAAAATGTGAGG - Intergenic
1197805758 X:130397049-130397071 CCCTATAAGGAAAACATATGTGG - Intergenic
1199042864 X:143134886-143134908 ACATATATGAAAATAATGTGTGG - Intergenic
1199800806 X:151248814-151248836 CCTCATTTGGGGAAAATGTGCGG - Intergenic
1200532333 Y:4354871-4354893 CGTTATATAGAAAAAGGGTGAGG + Intergenic
1201624631 Y:16001276-16001298 CTTTACATAGAAAAATTGTGTGG + Intergenic
1201702508 Y:16899794-16899816 ACTTATATAGAAAAAAAGTGGGG + Intergenic