ID: 928945435

View in Genome Browser
Species Human (GRCh38)
Location 2:36767808-36767830
Sequence GATGATCAGATGGGCTCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 422}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928945435 Original CRISPR GATGATCAGATGGGCTCCTT AGG (reversed) Intronic
900028528 1:353108-353130 GGTGATCAGATGGGTGTCTTTGG - Intergenic
904435863 1:30494753-30494775 GTTGATCACATCGGCTCCTGAGG - Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
905941479 1:41866705-41866727 GATGGTCGGATGTGTTCCTTGGG - Intronic
906760016 1:48368576-48368598 GTTGATCACATCGGCTCCTGAGG + Intronic
907416945 1:54321090-54321112 CATGAACAGAAGGGCTTCTTGGG - Intronic
907991632 1:59588154-59588176 GTTGATCACATCGGCTCCTGAGG - Intronic
908691161 1:66781526-66781548 GTTGATCACATCGGCTCCTGAGG - Intergenic
909422067 1:75477612-75477634 GTTGATCACATCGGCTCCTGAGG - Intronic
909778706 1:79516037-79516059 GTTGATCGCATGGGCTCCTGGGG + Intergenic
909846327 1:80399126-80399148 GTTGATCGCATGGGCTCCTGAGG + Intergenic
909886364 1:80946755-80946777 GTTGATCGCATGGGCTCCTGAGG - Intergenic
910068550 1:83183396-83183418 GTTGATCACATTGGCTCCTGAGG - Intergenic
910295748 1:85643207-85643229 GTTGATCGCATGGGCTCCTGAGG - Intergenic
910699827 1:90062069-90062091 GTTGATCACATCGGCTCCTGAGG + Intergenic
911066607 1:93795437-93795459 GTTGATCACATCGGCTCCTGAGG + Intronic
911141871 1:94511773-94511795 GTTGATCACATCGGCTCCTGAGG + Intronic
911290937 1:96056358-96056380 GTTGATCACATCGGCTCCTGAGG + Intergenic
911359318 1:96857990-96858012 GTTGATCACATCGGCTCCTGAGG + Intergenic
913434527 1:118832781-118832803 GTTGATCACATCGGCTCCTGAGG - Intergenic
913504023 1:119499013-119499035 GTTGATCACATCGGCTCCTGAGG - Intergenic
914197785 1:145458705-145458727 GATAATCATCTGGCCTCCTTGGG + Intergenic
914476889 1:148031816-148031838 GATAATCATCTGGCCTCCTTGGG + Intergenic
917161048 1:172057054-172057076 GTTGATCACATCGGCTCCTGAGG - Intronic
917581196 1:176379744-176379766 GCTGTTCAGTTGGGTTCCTTTGG + Intergenic
917706027 1:177635142-177635164 GTTGATCGCATGGGCTCCTGAGG - Intergenic
918035870 1:180871598-180871620 GTTGATCACATCGGCTCCTGAGG + Intronic
918337207 1:183528928-183528950 TGTGGTCAGATGGTCTCCTTTGG - Exonic
918351410 1:183659417-183659439 GTTGATCACATCGGCTCCTGAGG - Intronic
919375187 1:196785585-196785607 GATGATCACATCGGCTCCTGAGG + Intronic
920220019 1:204390125-204390147 CATGGTCAGATGGGTTCTTTTGG - Intergenic
922197355 1:223371325-223371347 GTTGATCACATCGGCTCCTGAGG + Intergenic
924639282 1:245817757-245817779 GTTGATCACATCGGCTCCTGAGG - Intronic
1063331211 10:5161386-5161408 GTGGCACAGATGGGCTCCTTTGG - Intergenic
1064761800 10:18628615-18628637 GTTGATCACATTGGCTCCTGAGG - Intronic
1065951117 10:30652079-30652101 GGTGATCAGAAAGGCCCCTTCGG + Intergenic
1066146134 10:32560032-32560054 GTTGATCACATCGGCTCCTGAGG - Intronic
1066257525 10:33695343-33695365 GGTGAGCAGTTGTGCTCCTTTGG + Intergenic
1066663425 10:37759028-37759050 AAGGATCAGATGGACTCCCTTGG + Intergenic
1067240456 10:44487598-44487620 GTTGATCACATCGGCTCCTGAGG + Intergenic
1067301390 10:45013951-45013973 GTTGATCACATCGGCTCCTGAGG + Intergenic
1068512560 10:57984669-57984691 TAAGATCTGATGGGGTCCTTAGG - Intergenic
1068737052 10:60425701-60425723 GAAGCTAAGATGGGCTCCTCTGG + Intronic
1069084355 10:64121507-64121529 GTTGATCACATCGGCTCCTGAGG - Intergenic
1069631875 10:69902235-69902257 GAGGATCAAATGGGATCCTTAGG - Intronic
1070094640 10:73324696-73324718 GTTGATCACATCGGCTCCTGAGG - Intronic
1070202262 10:74218229-74218251 GTTGATCACATCGGCTCCTGAGG - Intronic
1070404110 10:76079402-76079424 GCTGACCACATGGGCTCCTCAGG + Intronic
1070793665 10:79204462-79204484 GATGCTCAGAAGGGCCCCTGGGG - Intronic
1071333694 10:84585094-84585116 GATGATCAAATGGCCTCCCAGGG - Intergenic
1071456879 10:85857767-85857789 GAAGATCAAATAGGCTCCTTGGG + Intronic
1072405551 10:95148722-95148744 GTTGATCACATTGGCTCCTGAGG - Intergenic
1072855192 10:98938449-98938471 GTTGATCACATTGGCTCCTGAGG - Intronic
1073512275 10:104050277-104050299 AAAGATCAGATGTGCTCCTTTGG - Intronic
1073516667 10:104082024-104082046 GTTGATCAGCTGGTCTCATTTGG - Intronic
1075219061 10:120568476-120568498 GATGATCAGATGAGCACACTGGG + Intronic
1078711690 11:13798610-13798632 GTTGATCACATCGGCTCCTGAGG + Intergenic
1078817957 11:14845699-14845721 GTTGATCACATCGGCTCCTGAGG - Intronic
1078977834 11:16497677-16497699 GTTGATCAAATCGGCTACTTAGG - Intronic
1078980001 11:16521839-16521861 GTTGATCACATCGGCTCCTGAGG - Intronic
1079575658 11:22000629-22000651 GTTGATCACATGGGCTCCTGAGG + Intergenic
1079660615 11:23032899-23032921 GTTGATCACATTGGCTCCTGAGG + Intergenic
1080211905 11:29795821-29795843 GTTGATCACATTGGCTCCTGAGG - Intergenic
1080579330 11:33629569-33629591 GTTGATCACATCGGCTCCTGAGG + Intronic
1081086914 11:38812540-38812562 GTTGATCACATTGGCTCCTGAGG - Intergenic
1081442870 11:43099780-43099802 GTTGATCACATCGGCTCCTGAGG + Intergenic
1081543775 11:44055038-44055060 GAGGGTCAGATGGGCTGCTGGGG + Intronic
1082150307 11:48730617-48730639 GTTGATCACATCGGCTCCTGAGG - Intergenic
1082578592 11:54839209-54839231 GTTGATCACATCGGCTCCTGAGG - Intergenic
1085254465 11:75164585-75164607 GAGGAGCAGATGAGCTGCTTTGG + Intronic
1085779624 11:79396534-79396556 TATGAACAGTTGGGCTGCTTTGG - Intronic
1085798659 11:79566811-79566833 GATGATCACAGGGGCTTCTCTGG - Intergenic
1086175409 11:83885307-83885329 GTTGATCACATTGGCTCCTGAGG - Intronic
1086440936 11:86829275-86829297 GTTGATCACATCGGCTCCTGAGG + Intronic
1087451478 11:98329682-98329704 GTTGATCACATCGGCTCCTGAGG + Intergenic
1087598833 11:100286966-100286988 GTTGATCACATCGGCTCCTGAGG - Intronic
1087609525 11:100417336-100417358 CATGATCAGTTTGGATCCTTTGG - Intergenic
1087824170 11:102746221-102746243 GTTGATCACATTGGCTCCTGAGG + Intergenic
1090227779 11:125081964-125081986 GATGAGGAGATGGGGTGCTTGGG + Intronic
1091045546 11:132321387-132321409 GTTGATCACATCGGCTCCTGAGG - Intronic
1091077577 11:132634561-132634583 GATGATTAGATCTGCACCTTGGG + Intronic
1092119621 12:6034847-6034869 GATGACAAGTTGGGCACCTTGGG + Intronic
1092405273 12:8217422-8217444 GATGACCACATGGGCTACCTTGG - Intergenic
1093332205 12:17856764-17856786 GTTGATCACATCGGCTCCTGAGG - Intergenic
1093571344 12:20669059-20669081 GTTGATCACATCGGCTCCTGAGG - Intronic
1094735465 12:33228918-33228940 GTTGATCACATCGGCTCCTGAGG - Intergenic
1095657360 12:44686196-44686218 GTTGATCACATCGGCTCCTGAGG + Intronic
1095677157 12:44933050-44933072 GTTGATCACATTGGCTCCTGAGG - Intergenic
1096181965 12:49556023-49556045 GATGGTTAGATGGGCACCTAGGG - Intronic
1097467651 12:59948001-59948023 GTTGATCACATCGGCTCCTGAGG - Intergenic
1097528284 12:60766239-60766261 GTTGATCACATCGGCTCCTGAGG + Intergenic
1097578059 12:61419753-61419775 GTTGATCACATCGGCTCCTGAGG + Intergenic
1098181154 12:67848585-67848607 GTTGATCACATCGGCTCCTGAGG + Intergenic
1099901193 12:88713636-88713658 GTTGATCACATCGGCTCCTGAGG + Intergenic
1099999001 12:89811360-89811382 GTTGATCACATCGGCTCCTGAGG + Intergenic
1100097595 12:91061315-91061337 GATGGTTGGATGGACTCCTTAGG + Intergenic
1100671758 12:96821150-96821172 GATGGAGAGATGGGCTCTTTGGG + Intronic
1100720604 12:97354190-97354212 GTTGATCACATCGGCTCCTGAGG + Intergenic
1101552716 12:105777290-105777312 GTTGATCACATCGGCTCCTGAGG - Intergenic
1102309442 12:111833944-111833966 GTTGATCACATCGGCTCCTGAGG + Intergenic
1102401189 12:112630978-112631000 GAGGATCAGATGGGCAGGTTGGG + Intronic
1102749223 12:115277617-115277639 GCTTATCACATGGGTTCCTTTGG - Intergenic
1104227257 12:126847689-126847711 ATAGATCACATGGGCTCCTTAGG + Intergenic
1107154859 13:37154739-37154761 GTTGATCACATCGGCTCCTGAGG + Intergenic
1110180525 13:72611477-72611499 GTTGATCACATCGGCTCCTGAGG - Intergenic
1110275957 13:73641741-73641763 GTTGATCACATCGGCTCCTGAGG - Intergenic
1110991375 13:82046574-82046596 GTTGATCACATCGGCTCCTGAGG - Intergenic
1112980937 13:105383550-105383572 GTTGATCACATCGGCTCCTGAGG - Intergenic
1113122020 13:106934118-106934140 GTTGATCACATCGGCTCCTGAGG + Intergenic
1113668998 13:112163078-112163100 GATGATCAGCTGGGCAAGTTAGG - Intergenic
1114034385 14:18608786-18608808 GTTGATCACATCGGCTCCTGAGG + Intergenic
1114124258 14:19706223-19706245 GTTGATCACATCGGCTCCTGAGG - Intergenic
1114167491 14:20235060-20235082 GTTGATCACATCGGCTCCTGAGG + Intergenic
1114828337 14:26107623-26107645 GTTGATCACATCGGCTCCTGAGG - Intergenic
1115165018 14:30438556-30438578 GGTTAACAGTTGGGCTCCTTGGG - Intergenic
1115278856 14:31638866-31638888 GTTGATCGGATCGGCTCCTGAGG + Intronic
1116038476 14:39657227-39657249 GTTGATCGCATCGGCTCCTTAGG - Intergenic
1116306491 14:43263286-43263308 GTTGATCACATCGGCTCCTGAGG - Intergenic
1116495010 14:45550512-45550534 GTTGATCACATCGGCTCCTGAGG + Intergenic
1116667438 14:47795850-47795872 GTTGATCACATCGGCTCCTCAGG - Intergenic
1119177881 14:72582691-72582713 GATGAACAGATGTTGTCCTTTGG - Intergenic
1120069802 14:80089876-80089898 GTTGATCACATCGGCTCCTGAGG - Intergenic
1120105192 14:80486229-80486251 GTTGATCACATCGGCTCCTGAGG - Intronic
1120158048 14:81115390-81115412 GTTGATCACATCGGCTCCTGAGG - Intronic
1120271666 14:82321128-82321150 GATGAGGAGTTGGGATCCTTTGG + Intergenic
1120971427 14:90211561-90211583 GTTGATCACATTGGCTCCTGAGG + Intergenic
1121980027 14:98446656-98446678 GATTGTCAGGTGGGCTCCTCAGG - Intergenic
1123790573 15:23715293-23715315 GTTGATCACATCGGCTCCTGAGG - Intergenic
1124044379 15:26135077-26135099 GAATATCTGATTGGCTCCTTTGG - Intergenic
1127041554 15:54982548-54982570 CATGATTAGATGGGCACCGTGGG - Intergenic
1128046650 15:64623955-64623977 GATGATTAGCTGTGCTCCTCTGG - Intronic
1128942164 15:71797807-71797829 GTTGATCACATCGGCTCCTGAGG + Intronic
1133447808 16:5877202-5877224 GATTAGCAGATGGACTTCTTTGG + Intergenic
1136647469 16:31634649-31634671 GTTGATCACATTGGCTCCTGAGG + Intergenic
1136917258 16:34217628-34217650 GTTGATCACATCGGCTCCTGAGG + Intergenic
1138746076 16:59364555-59364577 GTTGATCATATCGGCTCCTGAGG - Intergenic
1141723863 16:85773117-85773139 GAAAATCAGATGGCCTCCTGTGG + Intronic
1144091929 17:11865801-11865823 GTTGATCACATTGGCTCCTGAGG + Intronic
1145718271 17:27044444-27044466 GTTGATCACATCGGCTCCTGAGG + Intergenic
1149372011 17:56003742-56003764 GCTGATCACATCGGCTCCTGAGG - Intergenic
1150879122 17:69003899-69003921 GTTGATCACGTGGGCTCCTGAGG + Intronic
1151083610 17:71356729-71356751 GTTGATCACATCGGCTCCTGAGG + Intergenic
1153384475 18:4476930-4476952 GTTGATCACATCGGCTCCTGAGG + Intergenic
1154277205 18:12972513-12972535 GGTGATCAGATGGGCTTCGCAGG + Intronic
1155578945 18:27280771-27280793 GTTGATCACATCGGCTCCTGAGG - Intergenic
1156601185 18:38609061-38609083 GATGTGCAGATGGGCTCCCTGGG + Intergenic
1156718874 18:40045753-40045775 TATGAACAGATGGGCTTCTAAGG - Intergenic
1156843182 18:41632964-41632986 GTTGATCACATCGGCTCCTGAGG - Intergenic
1157039637 18:44023584-44023606 GTTGATCACATCGGCTCCTGAGG + Intergenic
1160485593 18:79289396-79289418 GTTGATCACATCGGCTCCTGAGG + Intronic
1160558900 18:79744046-79744068 GCAGATCTGATGGCCTCCTTTGG + Intronic
1164341930 19:24410700-24410722 GTTGATCACATCGGCTCCTGAGG + Intergenic
1166292199 19:41870379-41870401 GAGCATCACATGGGCTGCTTGGG + Intronic
1166429868 19:42715514-42715536 GTTGATCACATCGGCTCCTGAGG - Intronic
928765158 2:34636672-34636694 GTTGATCACATCGGCTCCTGAGG - Intergenic
928945435 2:36767808-36767830 GATGATCAGATGGGCTCCTTAGG - Intronic
929087655 2:38184176-38184198 GATGAGCATAGGGGCACCTTTGG + Intergenic
929566643 2:42990697-42990719 GTTGATCACATCGGCTCCTGAGG - Intergenic
931052149 2:58427656-58427678 GCTGAACAGTTGGGCTCCTCTGG + Intergenic
932576428 2:72964804-72964826 CCTTATCAGAGGGGCTCCTTTGG + Intronic
932669321 2:73722756-73722778 GTTGATCAAATCGGCTCCTGAGG - Intergenic
932687970 2:73889426-73889448 GATGAGCAGAGAGGCTCGTTTGG + Intergenic
932986061 2:76727656-76727678 GTTGATCGCATGGGCTCCTGAGG + Intergenic
933590413 2:84226092-84226114 GTTGATCACATCGGCTCCTGAGG - Intergenic
935421929 2:102878808-102878830 GTTGATCACATCGGCTCCTGAGG + Intergenic
936036403 2:109116412-109116434 GTTGATCACATCGGCTCCTGAGG + Intergenic
936273238 2:111068457-111068479 GATTCACTGATGGGCTCCTTTGG - Intronic
936700462 2:115005577-115005599 GTTGATCACATCGGCTCCTGAGG - Intronic
937739487 2:125333470-125333492 AATGACCAAATGGGCTCCTGGGG + Intergenic
938148819 2:128863771-128863793 GTTGATCACATCGGCTCCTGAGG + Intergenic
939051560 2:137314288-137314310 GTTGATCACATCGGCTCCTGAGG + Intronic
940814161 2:158279486-158279508 GTTGATCACATCGGCTCCTGAGG - Intronic
940836126 2:158523842-158523864 GTTGATCACATCGGCTCCTGAGG - Intronic
941061750 2:160855505-160855527 GTTGATCACATCGGCTCCTGAGG + Intergenic
941761608 2:169249849-169249871 GTTGATCACATCGGCTCCTGAGG - Intronic
942992076 2:182213628-182213650 GTTGATCACATCGGCTCCTGAGG - Intronic
943921169 2:193709688-193709710 GTTGATCACATCGGCTCCTGAGG + Intergenic
943932317 2:193869153-193869175 GGTGATGTCATGGGCTCCTTGGG - Intergenic
945429747 2:209750963-209750985 GTTGATCACATCGGCTCCTGTGG + Intergenic
945550943 2:211220544-211220566 GTTGATCACATCGGCTCCTGAGG - Intergenic
945733696 2:213572019-213572041 GTTGATCACATCGGCTCCTGAGG + Intronic
947636751 2:231684221-231684243 GAAGACCAGCTGGGCTCCCTGGG + Intergenic
1170326869 20:15165499-15165521 GATGAACAAATAGGATCCTTGGG + Intronic
1171791218 20:29527120-29527142 GATGATCACATCAGCTCCTGAGG - Intergenic
1171955782 20:31462381-31462403 GCTGATCAGGTGGACACCTTTGG - Intergenic
1172645361 20:36465749-36465771 GAAGCTCAGATGGGCTCTTGCGG + Intronic
1173389478 20:42619722-42619744 GTTGATCACATCGGCTCCTGAGG + Intronic
1173774460 20:45692612-45692634 GTTGATCACATTGGCTCCTGAGG + Intronic
1174513961 20:51076897-51076919 CGTGACCAGATGGGCTCATTTGG + Intergenic
1174889000 20:54369358-54369380 CTTGATCAGGTGGGCTCTTTCGG + Intergenic
1178682582 21:34685305-34685327 GATATTCTGATGGGGTCCTTAGG + Intronic
1179961416 21:44768970-44768992 GATGATCTGGTGTGCTCCCTGGG + Exonic
1180458506 22:15535833-15535855 GTTGATCACATCGGCTCCTGAGG + Intergenic
1182410269 22:30179568-30179590 TATGAGCAGATTAGCTCCTTAGG - Intergenic
949201817 3:1388773-1388795 GTTGATCACATCGGCTCCTGAGG - Intronic
949666237 3:6342164-6342186 GTTGATCACATCGGCTCCTGAGG - Intergenic
949701902 3:6768919-6768941 GTTGATCACATTGGCTCCTGAGG + Intergenic
951125337 3:18977282-18977304 GTTGATCACATCGGCTCCTGAGG - Intergenic
951423688 3:22517627-22517649 GCTGATTAGATTGTCTCCTTTGG - Intergenic
951497904 3:23350596-23350618 GTTGATCACATCGGCTCCTGAGG - Intronic
951592428 3:24280797-24280819 GTTGATCGCATGGGCTCCTGAGG - Intronic
952602788 3:35105136-35105158 GTTGATCACATCGGCTCCTGAGG - Intergenic
953214651 3:40907190-40907212 GTTGATCACATCGGCTCCTGAGG + Intergenic
954986995 3:54803420-54803442 GTTGATCACATCGGCTCCTGAGG - Intronic
955022846 3:55137553-55137575 GTTGATCACATGGGCTCCTGAGG - Intergenic
955360351 3:58268867-58268889 GGTGATCAGATGTGGTTCTTGGG + Intronic
955427580 3:58807924-58807946 GTTGATCACATGGGCTCCTGAGG - Intronic
955430883 3:58843373-58843395 GTTGATCACATGGGCTCCTGAGG - Intronic
955438709 3:58932133-58932155 GTTGATCGCATGGGCTCCTGAGG - Intronic
955606621 3:60711635-60711657 GTTGATCACATTGGCTCCTGAGG - Intronic
955870057 3:63428595-63428617 GCTGATCAGCTGGGCTTTTTGGG + Intronic
956242839 3:67148995-67149017 GTTGATCACATCGGCTCCTGAGG - Intergenic
957250715 3:77768464-77768486 GTTGATCACATTGGCTCCTGAGG + Intergenic
958172856 3:89959051-89959073 GTTGATCACATCGGCTCCTGAGG - Intergenic
958828733 3:99063448-99063470 GTTGATCACATCGGCTCCTGAGG + Intergenic
959353520 3:105297443-105297465 GTTGATCACATCGGCTCCTGAGG - Intergenic
959891418 3:111560990-111561012 GTTGATCACATTGGCTCCTGAGG + Intronic
960919772 3:122734233-122734255 GTTGATCACATTGGCTCCTGAGG - Intergenic
961289700 3:125836094-125836116 GAAGATCAGATGGGCCAGTTTGG - Intergenic
962664290 3:137638490-137638512 GTTGATCACATCGGCTCCTGAGG + Intergenic
963954942 3:151242976-151242998 GTTGATCGCATGGGCTCCTGAGG - Intronic
964602339 3:158515880-158515902 GTTGATCACATCGGCTCCTGAGG + Intronic
964799325 3:160537244-160537266 GGTGAGCAGGAGGGCTCCTTTGG - Intronic
965100600 3:164292758-164292780 GTTGATCACATTGGCTCCTGAGG - Intergenic
965322743 3:167268342-167268364 GATGATCAGTAGGGCTGCTATGG + Intronic
965522379 3:169680710-169680732 GTTGATCACATCGGCTCCTGAGG - Intergenic
969760841 4:9180549-9180571 GATGACCACATGGGCTACCTTGG + Intergenic
969980339 4:11148406-11148428 GTTGATCACATCGGCTCCTGAGG + Intergenic
970084964 4:12335769-12335791 GTTGATCACATCGGCTCCTGAGG - Intergenic
970259720 4:14211872-14211894 GTTGATCACATCGGCTCCTGAGG + Intergenic
970531315 4:16988386-16988408 GATATTCACATGGGCTCCTTTGG - Intergenic
970611630 4:17730125-17730147 GTTGATCACATTGGCTCCTGGGG - Intronic
970611711 4:17730947-17730969 GTTGATCACATTGGCTCCTGGGG - Intronic
970901108 4:21160613-21160635 GTTGATCACATCGGCTCCTGAGG - Intronic
971389018 4:26168852-26168874 GTTGATCACATCGGCTCCTGAGG + Intronic
971618342 4:28823264-28823286 GAGGATCCCATGGGCTTCTTTGG - Intergenic
973183455 4:47295468-47295490 GTTGATCACATCGGCTCCTGAGG - Intronic
974143456 4:57918294-57918316 GTTGATCACATCGGCTCCTGAGG + Intergenic
974673062 4:65056956-65056978 GTTGATCACATCGGCTCCTGAGG + Intergenic
974682146 4:65177810-65177832 GTTGATCACATCGGCTCCTGAGG - Intergenic
974740289 4:65998079-65998101 GTTGATCACATCGGCTCCTGAGG + Intergenic
974956234 4:68645011-68645033 GTTGATCACATCGGCTCCTGAGG + Intronic
975062317 4:70018430-70018452 GTTGATCACATCGGCTCCTGAGG + Intergenic
975283930 4:72595065-72595087 GTTGATCACATCGGCTCCTGAGG - Intergenic
975505084 4:75128030-75128052 GTTGATCACATCGGCTCCTGAGG - Intergenic
975531358 4:75402419-75402441 GTTGATCGCATGGGCTCCTGAGG - Intergenic
976356833 4:84128008-84128030 GTTGATCACATCGGCTCCTGAGG - Intergenic
976794868 4:88920911-88920933 GTTGATCACATCGGCTCCTGAGG - Intronic
977391350 4:96413980-96414002 GTTGATCACATCGGCTCCTGAGG + Intergenic
978859207 4:113429333-113429355 GTTGATCATATCGGCTCCTGAGG + Intergenic
979112712 4:116779819-116779841 GTTGATCACATGGGCTCCTGAGG + Intergenic
979317189 4:119278882-119278904 GTTGATCACATCGGCTCCTGAGG + Intronic
979432372 4:120647241-120647263 GTTGATCACATCGGCTCCTGAGG + Intergenic
980216164 4:129855128-129855150 GTTGATCACATCGGCTCCTGAGG - Intergenic
980343715 4:131584419-131584441 GCTGCTCAGATGGGCTCCGATGG - Intergenic
980507175 4:133738719-133738741 GTTGATCACATTGGCTCCTGAGG + Intergenic
980781534 4:137497490-137497512 GTTGATCACATCGGCTCCTGAGG - Intergenic
981365169 4:143894091-143894113 GTTGATCACATTGGCTCCTGAGG + Intronic
982675161 4:158367327-158367349 GTTGATCACATCGGCTCCTGAGG + Intronic
983173123 4:164558278-164558300 GTTGATCACATCGGCTCCTGAGG + Intergenic
983704463 4:170640605-170640627 GTTGATCACATTGGCTCCTGAGG - Intergenic
984307718 4:178016257-178016279 GTTGATCGCATGGGCTCCTGAGG - Intergenic
986127521 5:4897062-4897084 GATGATCAGTTGAACTCATTAGG + Intergenic
986385784 5:7231943-7231965 GTTGATCACATCGGCTCCTGAGG - Intergenic
987174515 5:15293285-15293307 GTTGATCACATCGGCTCCTGAGG - Intergenic
987507462 5:18792656-18792678 GCTGCTCAGATGGGCTCCAGTGG + Intergenic
989653521 5:43719175-43719197 GTTGATCACATCGGCTCCTGAGG - Intergenic
989849795 5:46194638-46194660 GTTGATCACATCGGCTCCTGAGG - Intergenic
989949583 5:50281438-50281460 GTTGATCATATTGGCTCCTGAGG - Intergenic
990600723 5:57356281-57356303 GTTGATCACATCGGCTCCTGAGG + Intergenic
991175404 5:63681752-63681774 GTTGATCACATCGGCTCCTGAGG + Intergenic
991451116 5:66751504-66751526 GTTGATCACATCGGCTCCTGAGG - Intronic
991659166 5:68932761-68932783 GCTGCTCAGATGGGCTCCAGTGG - Intergenic
992162584 5:74017206-74017228 GGTCATCAGAGGGGCTCCTGTGG + Intergenic
992605974 5:78456966-78456988 GTTGATCGCATGGGCTCCTGAGG + Intronic
993446097 5:88014251-88014273 GTTGATCACATCGGCTCCTGAGG + Intergenic
993612720 5:90074442-90074464 GTTGATCACATAGGCTCCTGAGG - Intergenic
994036845 5:95211456-95211478 GTTGATCACATCGGCTCCTGAGG + Intronic
994274072 5:97814697-97814719 GTTGATCACATCGGCTCCTGAGG + Intergenic
994334459 5:98547896-98547918 GTTGATCACATCGGCTCCTGAGG - Intergenic
994693663 5:103047962-103047984 GTTGATCACATTGGCTCCTGAGG - Intergenic
995413323 5:111882190-111882212 GTTGATCACATCGGCTCCTGAGG - Intronic
996002836 5:118384316-118384338 GATGATCGCATTGGCTCCTGAGG - Intergenic
996418986 5:123241391-123241413 GTTGATCACATTGGCTCCTGAGG + Intergenic
997027191 5:130078779-130078801 GATGCTCAGCTGGGCTCCGAAGG + Intronic
997134533 5:131311724-131311746 GTTGATCACATCGGCTCCTGAGG + Intronic
997437994 5:133888984-133889006 GATGAACAGGTGGGCGTCTTTGG - Intergenic
998247057 5:140516156-140516178 GTTGATCGCATGGGCTCCTGAGG - Intronic
1000377234 5:160593771-160593793 GTTGATCACATCGGCTCCTGAGG - Intronic
1002745462 5:181467263-181467285 GGTGATCAGATGGGTGTCTTTGG + Intergenic
1003296533 6:4834855-4834877 GTTGATCACATCGGCTCCTGAGG + Intronic
1003813565 6:9811972-9811994 GTTGATCACATCGGCTCCTGAGG - Intronic
1005239292 6:23805265-23805287 GTTGATCACATCGGCTCCTGAGG - Intergenic
1006276426 6:33008240-33008262 GCTGACCACATGGGCTCCTACGG - Exonic
1006726354 6:36201776-36201798 CATGCCCAGAAGGGCTCCTTAGG + Intronic
1008262865 6:49388103-49388125 GTTGATCGCATGGGCTCCTGAGG - Intergenic
1009175947 6:60460132-60460154 GTTGATCACATCGGCTCCTGAGG + Intergenic
1009303788 6:62061955-62061977 GTTGATCACATCGGCTCCTGAGG + Intronic
1009662507 6:66632180-66632202 GTTGATCACATCGGCTCCTGAGG - Intergenic
1010078652 6:71831491-71831513 GTTGATCGCATGGGCTCCTGAGG + Intergenic
1010856697 6:80848964-80848986 GTTGATCACATTGGCTCCTGAGG - Intergenic
1011180058 6:84609660-84609682 GTTGATCACATCGGCTCCTGAGG - Intergenic
1011181621 6:84627569-84627591 GTTGATCACATCGGCTCCTGAGG - Intergenic
1011315432 6:86026270-86026292 GTTGATCACATTGGCTCCTGAGG + Intergenic
1012492505 6:99798014-99798036 GATTATCAGAGGGTCTCCCTGGG - Intergenic
1012561356 6:100585361-100585383 GTTGATCACATCGGCTCCTGAGG + Intronic
1012605855 6:101157031-101157053 GTTGATCACATCGGCTCCTGAGG + Intergenic
1013197598 6:107859501-107859523 GTTGATCACATCGGCTCCTGAGG + Intergenic
1013762301 6:113532341-113532363 GTTGATCACATCGGCTCCTGAGG - Intergenic
1013889523 6:115009674-115009696 GTTGATCACATTGGCTCCTGAGG - Intergenic
1014025428 6:116640048-116640070 GCTGATCACATTGGCTCCTGAGG - Intronic
1014071173 6:117183040-117183062 GTTGATCACATCGGCTCCTGAGG - Intergenic
1014185358 6:118428156-118428178 GTTGATCACATCGGCTCCTGAGG - Intergenic
1014364608 6:120523677-120523699 GTTGATCACATCGGCTCCTGAGG - Intergenic
1015432386 6:133146854-133146876 GTTGATCACATTGGCTCCTGAGG + Intergenic
1016296501 6:142578348-142578370 GTTGATCACATCGGCTCCTGAGG - Intergenic
1016365024 6:143306982-143307004 GTTGATCACATCGGCTCCTGAGG + Intronic
1016766463 6:147799850-147799872 GTTGATCACATCGGCTCCTGAGG + Intergenic
1017905859 6:158757170-158757192 GATGGTCAGCTGGGCTCCCGGGG - Intronic
1019912933 7:4112307-4112329 GCAGATCTGATGGCCTCCTTTGG - Intronic
1020374215 7:7466315-7466337 GTTGATCACATCGGCTCCTGAGG - Intronic
1021373752 7:19882423-19882445 GTTGATCACATCGGCTCCTGAGG + Intergenic
1021671271 7:23036951-23036973 GTTGATCACATCGGCTCCTGAGG - Intergenic
1021701373 7:23322281-23322303 GTTGATCACATCGGCTCCTGAGG - Intronic
1021765916 7:23948519-23948541 GTTGATCACATCGGCTCCTGAGG - Intergenic
1022694053 7:32687472-32687494 GTTGATCACATCGGCTCCTGAGG + Intergenic
1022824270 7:33993399-33993421 GTTGATCACATTGGCTCCTGAGG + Intronic
1022842060 7:34174347-34174369 GTTGATCACATCGGCTCCTGAGG + Intergenic
1022845362 7:34205019-34205041 GTTGATCACATCGGCTCCTGAGG + Intergenic
1022874536 7:34514679-34514701 GTTGATCACATCGGCTCCTGAGG - Intergenic
1022929350 7:35094179-35094201 GTTGATCACATCGGCTCCTGAGG - Intergenic
1023683903 7:42715863-42715885 GTTGATCAGATAGGCACCATAGG - Intergenic
1023725311 7:43137182-43137204 GATGAGCAGGAGTGCTCCTTCGG - Intronic
1024552524 7:50575615-50575637 GTTGATCAAATTGGCTACTTAGG + Intergenic
1024877790 7:54046093-54046115 GTTGATCACATCGGCTCCTGAGG + Intergenic
1025153937 7:56586015-56586037 GTTGATCACATCGGCTCCTGAGG - Intergenic
1025591016 7:62860132-62860154 GTTGATCACATCGGCTCCTGAGG - Intergenic
1027269502 7:76512078-76512100 GAGGAGCAGGTGGGCACCTTGGG + Intronic
1027680709 7:81217495-81217517 GATGAGCAGGAGGGTTCCTTAGG + Intergenic
1027989104 7:85334502-85334524 GTTGATCACATCGGCTCCTGAGG + Intergenic
1028062646 7:86341430-86341452 GTTGATCACATCGGCTCCTGAGG - Intergenic
1028489360 7:91394264-91394286 GTTGATCACATCGGCTCCTGAGG + Intergenic
1028499943 7:91508064-91508086 GTTGATCACATCGGCTCCTGAGG - Intergenic
1028995597 7:97096452-97096474 TTTGATCTGATGGGCTCATTAGG + Intergenic
1029916119 7:104211082-104211104 GTTGATCACATTGGCTCCTGAGG - Intergenic
1030312412 7:108081932-108081954 GAAAATCAGAGGGCCTCCTTGGG + Intronic
1030753588 7:113262485-113262507 GTTGATCACATCGGCTCCTGAGG + Intergenic
1031585326 7:123527096-123527118 GTTGATCACATCGGCTCCTGAGG + Intronic
1031617261 7:123895848-123895870 GTTGATCACATCGGCTCCTGAGG - Intergenic
1031706246 7:124984243-124984265 GTTGATCACATTGGCTCCTGAGG + Intergenic
1032659619 7:133969385-133969407 GATGATGAGTTGTGATCCTTTGG + Intronic
1035639372 8:1172665-1172687 GTTGATCACATCGGCTCCTGGGG + Intergenic
1036270954 8:7302400-7302422 GATGATCACATGGGCTACCTTGG + Intergenic
1036350395 8:8007944-8007966 GATGATCACATGGGCTACCTTGG - Intergenic
1037688811 8:21165854-21165876 GTTCATCAGATGGGTTCTTTTGG + Intergenic
1037800036 8:22027978-22028000 GATGATGAGATGTGGTCCATTGG - Intronic
1039268795 8:35857818-35857840 GATGAGCTGTTGGGCTCATTTGG + Intergenic
1040092920 8:43417125-43417147 GTTGATCACATCGGCTCCTGAGG + Intergenic
1040398248 8:47019954-47019976 GTTGATCACATCGGCTCCTGAGG - Intergenic
1040411575 8:47159461-47159483 GTTGATCACATTGGCTCCTGAGG - Intergenic
1041485503 8:58371381-58371403 GTTGATCACATTGGCTCCTGAGG - Intergenic
1041752155 8:61272775-61272797 GTTGATCACATCGGCTCCTGAGG + Intronic
1043181365 8:77089634-77089656 GTTGATCACATTGGCTCCTGAGG - Intergenic
1043757309 8:84019622-84019644 GATGATCGCATTGGCTCCTGAGG + Intergenic
1043976512 8:86591121-86591143 GTTGATCACATCGGCTCCTGAGG + Intronic
1044156906 8:88859410-88859432 GTTGATCGCATGGGCTCCTGAGG + Intergenic
1044968198 8:97594356-97594378 GTTGATCACATCGGCTCCTGAGG + Intergenic
1045026287 8:98090054-98090076 GATGTTTAGATGTGCTCCATAGG + Intronic
1045278183 8:100725152-100725174 GATGGTCACATGGGCACCTAGGG + Intergenic
1045775126 8:105793858-105793880 GTTGATCACATCGGCTCCTGAGG + Intronic
1046879611 8:119293387-119293409 GTTGATCACATCGGCTCCTGAGG - Intergenic
1046894710 8:119460981-119461003 GTTGATCACATCGGCTCCTGAGG + Intergenic
1047686782 8:127312802-127312824 GTTGATCACATCGGCTCCTGAGG - Intergenic
1048138781 8:131772125-131772147 GCTGATCACATCGGCTCCTGAGG - Intergenic
1049054882 8:140228334-140228356 GATAACCAGATGGGCTTTTTTGG - Intronic
1050048432 9:1573802-1573824 GTTGATCACATCGGCTCCTGAGG + Intergenic
1051458636 9:17289790-17289812 GTTGATCGCATGGGCTCCTGAGG + Intronic
1051928128 9:22353618-22353640 GTTGATCACATCGGCTCCTGAGG + Intergenic
1052110782 9:24579321-24579343 GTTGATCGCATGGGCTCCTGAGG + Intergenic
1052148087 9:25075725-25075747 GTTGATCACATCGGCTCCTGAGG + Intergenic
1053699968 9:40680459-40680481 GTTGATCACATTGGCTCCTGAGG + Intergenic
1054311259 9:63479857-63479879 GTTGATCACATTGGCTCCTGAGG + Intergenic
1056616782 9:88175038-88175060 GATGATCAAATAATCTCCTTTGG + Intergenic
1057638985 9:96798355-96798377 GTTGATCACATCGGCTCCTGAGG - Intergenic
1058215038 9:102222688-102222710 GTTGATCACATCGGCTCCTGAGG + Intergenic
1058254990 9:102750589-102750611 TATGATCAGATGGCCACCTGTGG + Intergenic
1058557567 9:106186405-106186427 GTTGATCACATCGGCTCCTGAGG + Intergenic
1061222544 9:129260540-129260562 GAAGACCAGCTGGGCTGCTTGGG + Intergenic
1062026681 9:134343858-134343880 GGTCAGCAGATGGGCTCCTCTGG + Intronic
1185577019 X:1182541-1182563 GAAGGTCAGCTGGGCTCTTTAGG - Intergenic
1186805478 X:13137103-13137125 GTTGATCACATCGGCTCCTGAGG + Intergenic
1187706277 X:22012654-22012676 GATGGTAAGATGGGGTCCTTAGG + Intergenic
1188109576 X:26181321-26181343 GTTGATCACATCGGCTCCTGAGG + Intergenic
1189909777 X:45798965-45798987 GATTATAAAATGGCCTCCTTTGG - Intergenic
1190557060 X:51645981-51646003 GTTGATCACATCGGCTCCTGAGG - Intergenic
1190593088 X:52025216-52025238 GTTGATCACATCGGCTCCTGAGG + Intergenic
1191020112 X:55850544-55850566 GTTGATCACATTGGCTCCTGAGG + Intergenic
1191751553 X:64548567-64548589 GTTGATCACATCGGCTCCTGAGG + Intergenic
1191808610 X:65162548-65162570 GTTGATCACATCGGCTCCTGAGG + Intergenic
1191814246 X:65225735-65225757 GTTGATCACATCGGCTCCTGAGG - Intergenic
1191827370 X:65379817-65379839 GTTGATCACATCGGCTCCTGAGG - Intronic
1191981399 X:66929630-66929652 GTTGATCACATCGGCTCCTGAGG + Intergenic
1191982760 X:66944015-66944037 GTTGATCACATCGGCTCCTGAGG - Intergenic
1192256339 X:69463320-69463342 GTTGATCACATCGGCTCCTGAGG + Intergenic
1192290323 X:69788073-69788095 GTTGATCACATCGGCTCCTGAGG + Intronic
1192859410 X:75050199-75050221 GGTGAGCAGATGGGCTCATTTGG - Intergenic
1192955938 X:76070027-76070049 GTTGATCACATTGGCTCCTGAGG - Intergenic
1193029656 X:76883548-76883570 GTTGATCACATCGGCTCCTGAGG - Intergenic
1193045347 X:77047452-77047474 GTTGATCACATCGGCTCCTGAGG - Intergenic
1193182156 X:78471009-78471031 GTTGATCACATCGGCTCCTGAGG + Intergenic
1193304110 X:79928022-79928044 GTTGATCACATCGGCTCCTGAGG - Intergenic
1193346148 X:80406460-80406482 GTTGATCACATCGGCTCCTGAGG - Intronic
1194068772 X:89293849-89293871 GTTGATCACATCGGCTCCTGAGG - Intergenic
1194255466 X:91628450-91628472 GTTGATCACATCGGCTCCTGAGG - Intergenic
1195327611 X:103770660-103770682 GAGGATCACATGGGATCCGTAGG + Intergenic
1195975338 X:110520710-110520732 AATGATCAGATGTACTCTTTTGG - Intergenic
1196077429 X:111593482-111593504 GTTGATCACATCGGCTCCTGAGG + Intergenic
1196162707 X:112503258-112503280 GTTGATCACATCGGCTCCTGAGG - Intergenic
1196183419 X:112719833-112719855 GTTGATCACATCGGCTCCTGAGG - Intergenic
1196249757 X:113446662-113446684 GTTGATCACATCGGCTCCTGAGG - Intergenic
1197860041 X:130960151-130960173 GTTGATCACATCGGCTCCTGAGG - Intergenic
1198023872 X:132685691-132685713 GATGATCAGACTGGGTCCTATGG - Intronic
1200038073 X:153346088-153346110 GAGGATCAGCTGGGCTCTCTGGG + Intronic
1200574200 Y:4867712-4867734 GTTGATCACATAGGCTCCTGAGG - Intergenic
1201244818 Y:11993236-11993258 GTTGATCACATCGGCTCCTGAGG + Intergenic
1201410316 Y:13692556-13692578 GTTGATCACATCGGCTCCTGAGG - Intergenic
1201431859 Y:13910614-13910636 GTTGATCACATTGGCTCCTGAGG - Intergenic
1201435428 Y:13953171-13953193 GTTGATCAAATTGGCTCCTGAGG - Intergenic
1201449774 Y:14099062-14099084 GTTGATCACATTGGCTCCTGAGG + Intergenic
1201450226 Y:14103488-14103510 GTTGATCACATCGGCTCCTGAGG - Intergenic
1201606433 Y:15790985-15791007 GTTGATCACATTGGCTCCTGAGG + Intergenic
1201710508 Y:16986264-16986286 GTTGATCACATCGGCTCCTGAGG - Intergenic
1201779957 Y:17709708-17709730 GTTGATCACATTGGCTCCTGAGG - Intergenic
1201821598 Y:18196284-18196306 GTTGATCACATTGGCTCCTGAGG + Intergenic
1201886928 Y:18895119-18895141 GTTGATCACATCGGCTCCTGAGG - Intergenic
1201991544 Y:20032298-20032320 GTTGATCACATTGGCTCCTGAGG - Intergenic
1202064530 Y:20924625-20924647 GTTGATCACATTGGCTCCTGAGG + Intergenic
1202577292 Y:26340958-26340980 GTTGATCACATCGGCTCCTGAGG - Intergenic