ID: 928948070

View in Genome Browser
Species Human (GRCh38)
Location 2:36789934-36789956
Sequence CAGTGGTAACAGAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 371}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928948070_928948084 28 Left 928948070 2:36789934-36789956 CCTTCTCCCCTCTGTTACCACTG 0: 1
1: 0
2: 2
3: 46
4: 371
Right 928948084 2:36789985-36790007 TTCCTTCCTTGGGTTTCCTTAGG 0: 1
1: 0
2: 3
3: 72
4: 509
928948070_928948081 17 Left 928948070 2:36789934-36789956 CCTTCTCCCCTCTGTTACCACTG 0: 1
1: 0
2: 2
3: 46
4: 371
Right 928948081 2:36789974-36789996 TTCCTGGAAGATTCCTTCCTTGG 0: 1
1: 0
2: 5
3: 23
4: 265
928948070_928948078 1 Left 928948070 2:36789934-36789956 CCTTCTCCCCTCTGTTACCACTG 0: 1
1: 0
2: 2
3: 46
4: 371
Right 928948078 2:36789958-36789980 CCCTGGTCCACACAGCTTCCTGG 0: 1
1: 0
2: 3
3: 17
4: 270
928948070_928948082 18 Left 928948070 2:36789934-36789956 CCTTCTCCCCTCTGTTACCACTG 0: 1
1: 0
2: 2
3: 46
4: 371
Right 928948082 2:36789975-36789997 TCCTGGAAGATTCCTTCCTTGGG 0: 1
1: 0
2: 5
3: 23
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928948070 Original CRISPR CAGTGGTAACAGAGGGGAGA AGG (reversed) Intronic
900324885 1:2103859-2103881 CAGTGGGAGGAGAGGGGTGAAGG + Intronic
900486474 1:2925065-2925087 CAGCGGAAACAGAGGTCAGAGGG + Intergenic
901497294 1:9629386-9629408 TGGTGGTAAGAAAGGGGAGAGGG - Intergenic
902050745 1:13562041-13562063 CAGTGGGAACAGAGACTAGAGGG - Intergenic
902678456 1:18025920-18025942 CAGTGGTCACAGTGGGGTGAGGG - Intergenic
902875938 1:19340856-19340878 CAGTGGAAAGAGTGGGTAGAGGG + Intronic
902972416 1:20063402-20063424 CAGTGGAAACTGTGGGGAGAGGG + Intronic
904457411 1:30655973-30655995 CAGGGGTGACAGAGGAGAGAGGG - Intergenic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908321952 1:62987093-62987115 CAGCAGGAACAGAGGGGAAAAGG - Intergenic
908432373 1:64071687-64071709 GAGTGGCAACTGCGGGGAGAAGG + Intronic
908714472 1:67054526-67054548 CACCTGTAACAGAGGGGAGGAGG - Intergenic
908792658 1:67798361-67798383 CAGTGGTCACAGAGGGGTTGGGG - Intronic
909599078 1:77442133-77442155 TAGTGGTAACAGATGGGGAAAGG + Intronic
910625658 1:89303597-89303619 CAGTGCTAGCAGGTGGGAGATGG + Intergenic
913255639 1:116950695-116950717 CAGTGGAGACAGAGGGGGCAGGG + Intronic
914675875 1:149906884-149906906 CAGTCATAGCAGATGGGAGAGGG + Intronic
915017301 1:152745966-152745988 GTGTGGTAACAGCGGGCAGAAGG - Intronic
915442690 1:155955420-155955442 CAGTGCTAAGAAATGGGAGAAGG - Intronic
915517942 1:156424020-156424042 AATTGGTAACAGAGGAGAAAGGG - Intronic
917193078 1:172439431-172439453 AAGTGGTAGCTGTGGGGAGAAGG - Intronic
917500364 1:175579742-175579764 CCTTGGAAATAGAGGGGAGAGGG + Intronic
917746301 1:178011247-178011269 CAGTGGGAAATGAGGGGAAAGGG + Intergenic
918125384 1:181579257-181579279 CCCAGTTAACAGAGGGGAGAAGG - Intronic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
920742540 1:208595297-208595319 CAGTGGTAATAGGGAGGAGGAGG + Intergenic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
923140727 1:231160362-231160384 CAGTAGCCACAGATGGGAGATGG - Intergenic
923718349 1:236446184-236446206 TCTGGGTAACAGAGGGGAGAAGG - Intronic
924067159 1:240235823-240235845 CAGAGGAAGAAGAGGGGAGATGG - Intronic
1065205610 10:23355183-23355205 CTGTGGCCACAGAGGAGAGAAGG - Intergenic
1065664973 10:28049430-28049452 CAGTGGAAACAGCGTGGAGCTGG + Intergenic
1067525597 10:47036510-47036532 AAGTGATAACAGATGGGAAAAGG - Intergenic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1070271016 10:74955024-74955046 CAGTGGTGGTAGAGGGGTGAGGG - Intronic
1071888131 10:89972722-89972744 CAATGGGAGCAGAGAGGAGAAGG + Intergenic
1071948552 10:90676498-90676520 TAATGGAAACAGAAGGGAGAAGG - Intergenic
1072249245 10:93568516-93568538 AAGTGGTCAGAGAGGGGAGTAGG + Intronic
1072867985 10:99084824-99084846 CAGTGGTAACAGGGGCAAGTTGG - Intronic
1074290410 10:112133848-112133870 CAGTGGTGGGAGAGTGGAGAGGG - Intergenic
1074525473 10:114259828-114259850 CAGTGGACACATTGGGGAGACGG - Intronic
1074740214 10:116479236-116479258 CAGTGGTACCACAGAGAAGACGG + Intergenic
1075173615 10:120139104-120139126 GAGTAGAAACAGAAGGGAGAGGG - Intergenic
1075268457 10:121026519-121026541 CAGAGGTCACAGATGTGAGAAGG - Intergenic
1075576118 10:123578774-123578796 CAGGAGTAACAGAGGACAGATGG + Intergenic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075725140 10:124607134-124607156 CAGTGGGTACAGAGCGGAGAGGG - Intronic
1076324240 10:129609028-129609050 CAGCAGTAAGAGAGGAGAGAAGG - Intronic
1077048986 11:558311-558333 CAGTGGCGAAGGAGGGGAGAAGG + Intronic
1077675601 11:4191137-4191159 AAGTGCCCACAGAGGGGAGAGGG - Intergenic
1078028432 11:7722456-7722478 CAGTGGTTCAAGATGGGAGAGGG + Intergenic
1078113016 11:8415072-8415094 AAGTTGTAAGAGAGGAGAGATGG - Intronic
1078126806 11:8573894-8573916 CAGGGGTTACAGATAGGAGAGGG + Intronic
1078454310 11:11463142-11463164 CAGTGATAACTGAGGGAAGCAGG - Intronic
1078464463 11:11539985-11540007 CAATGGGAAATGAGGGGAGACGG + Intronic
1079685976 11:23360462-23360484 CTGTGGGAACAGAGTGTAGAGGG - Intergenic
1080193841 11:29583887-29583909 CACTAGCAACACAGGGGAGATGG + Intergenic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1080855660 11:36109372-36109394 CAGTGGGAACATATGGGGGATGG + Intronic
1081594903 11:44452302-44452324 TAGTAGTAACAGTGCGGAGAAGG - Intergenic
1081710417 11:45212420-45212442 AAGTGGTTACAAAAGGGAGAAGG - Intronic
1081779004 11:45696919-45696941 AAGTGGTGTCAGAGGGGAGGAGG - Intergenic
1083687527 11:64385478-64385500 CACTGGACACAGAGGGGAGGTGG + Intergenic
1083887727 11:65581031-65581053 GAATGGTAGGAGAGGGGAGAAGG - Intronic
1083966418 11:66046589-66046611 CAGGAGTAAGAGAGGGGAGGAGG + Intronic
1084285362 11:68127832-68127854 CAGGGCTGACTGAGGGGAGAGGG - Intergenic
1086458407 11:86982027-86982049 TAGTGGTAACAGAGGCCACACGG - Intergenic
1086849024 11:91786569-91786591 CAGTGGTAATGCAGGGCAGATGG - Intergenic
1086964422 11:93012881-93012903 CAGCTGTAACAGATGGGAGGAGG - Intergenic
1087313934 11:96584191-96584213 CAGTGATAACTGAGGTAAGATGG - Intergenic
1087645154 11:100800331-100800353 CACTGGGAACAGAGGGGAGTTGG + Intronic
1087943471 11:104129490-104129512 CATTTGTAACACAGAGGAGAAGG + Intronic
1087978141 11:104575909-104575931 CTGTGTTCTCAGAGGGGAGAAGG - Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088846841 11:113675371-113675393 CAGTGGCATCAGAGGGGTCAGGG + Intergenic
1088899204 11:114102473-114102495 CAGTGGTAACAGTGGTTAGAGGG + Intronic
1089093227 11:115896351-115896373 CATTGGGAAGAGAGAGGAGAGGG - Intergenic
1090414478 11:126531197-126531219 CAGTGGGAATAGAGAGGAAAGGG - Intronic
1090764486 11:129864913-129864935 CAGTGGAATCAGAGAGGAGCCGG + Intronic
1090963170 11:131574840-131574862 CAGAGGTAACAGTGGGGAGTGGG - Intronic
1091364309 11:135004983-135005005 TAGTGACAGCAGAGGGGAGAAGG - Intergenic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1092883954 12:12909644-12909666 CAGTGATCACAGAGCAGAGAAGG + Intronic
1093322715 12:17734017-17734039 CAGTGGTAGCAGAGAAGAGGAGG - Intergenic
1093669520 12:21856967-21856989 CAGTGCTGAGAGAGGGTAGATGG - Intronic
1094037869 12:26090048-26090070 AAGAGGTAACAGATGGAAGAAGG + Intergenic
1094199592 12:27781921-27781943 GAGTGGGATGAGAGGGGAGAAGG + Intronic
1094250092 12:28349826-28349848 CAGTTGTAACAGAGGAATGAGGG - Intronic
1095785319 12:46102634-46102656 CAGAGCTAACAGTGGGGAAATGG - Intergenic
1097228181 12:57491520-57491542 CAGTGACAACAGAGAGGAGAAGG - Intronic
1098841190 12:75479997-75480019 CAGTGGTAAGAGCTGTGAGATGG - Intergenic
1098856725 12:75661165-75661187 AAGTGATAGAAGAGGGGAGAAGG - Intergenic
1100193491 12:92218185-92218207 AAGTGAGAACAGAGTGGAGAAGG + Intergenic
1100281194 12:93119977-93119999 CAGAGAGAACTGAGGGGAGATGG - Intergenic
1100553151 12:95666269-95666291 CAGGGGGAAGAGAGGGGATAAGG + Intronic
1100718573 12:97330949-97330971 CGGGGATAACAGAGAGGAGAGGG + Intergenic
1102149224 12:110677295-110677317 GAGTGGGGACAGAGGTGAGAGGG - Intronic
1102547569 12:113667661-113667683 CAGAGAGAAAAGAGGGGAGATGG - Intergenic
1102824219 12:115933695-115933717 GAGTGCAAACAGAGAGGAGAGGG - Intergenic
1102993339 12:117330397-117330419 CAGTGGGAGCAGAGGGGTCAAGG - Exonic
1103023566 12:117555852-117555874 TAGAAGTAACAGAAGGGAGAGGG - Intronic
1103612664 12:122133589-122133611 TAATGGTAACACGGGGGAGATGG - Exonic
1103873853 12:124112042-124112064 CAGTTTAGACAGAGGGGAGAAGG - Intronic
1104575713 12:129964185-129964207 CAGTGGAAAAGGTGGGGAGAAGG + Intergenic
1105353828 13:19639691-19639713 CAGGGGTAAGAGAGGAGGGAAGG + Intronic
1106405437 13:29469216-29469238 GAGTGGTCACAGGAGGGAGAAGG - Intronic
1107694045 13:42982760-42982782 CAGGGGAAAAAGATGGGAGAAGG - Intronic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1108607459 13:52053842-52053864 CAGCGCTAGCAGTGGGGAGATGG - Intronic
1109038966 13:57306038-57306060 AAGGGGAAACAGAGGGGAGTAGG - Intergenic
1109283140 13:60380114-60380136 CACTGGATACAGAGGTGAGAAGG - Intergenic
1110327128 13:74229830-74229852 CATTGGTAACACTGGGGAGACGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111838298 13:93416730-93416752 CAGTGGACACAGAGAGTAGAAGG - Intronic
1112322171 13:98417612-98417634 CAGGGGTAAGAGATGTGAGAAGG + Intronic
1113223325 13:108130216-108130238 CAGCGCTAACAGAATGGAGAAGG - Intergenic
1113312340 13:109142998-109143020 TACTGGTAACACAGGGTAGATGG + Intronic
1113755592 13:112808706-112808728 CAGCGGAGACAGCGGGGAGATGG - Intronic
1113940773 13:114017623-114017645 CAGAGGCCGCAGAGGGGAGAGGG - Intronic
1114815204 14:25949290-25949312 CAGTGGTAATAGAGAGATGAAGG - Intergenic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1116809105 14:49522313-49522335 CAGTGGAAATAGAGGGGTGAAGG + Intergenic
1117162921 14:53006807-53006829 CACTCGCAAAAGAGGGGAGAAGG + Intergenic
1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG + Intronic
1117620740 14:57583710-57583732 CAACAGTAACAAAGGGGAGAAGG - Intronic
1117662311 14:58020364-58020386 CCGAGGGAACAGAGAGGAGAAGG - Intronic
1117841242 14:59862647-59862669 CAGTGGGAACAGATGGGAAATGG - Intronic
1118010348 14:61604489-61604511 CTGTGGCAGCAGAGGAGAGATGG + Intronic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1118436281 14:65773615-65773637 AAGAGGTGACAGAGGGTAGATGG - Intergenic
1119483865 14:74975889-74975911 AAGGGGGCACAGAGGGGAGATGG - Intergenic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1119787269 14:77322876-77322898 TAGGGGTGGCAGAGGGGAGAGGG + Intronic
1119892687 14:78194727-78194749 CAGTAGTTGCAGAGGAGAGAAGG + Intergenic
1121021263 14:90581513-90581535 CAGTGGCAACACAGGGGAGCAGG + Intronic
1121089339 14:91170385-91170407 CAGTGGTCCCAGAGGTGAGTGGG - Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121760638 14:96441898-96441920 CAGTGGGGACAGAGGGGTGATGG - Intronic
1122074572 14:99227917-99227939 CAATGGTCGCAGTGGGGAGAAGG - Intronic
1122117512 14:99535244-99535266 CAGTGGGAAAAGCAGGGAGAGGG + Intronic
1122474578 14:101998161-101998183 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1122474597 14:101998255-101998277 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1122474615 14:101998349-101998371 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1124501718 15:30233788-30233810 AAGAGGAAAAAGAGGGGAGAAGG - Intergenic
1124741847 15:32304863-32304885 AAGAGGAAAAAGAGGGGAGAAGG + Intergenic
1125588642 15:40840343-40840365 CAGTGGGAACAGACAAGAGATGG + Intergenic
1125697507 15:41651679-41651701 AAGGGGTAAGAGAGGGGAAAGGG - Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1126599540 15:50415142-50415164 AAATGGTGACAGAGGGAAGAGGG - Intergenic
1126768207 15:52030153-52030175 CACTGCTAAGAGATGGGAGAAGG - Intronic
1127681963 15:61306183-61306205 CAAAGGTAGCTGAGGGGAGATGG + Intergenic
1128547416 15:68577839-68577861 CTGGGGGAACAGAGAGGAGATGG - Intergenic
1128648325 15:69393079-69393101 AAGTGGGAGCTGAGGGGAGAGGG + Intronic
1130454188 15:84088689-84088711 CAGTGGGATCTGAGGAGAGATGG + Intergenic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1130964334 15:88685941-88685963 CAGAGGCAGCAGAGTGGAGATGG + Intergenic
1131571771 15:93544793-93544815 GAGTGGAAACAGAGGGGACTAGG - Intergenic
1132315088 15:100883855-100883877 CAGTGATGACAGATGAGAGAGGG - Intronic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1134195188 16:12154370-12154392 CAGGGGTGTCAGAGGGGAGAGGG - Intronic
1135235748 16:20754177-20754199 CAGTGAAATAAGAGGGGAGAAGG + Intronic
1137685814 16:50386098-50386120 AAGAGGTGACAGAAGGGAGAAGG - Intergenic
1137991590 16:53162213-53162235 CAGTGGGAAGAGAGGCCAGAGGG + Intronic
1138413916 16:56860351-56860373 CAGAGGAAGGAGAGGGGAGAGGG - Intergenic
1139485352 16:67253116-67253138 ATGTGGTAACAGAGGGCAGGAGG - Intronic
1139615063 16:68084054-68084076 CAGTGGGAAGAGAGGGTAAAGGG - Intergenic
1139766715 16:69236745-69236767 CAGTGGAAACTGAGGGGAGTAGG + Intronic
1139868957 16:70088283-70088305 CAGTGAGAATAGGGGGGAGATGG - Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140386430 16:74543889-74543911 CAGTGAGAATAGGGGGGAGATGG + Intronic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1140732121 16:77865810-77865832 GAGTGGGAAGAGAAGGGAGATGG + Intronic
1141917183 16:87107226-87107248 CATTGGAAACAGAGCAGAGAGGG - Intronic
1142142672 16:88479542-88479564 CGGTGGGGACAGAGAGGAGACGG - Intronic
1143133626 17:4697145-4697167 CAGAGGTCACAGAGGTGAGGAGG + Intronic
1143346725 17:6254995-6255017 CAGTGACCACAGAGGGGAGCTGG + Intergenic
1143576770 17:7798380-7798402 CAGTGACAAGAGAGGAGAGATGG + Intronic
1143836499 17:9696879-9696901 CAGGGGAACCAGAGGGGAAAGGG - Intronic
1144554307 17:16268341-16268363 AAGTGGCAACAGAAGGGAAATGG - Intronic
1146945239 17:36869158-36869180 CAGAGGTCACAGAGGGAGGAGGG + Intergenic
1149093483 17:52813681-52813703 CAGAGGTAACAAAGAGGAGCTGG - Intergenic
1150451320 17:65271232-65271254 TGGTGGGAAAAGAGGGGAGAGGG + Intergenic
1150673825 17:67226636-67226658 CTGTGGTATCTGAGGGGCGAAGG - Intronic
1150852269 17:68714971-68714993 CAGTAGTCACAGGGGGGACACGG - Intergenic
1151095424 17:71492175-71492197 CTGAGGTAAGAGAGGAGAGAAGG + Intergenic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1152844410 17:82591055-82591077 CAGTGCTGACAGATGGGAGGTGG + Intronic
1153146790 18:2042313-2042335 TATTGGTAACAGAGGTGGGAGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157593133 18:48848113-48848135 CAGTGGAGACAAAGGGGACAGGG - Intronic
1157627369 18:49061683-49061705 CAGTGGGAACAGAGGAGAGCTGG + Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1162028770 19:7908576-7908598 CAGGAGGAAAAGAGGGGAGAGGG + Intronic
1163311394 19:16517044-16517066 CTGTGGGAACACAGGGTAGAGGG - Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1166412718 19:42567080-42567102 CTGGGGTAAAAGAGGGGATAGGG - Intergenic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1166665340 19:44676441-44676463 CAGTGGGAGCAGACAGGAGAGGG - Intronic
1167867353 19:52339002-52339024 CAAAGGTAATAGTGGGGAGAGGG + Intronic
925234402 2:2265526-2265548 CAGTGGGTACAGAGGGGACCAGG + Intronic
925505363 2:4556375-4556397 CAGTGGCCAGAGACGGGAGAGGG + Intergenic
926743219 2:16129224-16129246 GAGTAGTAACAGAGGTGAGTGGG + Intergenic
927680185 2:25133770-25133792 CAGGGGACACAGAGGGGAAAAGG - Intronic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929464655 2:42133731-42133753 CAGTGGTAATCGAGGGGATTTGG - Intergenic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929823157 2:45289579-45289601 AACTTCTAACAGAGGGGAGAAGG + Intergenic
929945468 2:46368348-46368370 CATAGGGAACTGAGGGGAGAGGG + Intronic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932411728 2:71551557-71551579 CAGGGGAGACAGAGGGGAGGAGG - Intronic
932720348 2:74134292-74134314 CAGTTGTATCAGAGCTGAGAAGG - Intronic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
937183279 2:120014767-120014789 CAGAGCAAACAGAGGGGAGTAGG + Intronic
937678096 2:124613941-124613963 CAGGGCTATCAGATGGGAGACGG + Intronic
938249383 2:129802427-129802449 GACTGGAAACAGAGGGGAGAGGG - Intergenic
941204704 2:162557499-162557521 CAGTGGCAAAAGATGGGAGATGG + Intronic
941989533 2:171541440-171541462 CAGGGGTAACATGGGGAAGAGGG + Intronic
944318979 2:198313594-198313616 AAGGGGAAACAGAGGAGAGAAGG - Intronic
946938241 2:224744034-224744056 CAGTGGTCAAACAGGGGAGTTGG + Intergenic
947309581 2:228786347-228786369 GTGTAGTAACAGAGGTGAGAAGG - Intergenic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
948460253 2:238125611-238125633 CAGGGGTAAAAGCGGGGAGACGG + Intronic
1169771446 20:9205773-9205795 CAGGGGTTAGAGAGGAGAGAAGG - Intronic
1170688924 20:18594538-18594560 CCGTGGTAATGGAGGGGAGGAGG - Intronic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1172162020 20:32875403-32875425 CAGGGGGCACAGAAGGGAGATGG - Intronic
1172242054 20:33419659-33419681 CAAAGGAAAAAGAGGGGAGATGG - Intronic
1172330593 20:34073796-34073818 CTGGGGAAACAAAGGGGAGAGGG - Intronic
1173228644 20:41177116-41177138 CAGTGGTACCAGAAGGTAGATGG + Intronic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1173834382 20:46115698-46115720 CTGTGGCAACACAGGGGAGGAGG + Intergenic
1174142048 20:48422035-48422057 CAGTGGTGACAGAATGGAAAAGG + Intergenic
1174193416 20:48756273-48756295 AGGTGGGAACAGAGTGGAGAGGG - Intronic
1174548409 20:51343670-51343692 CAGTGGGATCAGAGGGGTTATGG + Intergenic
1174744469 20:53047945-53047967 CAGTGGAAACGGAGGTCAGAAGG + Intronic
1178582795 21:33850392-33850414 CGGTGGGCACAGAGGTGAGAGGG - Intronic
1179114196 21:38475220-38475242 CAGTGGCAAGGGATGGGAGATGG + Intronic
1179873981 21:44258277-44258299 CCCTGGTAGCAGATGGGAGAGGG - Intronic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1180738428 22:18035946-18035968 CCAAGGTAACAGAGAGGAGACGG - Intergenic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1181078498 22:20397549-20397571 TAGTGGTTACCAAGGGGAGAGGG - Intronic
1181284024 22:21739344-21739366 CAGAGTTAGCAGAGGGGAGGAGG - Intergenic
1181616788 22:24060418-24060440 CAGTGGTAATAGTGGGGTGCTGG + Intronic
1181793924 22:25290038-25290060 CAGTAGGAACAGAGGTGGGAGGG + Intergenic
1181833920 22:25586581-25586603 CAGTAGGAACAGAGGTGGGAGGG + Intronic
1182692689 22:32175082-32175104 CAGAGGTCACAGGGAGGAGAGGG - Intergenic
1182779026 22:32852663-32852685 CAGAGTTAGCAGACGGGAGAAGG - Intronic
1183214323 22:36469319-36469341 CAGTGGCTACAGAGGGCACAAGG + Intronic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949592447 3:5508640-5508662 CAGTGATAAGTGAGGGGTGATGG + Intergenic
950179575 3:10901586-10901608 CAGTGGGAACAGTGGTGGGAAGG - Intronic
952161754 3:30700848-30700870 CAGTTGGAACAAAGGGGAGGGGG + Intergenic
952571655 3:34725073-34725095 CAGGGGTGAAAGATGGGAGATGG - Intergenic
954530051 3:51310435-51310457 CCATGGGAACAGAGAGGAGAGGG + Intronic
955707686 3:61745598-61745620 AAGAGGTAACAGAAGGGACAGGG - Intronic
955771639 3:62390542-62390564 AAGTGGTAACAGAGGTGGGCAGG - Intergenic
955968609 3:64414079-64414101 CAGTGTTCAAAGAGGGGAGAAGG - Intronic
956519204 3:70085027-70085049 CAGTGATGGCAGAGGGGAGAGGG + Intergenic
958822576 3:98992464-98992486 CAGAGGAAACTGAAGGGAGAGGG - Intergenic
960121233 3:113950122-113950144 CGGTGGAAACACAGAGGAGAGGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961362414 3:126376194-126376216 CAGAGGAAACAGAGTGGAGGCGG + Intergenic
962131455 3:132682191-132682213 CACTGGAAAAAGAGGGGAAATGG - Intronic
962898693 3:139738014-139738036 CTGTGGTAACAGAGGACACAGGG + Intergenic
964024705 3:152058324-152058346 CAGTGGGAACAGAAGGGCAAGGG - Intergenic
964527537 3:157631197-157631219 GGTTGGTGACAGAGGGGAGAAGG - Intronic
965023136 3:163261165-163261187 AAGTGATAACAGATGGTAGAAGG - Intergenic
966010751 3:175073166-175073188 CATTAGTAACTGAGGAGAGAAGG - Intronic
966098275 3:176232972-176232994 CAGTGGTTACCAAGGGTAGAAGG + Intergenic
966423709 3:179758892-179758914 CAGTGGTTATAGATGGGTGATGG - Intronic
968557656 4:1255696-1255718 CAGTGGTTGCACTGGGGAGAAGG - Intergenic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
971257382 4:25027887-25027909 CATTGCTCACAGAGAGGAGATGG + Intronic
971302963 4:25456916-25456938 CAGTGTTGACAGAGAGGAGGGGG - Intergenic
972756278 4:42050359-42050381 CAGTGGGAGGAGAGGGGATAGGG + Intronic
973587527 4:52408379-52408401 CAGGGGGAAGAGAGGGGACAAGG + Intergenic
974710637 4:65589434-65589456 CAGTGGTTACAGAGGGAGGTGGG - Intronic
975822198 4:78282974-78282996 CAGTAGAAACAGAGGAGACATGG - Intronic
976591223 4:86851483-86851505 CAGTGCTGATAGAGGGGAGGGGG + Intergenic
977460721 4:97321516-97321538 CACTGGAAACAGAGAGGAGTGGG - Intronic
977711033 4:100125834-100125856 CATAGGGAAGAGAGGGGAGAAGG + Intergenic
978092680 4:104737185-104737207 CAGAGGTAATAGACGGTAGATGG + Intergenic
978352881 4:107838892-107838914 CAGTGGCTACAGAAGGCAGATGG - Intronic
978627837 4:110707660-110707682 GAGTAGTAAGAGAGGGTAGAGGG - Intergenic
979446864 4:120823976-120823998 TAGTGGTCAAAGAGGGGATAAGG - Intronic
980245241 4:130230505-130230527 CAGTGGTAAGAGGGGCCAGATGG + Intergenic
981582569 4:146264830-146264852 CAGTGAAAACTGAGGGGAAAAGG - Intronic
985063813 4:186103111-186103133 CAATGGTAACAAGAGGGAGAGGG - Intergenic
985428573 4:189855679-189855701 CAGGAGGAACAGAGGGGAAATGG - Intergenic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
988453653 5:31368323-31368345 TCCTGGTAACAAAGGGGAGAGGG + Intergenic
989317673 5:40102029-40102051 CAGTGATATAAGAGGGGAGCAGG + Intergenic
990058591 5:51618060-51618082 AAGAGATAACAAAGGGGAGATGG - Intergenic
990432565 5:55750941-55750963 CTATGGTAACAGAGGGGAACAGG - Intronic
991511001 5:67376221-67376243 CAGTGGGAACAGATGACAGATGG - Intergenic
993602242 5:89941520-89941542 CAGTGGTAAAGGAAGGGAGAGGG + Intergenic
995063422 5:107835708-107835730 GGGTGGAAAGAGAGGGGAGAAGG + Intergenic
995479822 5:112582802-112582824 CAGTTGTCACACAGGGGACAGGG - Intergenic
995863658 5:116667096-116667118 CACTGGTGACAGTGGTGAGATGG + Intergenic
996785584 5:127233339-127233361 CAGAAGTAACAAAGGAGAGAAGG - Intergenic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
1000216596 5:159163460-159163482 AAGTGGAAACAGTGGGAAGAGGG - Intronic
1000873509 5:166606203-166606225 CAGGGGTAGCAGAGGCGAAAAGG - Intergenic
1000941948 5:167372428-167372450 CAGAGGTAACAGTGGGCTGAGGG - Intronic
1001804422 5:174571068-174571090 CAGGGGTAAAAGGGAGGAGATGG - Intergenic
1002308539 5:178298560-178298582 CAGGGGCAACAGAGAGGAGCAGG - Intronic
1002866797 6:1129130-1129152 CAGTCCAAACACAGGGGAGAGGG + Intergenic
1003387168 6:5679502-5679524 GAGTGTTGACAGAGGGGTGATGG - Intronic
1004578379 6:16922523-16922545 CAGTGGCAGGAGATGGGAGAGGG + Intergenic
1005149089 6:22727726-22727748 TGGTGGTAAGAGAAGGGAGAAGG - Intergenic
1005979338 6:30824431-30824453 GAGTGGGGACAGATGGGAGATGG + Intergenic
1006574904 6:35037905-35037927 TGGTGGTAAGAGAAGGGAGAGGG + Intronic
1006898293 6:37484431-37484453 CAGTGGGAAGTGAGGGGTGAAGG - Intronic
1007818960 6:44545850-44545872 CAGTGGTAATAGAGGGAATCTGG - Intergenic
1008487517 6:52051966-52051988 CTATGGAAACAGAGGAGAGATGG + Intronic
1008535484 6:52503708-52503730 CAGTGGCCACAGAAGGGAGGGGG + Intronic
1008777656 6:55061313-55061335 CAGTGGTAGCAGTGGTGAGCAGG + Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009990599 6:70838711-70838733 GAGTAGTAACAGAGGAGACAAGG + Intronic
1013172382 6:107648417-107648439 CTGTAGTCACAGTGGGGAGAGGG + Intronic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1014633648 6:123817729-123817751 CAGTGGTAAATGAGGAGAGCAGG + Intronic
1015886447 6:137923201-137923223 CAATGGGAACAGAGAGGAAAAGG - Intergenic
1016799804 6:148157015-148157037 GCGTGGTGACAGAGGAGAGAGGG - Intergenic
1017137582 6:151161796-151161818 TTATGTTAACAGAGGGGAGATGG + Intergenic
1017726186 6:157277459-157277481 GAGTGGGACCAGAGGAGAGAAGG - Intergenic
1019184042 6:170210550-170210572 CATTGCCAGCAGAGGGGAGACGG + Intergenic
1019311585 7:364437-364459 CAGTGGTGACAGTGGGGAGGGGG - Intergenic
1019321782 7:419313-419335 CAGGGGTGACTGAGGGGAGCTGG - Intergenic
1019605678 7:1909050-1909072 CAGTGGGAACACAGGGCAGGAGG + Intronic
1019853927 7:3585629-3585651 CAGTGGTAACAGAGAACAGAGGG + Intronic
1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG + Intergenic
1021638684 7:22716992-22717014 CAAGGGAAACAGAGAGGAGAAGG - Intergenic
1024185485 7:46944335-46944357 CAGTGGAAACAGAAGTGAGCAGG - Intergenic
1024590878 7:50881896-50881918 CAGTGGTGACTGAGGGGATGGGG + Intergenic
1024630530 7:51243350-51243372 CAGTGGTGACACAGGGGTGACGG + Intronic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1027338112 7:77175961-77175983 CAGTGTTATCAGAAGGGAAAGGG + Intronic
1027428742 7:78088325-78088347 CAGAGGTCAGAGAGGAGAGAAGG - Intronic
1029292292 7:99511348-99511370 AAGAGGAAACAGAGGTGAGAAGG - Intronic
1029777615 7:102694832-102694854 CAGTGTTATCAGAAGGGAAAGGG - Intergenic
1029919043 7:104242859-104242881 CAGTGGCCACAGAGGAGAGAAGG + Intergenic
1030352272 7:108503120-108503142 CAAAGGTAACTGAGGTGAGAAGG + Intronic
1032065529 7:128766864-128766886 CAGTTGTGAAAGGGGGGAGATGG + Intronic
1034422278 7:150996170-150996192 CAGGGGTGGGAGAGGGGAGAGGG - Intronic
1034452271 7:151143329-151143351 CTGTGGTTGCAGAGAGGAGAAGG + Exonic
1034988152 7:155530420-155530442 CAGGGGTCATGGAGGGGAGAGGG - Intronic
1035572766 8:684549-684571 CAGTGGTACCACAGAGAAGAGGG + Intronic
1037906566 8:22719065-22719087 CAGGGGTCAGAGAGGAGAGACGG - Intronic
1038026039 8:23591642-23591664 CAGTGAGAACATAGGGGAAAGGG + Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039603267 8:38859857-38859879 CAGTTGTAACAGAGGCCATATGG + Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040413987 8:47181301-47181323 CAGTGGGAACAGTGTGGAGAAGG - Intergenic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1041423242 8:57692819-57692841 CAGAGGTCATGGAGGGGAGAGGG + Intergenic
1042051614 8:64715646-64715668 CACTGGCAACAGAGGGAAAATGG + Intronic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044847068 8:96392468-96392490 AGGTGGGAACAGAGGGGTGAAGG - Intergenic
1046768414 8:118095217-118095239 CAGGGATAACAGAGGGCAAAAGG - Intronic
1046966076 8:120167208-120167230 CAGTGGAAAGAAAGGGGAGGAGG + Intronic
1047167686 8:122458420-122458442 CAGTGGAAACAGTGGGTGGAGGG + Intergenic
1047986774 8:130243554-130243576 GTGTGGGAACAGAGGGGAGAGGG - Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048264920 8:132977295-132977317 CAGTGCTGACAGAGAGGTGAAGG - Intronic
1048326365 8:133442373-133442395 CAGTGGCAAAAGATGGGAGCAGG - Intergenic
1048451913 8:134540978-134541000 CACTGGCACCAGAGGGGAGAGGG + Intronic
1049390101 8:142363371-142363393 CAGTGGGAACCAGGGGGAGAGGG + Intronic
1049606510 8:143532018-143532040 CAATAGTAACTCAGGGGAGATGG + Intronic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1049963174 9:755745-755767 CAGTGGGAACAGGCTGGAGATGG - Intergenic
1050069948 9:1800114-1800136 CAGTGGTAAATGAAGGCAGATGG - Intergenic
1050418459 9:5438006-5438028 CAGTGTTACCAGAGGTGGGAGGG + Intergenic
1050686082 9:8170791-8170813 CAGAGGTCACAGAGTGGTGAAGG - Intergenic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1052553797 9:29986672-29986694 CAGTGGACACTGATGGGAGAGGG + Intergenic
1052680393 9:31684267-31684289 GACTGTTAACAAAGGGGAGATGG + Intergenic
1053527885 9:38847935-38847957 CAGTGCTAAAACAGGGAAGAGGG - Intergenic
1054200106 9:62072371-62072393 CAGTGCTAAAACAGGGAAGAGGG - Intergenic
1054638249 9:67515989-67516011 CAGTGCTAAAACAGGGAAGAGGG + Intergenic
1054862988 9:69972250-69972272 CAGGAGTAACAGAGGGGGAAGGG - Intergenic
1054990225 9:71317026-71317048 CAGAAGTAACATAGGGGATATGG - Intronic
1055548222 9:77404891-77404913 GACTGGTAAAAGAGGGGAGCAGG + Intronic
1056412546 9:86345332-86345354 CAGTGGTAACAGAGGATAGGTGG + Intronic
1056798966 9:89678188-89678210 CAGGGGTCAAAGAGGGGAGCTGG + Intergenic
1057722352 9:97543118-97543140 GGGTTGTAACTGAGGGGAGAAGG - Intronic
1058959341 9:109978158-109978180 CTGAGGTGGCAGAGGGGAGATGG + Intronic
1059736526 9:117105460-117105482 CACGGGTAACAGATGGCAGAGGG - Intronic
1060369828 9:123058038-123058060 CCGTGGAAAGAGAGGGGAGAGGG + Intronic
1060591221 9:124818126-124818148 CAGAGCTCACAGAGGGGAGATGG - Intergenic
1060865393 9:126991183-126991205 CAGTGGAAACAGAGTAGAAAAGG + Intronic
1061396034 9:130343721-130343743 CAGTGCTATCAGAGGGGATTTGG - Intronic
1062006181 9:134239622-134239644 CAGTGGGAACACAGGCGGGATGG - Intergenic
1062583579 9:137238789-137238811 GAGTTGTCACAAAGGGGAGAAGG - Intergenic
1185688228 X:1948141-1948163 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1185688517 X:2133680-2133702 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1188444223 X:30239869-30239891 CAGTAGTAACAGAGAAGTGAAGG + Intergenic
1189110763 X:38286584-38286606 AGGAGGAAACAGAGGGGAGAGGG - Exonic
1189357985 X:40326037-40326059 CAGGAGCAAGAGAGGGGAGAGGG + Intergenic
1190276771 X:48904241-48904263 CGGTGGTAAGGGAGGAGAGAAGG + Exonic
1193746465 X:85288440-85288462 CAGTGGGCACTGAGGGGAGGTGG - Intronic
1194424440 X:93719127-93719149 CAGTGGTTACAGAGGGGCAAGGG - Intergenic
1196000305 X:110776737-110776759 CAGTGGTAACAGGGGGTATATGG - Intronic
1196068095 X:111487952-111487974 CATTGGTCACAAAGGGGATAGGG + Intergenic
1196123942 X:112080325-112080347 CTTTTGTAACAGAGGGGAGCAGG - Intronic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1196277014 X:113778279-113778301 TATTGGTAGCAGAGAGGAGATGG + Intergenic
1199589888 X:149457546-149457568 GAATGGAGACAGAGGGGAGATGG + Intergenic
1200579938 Y:4938137-4938159 CAATGGTAACGTAGGGGAGTGGG + Intergenic