ID: 928948837

View in Genome Browser
Species Human (GRCh38)
Location 2:36796481-36796503
Sequence ATGTGGTAGGGGAAAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 433}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928948832_928948837 3 Left 928948832 2:36796455-36796477 CCAAAACTAACAAGACTCAGCTG 0: 1
1: 0
2: 0
3: 11
4: 183
Right 928948837 2:36796481-36796503 ATGTGGTAGGGGAAAGAGACAGG 0: 1
1: 0
2: 1
3: 39
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928948837 Original CRISPR ATGTGGTAGGGGAAAGAGAC AGG Intronic
900990394 1:6095891-6095913 ATGTGGTAGGGGGTAGAGATGGG - Intronic
902111254 1:14080352-14080374 ATGTGGGAAGGGAAATACACGGG + Intergenic
902248091 1:15135018-15135040 ATGAGGGAGGAGAGAGAGACGGG + Intergenic
902666416 1:17942213-17942235 AGATGGTAGGGGAATGAGAGAGG + Intergenic
902716598 1:18277019-18277041 ATGGTGTTGGGGAAAGAGACAGG + Intronic
902860769 1:19243851-19243873 GTCTGGTAGGGAAAGGAGACTGG - Intronic
903189268 1:21647708-21647730 CTGGGGTAGGGGAAAGAGCATGG - Intronic
903407651 1:23111749-23111771 GTGGGGAGGGGGAAAGAGACAGG - Intronic
903685184 1:25126349-25126371 ATGTATTAGGAGAAAGTGACTGG + Intergenic
904265281 1:29315166-29315188 ATGTGCTAGAGGACAGAGATGGG - Intronic
904588791 1:31595890-31595912 TTGCAGTAGGGGAGAGAGACTGG - Intergenic
904599601 1:31666132-31666154 ATGAGGTAGGGGGATGTGACAGG + Intronic
904611817 1:31730037-31730059 ATGTGGTTAAGGAAAGGGACAGG - Intronic
905386736 1:37609772-37609794 ATGTGGAAGAGGGGAGAGACGGG - Intergenic
906573686 1:46867819-46867841 ATTTGGAAGGGTAAAGATACAGG - Intergenic
907269995 1:53285409-53285431 ATGATGTAGGAGAAAGAGCCTGG + Intronic
908250286 1:62260417-62260439 ATAAGGTGGGGGACAGAGACAGG - Intronic
908453630 1:64280789-64280811 ATGAGGTAAGAGAAAGAGGCAGG + Intergenic
909374641 1:74925423-74925445 TTGGGGTACGTGAAAGAGACAGG + Intergenic
909561957 1:77017037-77017059 AGGGGGCAGGGGAATGAGACTGG + Intronic
909850585 1:80458120-80458142 CTGAGGTATGAGAAAGAGACTGG - Intergenic
910062056 1:83105657-83105679 ATGGGGTAGGGGTTAGATACAGG - Intergenic
910534765 1:88284570-88284592 TGGTGGCAGGGGAAAGAGAGGGG - Intergenic
910746145 1:90576942-90576964 ATGTGAGAGGTGAAAGAGAGTGG - Intergenic
911258395 1:95659095-95659117 ATGTTGTAGAGGAAAGGGATAGG + Intergenic
912208398 1:107533016-107533038 AGCAGGTAGAGGAAAGAGACTGG + Intergenic
912728838 1:112083360-112083382 GTGTGATAGGGGAGAGAGAGTGG - Intergenic
913485926 1:119332837-119332859 ATGTGGAGGGGGAAGGAGAAAGG - Intergenic
914393787 1:147245261-147245283 ATTTGGAAGGGGAAAGTGAGGGG + Intronic
914876293 1:151514650-151514672 ATCTCGTAGGGGAGACAGACAGG + Intronic
915280398 1:154818493-154818515 ATGTGGTAGTGCCAAGAGATGGG + Intronic
915869838 1:159546972-159546994 ATGTTGCATGGGAAAGAGAAGGG + Intergenic
916124977 1:161561420-161561442 ATGTGTTATGGGAAGGATACTGG + Intergenic
916134871 1:161642765-161642787 ATGTGTTATGGGAAGGATACTGG + Intronic
916813610 1:168328630-168328652 ATGTGGTAGCAGCCAGAGACAGG - Intergenic
916931413 1:169581622-169581644 ATCTGATTGGGGAAAGGGACAGG + Intronic
918107823 1:181428529-181428551 GTGGGGTAGGGGAGAGAAACAGG + Intronic
918707506 1:187685437-187685459 CTGTGGTAGGGTAAACAGAGAGG + Intergenic
919197332 1:194303191-194303213 ATGTGGTTGGAGAGATAGACAGG - Intergenic
919240901 1:194914664-194914686 TTGTGGGAGGGGAAACACACAGG - Intergenic
920733824 1:208513097-208513119 AGGTGATGGGGGAAAGGGACAGG + Intergenic
922291998 1:224215964-224215986 ATGGGATAGAGGAAAAAGACAGG - Intergenic
923402683 1:233629969-233629991 ATGTGGCAGGGGATATAGAAGGG + Intronic
923589046 1:235302227-235302249 AAGGGGAAGGGGAAAGAGATGGG + Intronic
1063083683 10:2793155-2793177 TTGTTGTAGGAGATAGAGACAGG - Intergenic
1065696834 10:28388127-28388149 AGGTGGAAGGGGAAAGGGAAGGG + Intergenic
1065824337 10:29556264-29556286 ATGGGGTGGGAGAAAGAGAGAGG + Intronic
1067052300 10:43028779-43028801 ATGAGGTAGGAAAAATAGACAGG - Intergenic
1067256489 10:44647495-44647517 GGGAGGTAGGGGAAAGAGCCTGG - Intergenic
1068470839 10:57460862-57460884 AGGCAGTAGGGGAAAGGGACAGG + Intergenic
1070093348 10:73311494-73311516 ATCTGGTAGGAGAAACAGACTGG - Intronic
1070259435 10:74840294-74840316 ATGTGGAAGGGTTAAGAAACTGG + Intronic
1070291909 10:75122745-75122767 TTGGGGAAGGGGTAAGAGACGGG - Intronic
1071117459 10:82238607-82238629 AGGTGGTAGGGGAAAGGGAATGG - Intronic
1071899115 10:90100065-90100087 AAGTGGTAGGGGAAAGAAAATGG - Intergenic
1072926210 10:99619916-99619938 ATGTGGTAGTGGCAGGAGCCAGG + Intronic
1073663955 10:105509132-105509154 GTGTGTTAGGGGAAAAAGAAGGG + Intergenic
1074078738 10:110151579-110151601 AAGTGGAAGAGGAAGGAGACAGG - Intergenic
1075200476 10:120399266-120399288 AAGTGGAAGGGGAGAGAGAATGG + Intergenic
1075212610 10:120503689-120503711 CTGGGGAAGGGGAAAGAGACAGG - Intronic
1077399360 11:2346230-2346252 AGGTGGTCGGGGACAGAGGCTGG - Intergenic
1078238362 11:9507002-9507024 ATGTGGTGAGGGCAAGAGAAAGG - Intronic
1078844421 11:15108482-15108504 ATGATGTAGGGGAAAGACAAAGG + Intergenic
1080280046 11:30546353-30546375 ATGTTGTAGGGGAGAGAGTTGGG + Intronic
1080370809 11:31640134-31640156 ATATGGTAGGAGAAAAAGAGGGG + Intronic
1080441689 11:32300209-32300231 AAGTGGTAGGGGCAGGAGAGAGG + Intergenic
1080819117 11:35788230-35788252 ATTTGGGTGGGGAAAGAGAAAGG + Intronic
1081086344 11:38806289-38806311 CTCTGGTAGGGGAGAGAGGCAGG - Intergenic
1081309460 11:41553023-41553045 ATGATTTAGGGTAAAGAGACTGG + Intergenic
1082774583 11:57235670-57235692 GTGGTTTAGGGGAAAGAGACTGG - Exonic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1083882264 11:65554417-65554439 AGGGAGGAGGGGAAAGAGACAGG - Intronic
1084322480 11:68381358-68381380 ATGTGGTCGGGGACAGAGGTGGG + Intronic
1086596851 11:88582864-88582886 ATGTGATTGTGGAGAGAGACAGG + Intronic
1088005858 11:104939121-104939143 ATGGGGCAGAGGAAAGTGACTGG + Intergenic
1088891497 11:114048242-114048264 ATTTGGTAGGGGAAAGGAAGGGG + Intergenic
1089603376 11:119628137-119628159 GGGTGGGAGGGGAGAGAGACGGG - Intronic
1089831074 11:121328789-121328811 ATGCGGCATGGGAAAGAGGCTGG + Intergenic
1090703197 11:129314724-129314746 AAGAGGAAGGGGAAAGAGAGGGG - Intergenic
1091604138 12:1935952-1935974 ATCTGGGTGGCGAAAGAGACAGG + Intergenic
1091671426 12:2454797-2454819 ACGTGAAAGGGGAAGGAGACGGG - Intronic
1091996185 12:4995974-4995996 ATGTGGGAGGGGATGGAAACGGG + Intergenic
1092055045 12:5501808-5501830 ATGTGGAAGGCGAAAGAGGAAGG + Intronic
1092161715 12:6318713-6318735 GGGGCGTAGGGGAAAGAGACAGG - Intronic
1092193958 12:6537999-6538021 ATGTGGCTGGGGCCAGAGACTGG + Intronic
1092859911 12:12711429-12711451 ATGAGAAAGGGGAAAGAGAGTGG + Intergenic
1092914074 12:13173733-13173755 ATGCGGAAGGGGAAGGAGCCAGG + Intergenic
1093018942 12:14185450-14185472 ATGTGGAAGGGAAGAGAGAAGGG + Intergenic
1094112155 12:26873509-26873531 ATGGGGAATGGGAAAGATACAGG + Intergenic
1095866936 12:46982898-46982920 ATGTTGTGAGGGAAAGACACTGG + Intergenic
1095981651 12:47977835-47977857 AGGTTGTCGGGGAGAGAGACGGG - Intronic
1096627040 12:52902281-52902303 ATTGGGTAGGGGAAGGAGACAGG + Intronic
1098139030 12:67432688-67432710 ATGTGGCAGGTGAAGGAGAAGGG - Intergenic
1098608637 12:72426609-72426631 ATGTGGTAGGTGGTAGAGACAGG + Intronic
1099140101 12:78962578-78962600 GTGTGGTGGGGGAGAGAGAGAGG + Intronic
1099323624 12:81182823-81182845 AAGTGGAAAGGGAAAGAGAATGG - Intronic
1099694984 12:86006889-86006911 TTGTAGTAGGGGACAGAGATTGG - Intronic
1101300301 12:103472773-103472795 ATGTGGAAGGGAAAAAAGAATGG + Intronic
1101421407 12:104554331-104554353 ATGTGCAAGGGCCAAGAGACAGG + Intronic
1101806552 12:108069301-108069323 ATGTGGAAGGTGATAGGGACAGG - Intergenic
1101938857 12:109083933-109083955 ATGAGGTAGGGGACAGACTCTGG + Intronic
1102022469 12:109693383-109693405 CTGTGGTAGGAGAGAGAGAGAGG + Intergenic
1104586455 12:130051917-130051939 ATTTGGGTGGGAAAAGAGACAGG - Intergenic
1105236252 13:18556044-18556066 ATGTTGTGAGGGAAAGACACTGG - Intergenic
1105329050 13:19397748-19397770 ATGTAGTGGGGGAGAGAGAGGGG - Intergenic
1106131507 13:26943444-26943466 ATGTGAAATGGGAAAGAGAGAGG + Intergenic
1106313889 13:28577130-28577152 ATGTGGGAGGTGAATGAGAGGGG + Intergenic
1107054715 13:36090585-36090607 AGGTAGGAGAGGAAAGAGACAGG + Intronic
1107435780 13:40379726-40379748 GTGTGGTTTGGGAAAGAGAAGGG - Intergenic
1107572833 13:41681283-41681305 TTGTAGTAAGGGAAAGAGATGGG - Intronic
1108071463 13:46633566-46633588 AGTTGTGAGGGGAAAGAGACAGG + Intronic
1108542848 13:51460452-51460474 TGGTGGAAGGGGAAAGAGAGTGG - Intergenic
1108585322 13:51865797-51865819 ATGCCTTATGGGAAAGAGACCGG + Exonic
1109057530 13:57570669-57570691 ATGTGGTGGGTGAAAGATAAAGG + Intergenic
1109975333 13:69824745-69824767 ATGTGGAAGGTGAAATTGACTGG + Intronic
1110638149 13:77790478-77790500 CTGCTGTAGGGGAAAGACACAGG + Intergenic
1110973003 13:81790323-81790345 CCATGGTAAGGGAAAGAGACTGG + Intergenic
1111108304 13:83674313-83674335 AGGTAGTAGAGGAAGGAGACTGG + Intergenic
1112528458 13:100176207-100176229 GTGTTGTTGGGGATAGAGACAGG + Intronic
1112767269 13:102758937-102758959 ATGTCATATGTGAAAGAGACTGG + Exonic
1114550878 14:23532209-23532231 GAGTGGTAGGAGAAAGAGAAAGG - Intronic
1116319000 14:43435647-43435669 AAGTGGTAGGGAAAAGGGAAGGG + Intergenic
1116638367 14:47427634-47427656 GTGTGGTGGGAGACAGAGACAGG + Intronic
1116690024 14:48093889-48093911 ATGGGGCAGGAGAAAGAGATAGG + Intergenic
1116828313 14:49693286-49693308 ACGTGGTAAGGGGAAGAGGCGGG + Exonic
1117092572 14:52265939-52265961 ATGTGCTAGGGGCTAGAGATGGG + Intergenic
1118136233 14:63031140-63031162 ATCTAGTAGGGGAAAAAGACAGG + Intronic
1118474235 14:66102022-66102044 ATGTGATAGGGACAGGAGACAGG + Intergenic
1119441060 14:74629152-74629174 ATGTGGGAGGGGAAAGGTAAAGG + Intergenic
1120368852 14:83606761-83606783 TTGTGGTAGTTGAAAGAGATGGG - Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1122390101 14:101374184-101374206 ATCTGGTAGGGAAGACAGACAGG - Intergenic
1122902060 14:104786087-104786109 ATGAGGTGGGGGACAGGGACAGG - Intronic
1124605511 15:31167653-31167675 ATGGGGTTGGGGGAAGAGTCAGG - Intergenic
1124939338 15:34203546-34203568 ATGTGGTGGGGGAAAAATACAGG - Intronic
1125083394 15:35701742-35701764 AAGTGGTAGGTGAACAAGACAGG - Intergenic
1125802750 15:42464709-42464731 GTGGGGCAGGGGATAGAGACAGG + Intronic
1126645552 15:50871609-50871631 AAGTGGAAGGGAAAAGATACTGG + Intergenic
1126867702 15:52954315-52954337 AGGAGGAAGGGGAAAGAGAGAGG - Intergenic
1127151263 15:56077882-56077904 ATATGGAAGGGGAAAAACACGGG - Intergenic
1127827862 15:62720974-62720996 ATTTGGGAGGGGAGAGAGCCTGG + Intronic
1128422783 15:67510020-67510042 ATGAGGTATGGTGAAGAGACAGG - Intergenic
1128546763 15:68573610-68573632 ATGTGGTGGGGGACAGCGGCTGG + Intergenic
1128992730 15:72273902-72273924 GAGTGGTAGGGGAAGGAGTCAGG + Intronic
1129106816 15:73315507-73315529 CTGTGGTAGTGCAAAGAGATTGG + Intergenic
1129147219 15:73659493-73659515 TTGCAGTAGGGGAGAGAGACTGG - Intergenic
1129940815 15:79495293-79495315 ATGTGGGAGGTGGAAGGGACAGG + Intergenic
1131159518 15:90095757-90095779 ATGTGGAAGGGGAAACCTACAGG + Intronic
1132137080 15:99351816-99351838 TTGTAGTTGGGGAAAGAGATTGG + Intronic
1132892800 16:2212585-2212607 CTGGGGTAGGGGTTAGAGACTGG - Exonic
1133109151 16:3535318-3535340 TTGTGTGAGGGGAGAGAGACAGG + Intronic
1133863480 16:9619217-9619239 TGGTGGAAGGAGAAAGAGACAGG + Intergenic
1134908540 16:18003280-18003302 ATGAGATAGGGGAAAGAAAAAGG - Intergenic
1135186103 16:20317050-20317072 AAGGGGAAGGGGAAAGAGAACGG - Intronic
1135392283 16:22103978-22104000 GGGGGGAAGGGGAAAGAGACTGG + Intronic
1136234154 16:28904159-28904181 ATCTGGAAGGGGAAAGAGAAGGG - Exonic
1137743993 16:50807554-50807576 TTGCAGTGGGGGAAAGAGACTGG - Intergenic
1138279051 16:55759091-55759113 CTGGGGAAGGGGAAAGAGACGGG - Intergenic
1138289489 16:55834590-55834612 CTGGGGAAGGGGAAAGAGACGGG + Intergenic
1138563760 16:57817564-57817586 ATGTGCAGGTGGAAAGAGACTGG - Intronic
1139095726 16:63702862-63702884 ATGTGGGAGGAGAAAGAGTAGGG + Intergenic
1139448986 16:67015420-67015442 ATGAGGAAAGGGACAGAGACAGG + Intergenic
1139458830 16:67106166-67106188 ATGTGGGAGATGAGAGAGACTGG - Intergenic
1139544935 16:67645634-67645656 ATGGGGCAGGGGACAGAGCCGGG + Intronic
1140072866 16:71667975-71667997 AAGTGGTGGGAGAAAGAGAGTGG - Intronic
1140242221 16:73213430-73213452 ATGTGCAAGGAGAAAGAGATCGG + Intergenic
1140329349 16:74038398-74038420 ATGTGTTAGGGGAAAAAAGCAGG + Intergenic
1140601886 16:76486198-76486220 GAGTGGTAGGGTAAGGAGACAGG - Intronic
1140792067 16:78401537-78401559 ATGATTTAGGGGAAAGAGTCTGG + Intronic
1141362405 16:83408122-83408144 ATGTGTCAGGAGAATGAGACCGG - Intronic
1141856382 16:86683855-86683877 ATGTGGAGGGAGGAAGAGACAGG - Intergenic
1143197380 17:5086382-5086404 ATGTGGTAAGGGAAGGGGAAAGG - Intronic
1143216462 17:5228892-5228914 CTATAGCAGGGGAAAGAGACTGG - Intronic
1144018970 17:11223049-11223071 AAGTGACAGGGGAAAGAGAGTGG + Intergenic
1144120406 17:12147194-12147216 AAGTGGAAGGTGAAAGAGAAAGG - Intergenic
1144334139 17:14254420-14254442 GAGGGGTAGAGGAAAGAGACGGG + Intergenic
1144758370 17:17693772-17693794 CTGTGGTAGGGGGAAGGGAGAGG + Intronic
1146329652 17:31917084-31917106 GTGTGGTAGGGGACTGGGACAGG + Intergenic
1146790258 17:35746998-35747020 CTGAGGTATGGGGAAGAGACAGG - Exonic
1147437286 17:40424831-40424853 ATGAGGTGGGGGAAGGTGACAGG - Intergenic
1148159784 17:45443427-45443449 ATGGGGCAGGGGAAAGAGTGTGG - Intronic
1148255799 17:46130791-46130813 ATGAGGGAGGGGAAAGAGGAGGG - Intronic
1148549347 17:48541559-48541581 ATGTGGGAAGGGAAGGAGAGCGG - Intronic
1149552415 17:57550048-57550070 ATGGGGTAGGGAGAGGAGACAGG - Intronic
1150179472 17:63101746-63101768 ATATGGAAGGGGATAGAAACTGG + Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150391072 17:64790299-64790321 ATGGGGCAGGGGAAAGAGCGTGG - Intergenic
1150409853 17:64934351-64934373 ATGGGGCAGGGGAAAGAGTGTGG - Intergenic
1150439408 17:65179189-65179211 AAGTGGGAGGGGAAAGAAAAAGG + Intronic
1150915630 17:69433885-69433907 ATGAGATAGGAGAAATAGACAGG + Intronic
1151274198 17:73021621-73021643 GTATGGAAGGGGAAAGAGGCTGG - Intronic
1152082630 17:78197821-78197843 ATGTGGTTTGAGAAAGAGAGGGG + Intronic
1153193984 18:2572626-2572648 ATGTGGTCTGGGTAACAGACAGG + Intronic
1154513285 18:15133954-15133976 ATGTTGTGAGGGAAAGACACTGG + Intergenic
1155305312 18:24472656-24472678 GTGTGATAGGGGAAAGGGATGGG + Intronic
1155602275 18:27563278-27563300 ATGAGGTTGGAGAGAGAGACAGG - Intergenic
1156855215 18:41774063-41774085 AACTGGTAGGGGAGAGAGGCAGG - Intergenic
1156886334 18:42140419-42140441 ATGTTGTAGGAGAAAGACACTGG + Intergenic
1157035112 18:43962258-43962280 ATGTGGAAGAGGAAAGGGAAGGG - Intergenic
1157096790 18:44692898-44692920 ATGTGGTAGGTGAAGTAGTCTGG + Intronic
1158105946 18:53885227-53885249 ATGGGGTGGGGGAGAAAGACGGG + Intergenic
1158727258 18:59984903-59984925 ATGTGGTAAGGGAGTGAGAAAGG + Intergenic
1160337013 18:78051181-78051203 GGGTGGTTGGGGAAGGAGACTGG + Intergenic
1160425495 18:78776237-78776259 ATGTGGAGGAGGAAGGAGACTGG + Intergenic
1161942021 19:7411232-7411254 AAGAGGTAGGGGAAAGGAACAGG - Intronic
1162199406 19:9009850-9009872 ATCTGGTGGGCGAGAGAGACTGG - Intergenic
1162632300 19:11938376-11938398 ATGGGGTAGGGGGAAGGGAGAGG - Intronic
1165059740 19:33199268-33199290 ATGTGGTAGGGCACAGGGTCAGG - Intronic
1165380013 19:35472577-35472599 ATGGGGTGGGGGCAAGAGGCAGG - Intergenic
1166555175 19:43694502-43694524 ATATGACATGGGAAAGAGACAGG + Intergenic
1166853522 19:45771321-45771343 CTGAGGCAGGGGAAAGAGAGGGG + Intronic
1167291739 19:48628614-48628636 CAGGGGTTGGGGAAAGAGACAGG - Intronic
1167399964 19:49258692-49258714 GTGTGGTGAGGGAAAGAGACAGG + Intergenic
1167628258 19:50606601-50606623 ATGTGGACGTGGAAAGTGACTGG + Intergenic
1168135930 19:54351962-54351984 TTGTAGTAGGGGAAAGAAAATGG - Exonic
926309801 2:11667282-11667304 TTGTGGAAGGGGAAAGAGGCTGG - Intronic
927006047 2:18850304-18850326 AGTTGGTAGGGGAATGAGGCAGG + Intergenic
927012698 2:18922502-18922524 ATGTGGTGGGGGAGAGCGGCAGG - Intergenic
927056458 2:19369814-19369836 AAGAGGTGGTGGAAAGAGACAGG + Intergenic
927984228 2:27396392-27396414 ATGAGCTGGGGGAAAGAGAATGG + Intronic
928457423 2:31435126-31435148 ATTTGGTAGTGGAGAGAAACAGG + Intergenic
928634682 2:33231980-33232002 TTGGGGTAGGGGAGAGAGATTGG + Intronic
928948837 2:36796481-36796503 ATGTGGTAGGGGAAAGAGACAGG + Intronic
929016556 2:37503228-37503250 ATGTGGGTGGGTAAAGAGACAGG + Intergenic
930171920 2:48260495-48260517 ATGTGGTCAGAGAAAGAGTCAGG - Intergenic
931683177 2:64769454-64769476 ATATAGTATGTGAAAGAGACTGG + Intergenic
932519512 2:72395311-72395333 ATGTGGAAGTTAAAAGAGACTGG - Intronic
932759256 2:74428760-74428782 GTGAGGTAGGGGAATGAGAAGGG + Intronic
933176434 2:79179043-79179065 ATGTGGCAGAAGAAAAAGACAGG + Intergenic
935679861 2:105626684-105626706 AGGAGGTTGGGGAAAGAGAAGGG - Intergenic
937457209 2:122052836-122052858 AGGTGGTGGGGGAAAGGGAAGGG - Intergenic
937735864 2:125288050-125288072 ATGTGAGAGGGCAAAGAGAGTGG + Intergenic
938111069 2:128565394-128565416 ATTTGGAAGGTGAAAGAGAAAGG + Intergenic
938180982 2:129182181-129182203 ATGAGGGAGTGGAAAGAGAAGGG - Intergenic
938513533 2:131978565-131978587 ATGTTGTGAGGGAAAGACACTGG + Intergenic
939365098 2:141220445-141220467 ATGCGGTACCTGAAAGAGACAGG + Intronic
940023918 2:149185078-149185100 ATGTGGTAAGAGAGGGAGACCGG + Intronic
941695995 2:168551287-168551309 ATGGGGGAGGAGAGAGAGACAGG - Intronic
942344987 2:174993301-174993323 TTGTGATAGGGGAGAGAGATTGG - Intronic
943538824 2:189185690-189185712 ATATGATAAGGGAAACAGACAGG - Intergenic
944380991 2:199110720-199110742 ATGAGGTCAGGGAAGGAGACAGG - Intergenic
945030001 2:205654672-205654694 ATGTGTTATGGGAGTGAGACTGG + Intergenic
945397001 2:209331286-209331308 ATCTGGTGTGGGAAAGAGGCAGG + Intergenic
945419629 2:209618523-209618545 ATGTGGTAGGAGAAAAAAATTGG - Intronic
945768714 2:214013489-214013511 CTGGGGGAGGGAAAAGAGACGGG - Intronic
946387970 2:219397222-219397244 ATGTGGAACAGGAAAGAGACGGG - Intronic
946461709 2:219874585-219874607 TTGTGGTAGGGGGAAGAGAAGGG + Intergenic
946817970 2:223598533-223598555 ATGTGGTCGGGGGAGAAGACTGG - Exonic
947134327 2:226961984-226962006 AAGTGATAGGGGAAAGACACCGG - Intronic
947282747 2:228473643-228473665 ATGTGGTTTGGTAAAGAGAAGGG + Intergenic
947825801 2:233105348-233105370 AGGTGGTGGGGCAAAGAGACAGG - Intronic
948514468 2:238495118-238495140 ATGTGGTAGGGGTAATATCCAGG - Intergenic
1168988475 20:2072565-2072587 ATGTGTTAGAGAAAAGAGGCTGG + Intergenic
1169472748 20:5902236-5902258 TTGTGGTGGGAGAAAGAAACAGG - Intergenic
1169602866 20:7281974-7281996 ATATGGTAGGAGGAAAAGACAGG - Intergenic
1169799088 20:9496790-9496812 ATGTGGAAAGAGAAAGAGAGAGG + Intergenic
1169924064 20:10765087-10765109 AGGTTGGAGGGGACAGAGACTGG + Intergenic
1170066050 20:12311736-12311758 ATGTGGTAGGGAATAGAGGAGGG - Intergenic
1170808166 20:19652654-19652676 ATGCGTTAATGGAAAGAGACTGG + Intronic
1171436549 20:25129518-25129540 TTGTGGTCGGGAGAAGAGACAGG - Intergenic
1173152300 20:40578054-40578076 ACGTGGGAGGGGAAAGGGATGGG - Intergenic
1173160870 20:40651845-40651867 ATGTAGTGTGGGAAATAGACGGG + Intergenic
1173164370 20:40676223-40676245 ATGTGGTGGTGGAAACAGACAGG + Intergenic
1173316394 20:41948620-41948642 CTGTGGGAGTGGGAAGAGACAGG - Intergenic
1173764431 20:45594643-45594665 ATGGGGTACCTGAAAGAGACTGG - Intergenic
1174093231 20:48066759-48066781 TTGTGGTTGGGGACAGAGATGGG + Intergenic
1174219506 20:48942139-48942161 ATGAGGGAGGGAAAAGAGAAAGG + Intronic
1174373367 20:50109368-50109390 ATGTGGTGGGGGAAATAGAGTGG + Intronic
1175700399 20:61132741-61132763 ATGTTCTAGTGGAAGGAGACAGG - Intergenic
1176780248 21:13184329-13184351 ATGTTGTGAGGGAAAGACACTGG - Intergenic
1176942834 21:14944563-14944585 AAGTGGTAGAGGAACAAGACAGG + Intergenic
1177748530 21:25251405-25251427 ATGTTGTAGGGAAAGGAGAGAGG + Intergenic
1177977914 21:27873351-27873373 ATGTTGTGAGGGAAAGACACTGG - Intergenic
1178111903 21:29377117-29377139 ATGGGGTAGGGGAATGAGAGGGG + Intronic
1178865286 21:36321698-36321720 AGGAGATAGGGGAAAGAGAGGGG - Intronic
1180665626 22:17509309-17509331 ATGTGGTATGTGGAAGAGTCAGG + Intronic
1180841662 22:18961776-18961798 ATGTGGTAGGTGAGAGCGGCAGG - Intergenic
1181059838 22:20277070-20277092 ATGTGGTAGGTGAGAGCGGCAGG + Intronic
1181727901 22:24824319-24824341 GTGTGGGAAGGGAAAGAGACAGG + Intronic
1181962189 22:26630187-26630209 CTGTGGTAGGGGAGAGAGCATGG + Intronic
1182137760 22:27921548-27921570 TTGTAGTGGGGGAAAGAGATTGG + Intergenic
1183337583 22:37259354-37259376 ATGTGGCAGAGGCCAGAGACAGG - Intergenic
1183687339 22:39368692-39368714 AGGTGGGAGGGGAAACAGGCAGG - Intronic
1183929518 22:41228010-41228032 AAGGGCAAGGGGAAAGAGACAGG - Intronic
1184229762 22:43152178-43152200 AAGGGGTAGGGGAAGCAGACAGG - Exonic
1184714346 22:46272465-46272487 CTGTGGTAAAGGAAAGAGAGGGG - Intronic
950327117 3:12121226-12121248 ATGTGTAAGCAGAAAGAGACAGG - Intronic
950924064 3:16722636-16722658 ATGTGGTAGGAGAGAGAGCCTGG + Intergenic
951289077 3:20853888-20853910 ATGAGAAAGGGGAAAGAAACTGG - Intergenic
951494090 3:23306414-23306436 ATGGGGAAGGGGATATAGACTGG - Intronic
952981966 3:38743310-38743332 AGGTGGGAGAGGAAAGAGCCCGG - Intronic
953677903 3:45017583-45017605 GTGTGGCAGTGGAAAGAGAATGG - Intronic
953739596 3:45525983-45526005 AAGTAGGAGGGGAAAGAGAGAGG + Intronic
954469708 3:50682498-50682520 ATCTGGTTGGAGAAAGAGAGGGG - Intronic
955157957 3:56435864-56435886 GTGTGAAAGGGAAAAGAGACAGG - Intronic
955555696 3:60134939-60134961 ATGGAGTAGAGGAAAGAGAAAGG + Intronic
956582512 3:70830184-70830206 ATGTAGTAGGAGACAGAAACAGG - Intergenic
957017311 3:75083155-75083177 ATGAGGTAGAGGAAAGCGAGTGG + Intergenic
957624570 3:82642021-82642043 CCATGGTAGGGGAAAGAGCCTGG - Intergenic
958182416 3:90077097-90077119 GTGAGGGAGGGGAAAGAGAGAGG + Intergenic
958529025 3:95300623-95300645 ATTGAGTAGGGGAAAAAGACAGG - Intergenic
958650765 3:96932956-96932978 ACTTGGTATGGGAAAGATACAGG + Intronic
959216221 3:103453782-103453804 AAGTAGTAGGTGAATGAGACTGG - Intergenic
959739636 3:109702431-109702453 TTGTGGGAGGGGAATGAGAATGG + Intergenic
961357345 3:126347463-126347485 ATGTGGTGGGGGACAGAGAAGGG - Intronic
963208690 3:142663698-142663720 ATGGGGTAGGGGAAAGAATGTGG + Intronic
964202878 3:154137899-154137921 ATGGAGAAGGGGATAGAGACTGG - Intronic
964429853 3:156593969-156593991 GTGTGGTAGGGGGAAGGGAAGGG + Intergenic
964830909 3:160883690-160883712 AGAAGTTAGGGGAAAGAGACTGG + Intronic
964833313 3:160910202-160910224 AAGGGGAAGGGGAAAGGGACAGG - Intronic
965285757 3:166817718-166817740 ATGTAGTAGTGGAAGGAGAGAGG - Intergenic
965635231 3:170773913-170773935 ATGTAGTGGGGGAAAGAGGTTGG + Intronic
967298064 3:187985020-187985042 CTGGGGTAGGGGATAGGGACAGG - Intergenic
968530199 4:1087212-1087234 ATGGGGTAGGGGAGAGAGGACGG + Intronic
968891993 4:3374369-3374391 AGGTGGTGGCGGAAGGAGACCGG - Intronic
969625643 4:8304021-8304043 ATCTGGTAGGGGACACAGAGTGG + Intronic
972211697 4:36846336-36846358 ATATGGTTGGGGAAAGAGTGTGG - Intergenic
972664701 4:41153483-41153505 AGATAGTAGGGGAAAGAGAAGGG - Intronic
973117137 4:46475854-46475876 TTGTAGTAGGGGAGAGAGATTGG - Intergenic
975429956 4:74277484-74277506 AAGTGGCAGGGGAAAGAGCTGGG + Intronic
975571769 4:75825261-75825283 AGGTGGGATGGGAGAGAGACAGG + Intergenic
975613162 4:76221154-76221176 TTGTGGCAGGGGAAGGGGACAGG + Intronic
977171117 4:93763766-93763788 ATGGGGGAGGAGAAACAGACGGG + Intronic
977481509 4:97583593-97583615 ATTTGGTTGGAGAAAAAGACAGG + Intronic
977580231 4:98716873-98716895 ATTTGGTAGGGAAAAAAGGCTGG + Intergenic
978525750 4:109663474-109663496 TTGTGGAAGGGGAGAGAGGCAGG - Intronic
978885916 4:113766266-113766288 TTGCAGTAGGGGAAAGAGATTGG + Intergenic
979892792 4:126120969-126120991 ATGAGGTAGAGGAAAGAGTAAGG + Intergenic
979932832 4:126653629-126653651 ATGTGGTCAGGGATAGACACTGG - Intergenic
980518762 4:133902479-133902501 ATGGGGTAGGGGAAAGGGAGAGG + Intergenic
981215233 4:142157871-142157893 ATGTGCTAAGAGAAAAAGACGGG - Intronic
982734640 4:158992872-158992894 ATGTGCTAGGAGTAAGAGGCGGG - Intronic
983067384 4:163227165-163227187 AACTGGTAAGGGAAAGACACTGG + Intergenic
984637979 4:182134416-182134438 CTGAGTTAGGGGAAAGAGAAGGG - Intergenic
987785724 5:22496070-22496092 ATGTTGTAGGTGAAAGAAATGGG + Intronic
988329112 5:29811995-29812017 ATCTGGAAGGGGAAAGAAAGAGG - Intergenic
988358639 5:30207766-30207788 AGGTGGTTAAGGAAAGAGACTGG + Intergenic
989124266 5:38036146-38036168 ATATGGAAGGGAAGAGAGACTGG - Intergenic
990881414 5:60543207-60543229 ATGTGGAAGAGGAAGGACACTGG - Intergenic
990962940 5:61414036-61414058 ATGGGGTAGGAGAAATGGACAGG + Intronic
991106126 5:62843998-62844020 ATGTGGTTTGGCAAAGAGAAGGG - Intergenic
991229146 5:64310765-64310787 ATCTGGAAGGGGAAAGAGTGTGG + Intronic
991642647 5:68770178-68770200 ATGTGGCAGGGGAAGGAGGGAGG - Intergenic
992532694 5:77667510-77667532 AAGTAGTTGGGGAAGGAGACTGG - Intergenic
992664552 5:78994348-78994370 AAGAGGTAAGGGTAAGAGACAGG - Intergenic
992775941 5:80089433-80089455 ATGTAGTAGGGAGAAGAGAGAGG - Intergenic
993890527 5:93466808-93466830 ATGTAGGAGGTGAAAGAGAATGG - Intergenic
994219615 5:97180815-97180837 ATGTGGAAGGGTAAAGGGAACGG + Intronic
994675321 5:102814023-102814045 CTGTGGTAGGGGCAGGAGACTGG + Intronic
996341025 5:122439079-122439101 ATTAGGTAGGGGAAAAACACTGG - Intronic
996418317 5:123234001-123234023 AAGGGGAAGGGGAAAGAGAAAGG - Intergenic
996500125 5:124207496-124207518 ATGAGGTAGGGAAGATAGACCGG + Intergenic
996522274 5:124440429-124440451 TTGTAGTAGGGGAGAGAGATTGG + Intergenic
997243399 5:132325182-132325204 ATCTGGTTGGAGAAAGATACTGG + Intronic
997497433 5:134341734-134341756 ATGTGGTTTGGCAAAGAGAAGGG - Intronic
997858315 5:137392945-137392967 ATGTGTTAGGAGAAAGAGGCTGG - Intronic
998872002 5:146561695-146561717 GCGTGGTAGGATAAAGAGACCGG + Intergenic
998911955 5:146969536-146969558 CTGTGGTATAGGAAAGAGAGAGG + Intronic
998990273 5:147807717-147807739 GAGTGCTTGGGGAAAGAGACTGG + Intergenic
999394028 5:151215130-151215152 ATGGGGGTGGGGAAAGAGACAGG + Intronic
999652670 5:153782972-153782994 AGGTGGTAGTGGAAAGGGAGAGG + Intronic
999991911 5:157057815-157057837 ATGGGGTAGGGGAAGGGGAGGGG - Intronic
1000243118 5:159426837-159426859 AGGTTGTAGGGGAAAGAGGATGG - Intergenic
1001054340 5:168436701-168436723 ATGGGGTGAGGGAAAGAGAGGGG - Intronic
1002074010 5:176697460-176697482 AGGTGGTAGGGGAATGGGAAAGG + Intergenic
1003020948 6:2509032-2509054 ATGTGGGAGGCCAAAGAGAGAGG - Intergenic
1003453623 6:6260872-6260894 GGGTGGTAAGGGAGAGAGACTGG + Intronic
1004121379 6:12825666-12825688 ATGTGGTAGAGGCAAATGACTGG - Intronic
1004490493 6:16110387-16110409 ATGTGATGGGGGAAAAAGAGGGG + Intergenic
1004757128 6:18622621-18622643 TTTTGGTAGGGGAAGTAGACAGG + Intergenic
1005526243 6:26652878-26652900 ATGTGTCAGGGTAAAGAGAGTGG + Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006724760 6:36189887-36189909 ATGTGATTGGGGGAAGAGGCAGG + Intergenic
1007492110 6:42231210-42231232 TTGTGGAAGGGCAAAGAGAGGGG - Intronic
1008137215 6:47790827-47790849 GTTTGGGAGGGGAAAGAGAGAGG - Intronic
1008187919 6:48417486-48417508 GTGTGGTAAGCGAAAGGGACAGG + Intergenic
1009689578 6:67010927-67010949 ATGTGGTATGGAAAATAGACTGG - Intergenic
1011084466 6:83523789-83523811 ATCTGTTAGGAGAAAGAGACAGG + Exonic
1011214290 6:84988482-84988504 CTGTGGTACCTGAAAGAGACAGG + Intergenic
1011975060 6:93285715-93285737 ATGTGGCAAGAGAAGGAGACAGG - Intronic
1013029596 6:106320268-106320290 ATGGGGCAGGGGAAAGAGGAGGG + Intronic
1013373532 6:109491454-109491476 AAGTGGTAGGGGTAAGAGCAAGG + Intergenic
1013765992 6:113574924-113574946 ATGTGGTTGCAGAAAGAGAAAGG - Intergenic
1014061962 6:117082029-117082051 ATGGGGTAGGGGAAGGGGAGAGG + Intergenic
1014452777 6:121600554-121600576 ATGTGGCAAGGGTAAGAGATGGG + Intergenic
1015437677 6:133208410-133208432 AATTGGAAGGGGAAAGAGGCAGG - Intergenic
1015705551 6:136083808-136083830 ATGTGGGAGGAGAGAGAGAGAGG - Intronic
1016583920 6:145662546-145662568 TTGTGGTGGAGGAGAGAGACTGG + Intronic
1017571118 6:155745440-155745462 ATGTGGTAGGGGGAGGGGAGTGG + Intergenic
1017634438 6:156430317-156430339 TAGAGGAAGGGGAAAGAGACAGG + Intergenic
1017675617 6:156810790-156810812 ATGTGGGAGGGGCAAGAGTGAGG + Intronic
1018832323 6:167452683-167452705 ATGGGGTATGTGAAAGGGACTGG + Intergenic
1019358483 7:593160-593182 AAGCGGTGGAGGAAAGAGACGGG + Intronic
1019675269 7:2307822-2307844 CTGGGGTAGTGGGAAGAGACCGG - Intronic
1019752251 7:2738632-2738654 ATGGGGGATGGGACAGAGACAGG + Intronic
1020011486 7:4807986-4808008 AGGAGGGAGGGGAGAGAGACAGG - Intronic
1021105062 7:16628685-16628707 GGGTGGTAGGGGAAGGACACAGG + Intronic
1022841067 7:34164290-34164312 GTGTAGTGGGGGAAAGAGAAGGG - Intergenic
1024042662 7:45567324-45567346 ATGGGGTGGGGGAAACAGAAAGG + Intergenic
1024204646 7:47146638-47146660 ATGTGATAGGGTATAGAGATCGG + Intergenic
1025057161 7:55774514-55774536 ATGGGGGAGGGGAAAGCCACGGG + Intergenic
1026792226 7:73341608-73341630 TTGCGGTAGGGGAAACAGAAAGG - Intronic
1027744598 7:82057441-82057463 ATGTGTTGGGGGAAAGGGGCAGG + Intronic
1028898226 7:96065689-96065711 CTGTGGGAGAGGAAAGAGCCGGG - Intronic
1030561763 7:111095888-111095910 ATGGGGTAGGGGAGGGAGAGAGG - Intronic
1030935032 7:115575103-115575125 ATGTGGTAGGTGGAGGAGAGGGG + Intergenic
1031010301 7:116519699-116519721 ATGGGGTAGGGGAAAGTTCCAGG - Intergenic
1031912736 7:127534617-127534639 ATGAGGTCGGGGAAAGAGAAAGG + Intergenic
1032094249 7:128929653-128929675 AGGAGGTATGGGCAAGAGACAGG + Intergenic
1032425445 7:131819005-131819027 ATGGGGCAGGGGAAAGAGAAAGG + Intergenic
1032463456 7:132128520-132128542 ATGAGCAAGGGGAAAGAGAAGGG + Exonic
1033076361 7:138253825-138253847 AGGTGGCTGGGGAAAGAGGCTGG - Intergenic
1033422224 7:141213909-141213931 ATCTTGTAGGGGAAACAGCCCGG - Intronic
1033839561 7:145357358-145357380 GGGTGGTAGGGGAGAGAGAGGGG + Intergenic
1034076165 7:148233289-148233311 ATGTGGTTGGGAAGAGAGAAAGG - Intronic
1034086304 7:148325871-148325893 GCGTGGAAGGGGAAAGAGAGAGG + Intronic
1035555276 8:562986-563008 TTGCAGTAGGGGAGAGAGACTGG + Intergenic
1035911147 8:3567525-3567547 ATGGGGGAGGGGAAAGAGAAAGG + Intronic
1036037314 8:5032944-5032966 ATGTGTAGAGGGAAAGAGACGGG + Intergenic
1036151643 8:6304758-6304780 TTGCAGTAGGGGAGAGAGACGGG + Intergenic
1036534573 8:9634609-9634631 ATGTGGAAGGGGGAAGACAGAGG + Intronic
1036546829 8:9779401-9779423 ATGTGGTTAGGGAAACAGAGGGG - Exonic
1037222073 8:16536271-16536293 ATCTGGTAGGAGATAGAGTCAGG + Intronic
1037253069 8:16919789-16919811 ATGTGGCTGGAGAAAGACACTGG - Intergenic
1038447109 8:27611801-27611823 ATGGGGTAGGGGGCGGAGACCGG + Intronic
1038548028 8:28441159-28441181 ATTAGGTAGGGGAGAGAGGCGGG - Intronic
1038708531 8:29919957-29919979 ATGTGGTAAGTTAAAGAGGCTGG + Intergenic
1038720550 8:30031661-30031683 ATTTGCATGGGGAAAGAGACTGG - Intergenic
1038939108 8:32284383-32284405 TTATGGTAGGGGAAAGAGATTGG - Intronic
1040672156 8:49704587-49704609 TTGTAGGAGGGGAAAGAGATTGG - Intergenic
1040815735 8:51506857-51506879 ATGAGGGAGGGGAAAGTCACAGG - Intronic
1040886845 8:52272896-52272918 ATCTGGGAGGGGAAAGAAATGGG + Intronic
1041889907 8:62857462-62857484 TTGGGGTACGTGAAAGAGACAGG - Intronic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1045053052 8:98344109-98344131 ATGTGATTTTGGAAAGAGACTGG + Intergenic
1045858200 8:106788886-106788908 ATGTGGTAGTGGACAGATAAGGG + Intergenic
1045999595 8:108403381-108403403 ATCTAGTAAGGGAAACAGACAGG - Intronic
1046305147 8:112356502-112356524 ACTTGGTAGGGGAAAGAAAGAGG + Intronic
1047255805 8:123212684-123212706 ACGTGCCAGGGGAAAGAGAATGG + Intergenic
1047431536 8:124797527-124797549 GTGTGGTTGGGGAAAAAGAGGGG - Intergenic
1047533661 8:125699579-125699601 ATGTGACAGTGGAAAGACACTGG - Intergenic
1047694607 8:127391098-127391120 GTGTGTCAGGGGAAAGGGACCGG + Intergenic
1047959456 8:130000222-130000244 GTGGGGTAAGGGATAGAGACGGG + Intronic
1048383122 8:133885863-133885885 AGGAGGGAGGGGAAAGAGAGAGG + Intergenic
1049984488 9:936030-936052 ATGAGGTAGTGGGTAGAGACAGG - Intronic
1051276251 9:15401733-15401755 GTGTGTTACGGGAAAGACACAGG - Intergenic
1051859104 9:21604154-21604176 ATGTAGTAGAGGTCAGAGACTGG + Intergenic
1052135055 9:24898847-24898869 ATGTGGTAGGGGCAGGAGCAAGG + Intergenic
1053163205 9:35827936-35827958 GTGAGGAAGGGGAAAGAGAAGGG + Intronic
1055152653 9:73021146-73021168 TTGTGGTAGGGGAAATTGAGTGG + Intronic
1055287515 9:74745076-74745098 ATGTATTAGGAGAGAGAGACAGG + Intronic
1055726356 9:79233770-79233792 ATGTGGTGGGGGCAGGAGAAGGG + Intergenic
1057705245 9:97391107-97391129 ATTTGGAAGGGGACACAGACGGG + Intergenic
1057826047 9:98372546-98372568 ATGTGGTAGGGGAAAAAGAGAGG + Intronic
1059721765 9:116966785-116966807 ATGGGGAAGGGGAAAGAGTGTGG - Intronic
1059731944 9:117065539-117065561 TTCTGGTAGGGGAGAGAGACAGG - Intronic
1061087328 9:128406793-128406815 ATGTGGAGAGGGAAAGAGAGAGG - Intergenic
1062333690 9:136055736-136055758 ACGTGGTAGAGGAAGGAGAGAGG + Intronic
1186221522 X:7354323-7354345 TTGTAGTAGGGGAGAGAGACTGG - Exonic
1186501782 X:10056639-10056661 ATGTGCTGGGTGAAAGAGGCCGG - Intronic
1187260775 X:17683392-17683414 ATGGGGTAGGGGAGTGAGAATGG - Intronic
1187486288 X:19707343-19707365 ATGTGGTAGAGAAAAAAGAATGG + Intronic
1188083416 X:25874188-25874210 AAGAGGTATGGGAAAGGGACAGG + Intergenic
1190558646 X:51664858-51664880 ATGGGGGAGGGGAAAGATATTGG + Intergenic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190954060 X:55174066-55174088 ATGTTGTAAGAGAAAGTGACTGG + Intronic
1192321859 X:70096263-70096285 ATGTGCCAGGTGAAGGAGACTGG - Intergenic
1194600098 X:95910005-95910027 TTGCGGTAGGGGAGAGAGATTGG - Intergenic
1194849147 X:98851390-98851412 AGGTGGCTGGGGAAAGAGGCTGG + Intergenic
1196872400 X:120125442-120125464 ATGTGGAACTGGAAGGAGACAGG + Intergenic
1197214088 X:123851904-123851926 TTGCAGTAGGGGAGAGAGACTGG + Intergenic
1197866886 X:131028543-131028565 ATGTTATAGGAGAAAGAGCCTGG + Intergenic
1199688076 X:150281953-150281975 ATGTGGTTGGGGAAGAAGGCAGG - Intergenic
1201959693 Y:19665927-19665949 TTGGGGTATGCGAAAGAGACAGG + Intergenic