ID: 928964992

View in Genome Browser
Species Human (GRCh38)
Location 2:36966852-36966874
Sequence CCTCGCACGCGGAAGTTCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 24}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928964980_928964992 20 Left 928964980 2:36966809-36966831 CCTCTGGGGCCGGCTGGGCGCGG 0: 1
1: 0
2: 2
3: 29
4: 277
Right 928964992 2:36966852-36966874 CCTCGCACGCGGAAGTTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 24
928964986_928964992 11 Left 928964986 2:36966818-36966840 CCGGCTGGGCGCGGGCGGGCGGG 0: 1
1: 1
2: 3
3: 57
4: 414
Right 928964992 2:36966852-36966874 CCTCGCACGCGGAAGTTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928964992 Original CRISPR CCTCGCACGCGGAAGTTCGC GGG Intergenic
903326611 1:22572502-22572524 CCCAGCATGCGGAAGTTCCCGGG - Intronic
913662921 1:121020749-121020771 CCTCACACGCGAAAGGTCCCCGG - Intergenic
914014305 1:143804014-143804036 CCTCACACGCGAAAGGTCCCCGG - Intergenic
914163518 1:145157187-145157209 CCTCACACGCGAAAGGTCCCCGG + Intergenic
914652926 1:149712572-149712594 CCTCACACGCGAAAGGTCCCCGG - Intergenic
916101854 1:161399720-161399742 CCTCACACGCGAAAGGTCCCCGG - Intergenic
920043014 1:203116156-203116178 CCTGGCAGGTGGAAGTTGGCGGG + Intronic
1075085193 10:119410036-119410058 CCGCGCACGCGGGGGCTCGCGGG - Intronic
1106283069 13:28294633-28294655 CCTTGCACAGGGAAGTTTGCTGG - Intronic
1123021742 14:105401113-105401135 CCTGGCAGGCGGAAGTGTGCAGG - Intronic
1148132496 17:45270537-45270559 CCTCACAGGCGGAGGCTCGCTGG + Exonic
1161521263 19:4724655-4724677 CCTCACACGCGAAAGGTCCCCGG - Intronic
1161613735 19:5258016-5258038 CCTCGCACGTAGAGGTTGGCAGG + Exonic
928964992 2:36966852-36966874 CCTCGCACGCGGAAGTTCGCGGG + Intergenic
942464105 2:176189501-176189523 CCTCCCCCGCGGAAATGCGCTGG + Intronic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1002696675 5:181097100-181097122 CCTCACACGCGAAAGGTCCCCGG + Intergenic
1002697947 5:181102273-181102295 CCTCACACGCGAAAGGTCCCCGG - Intergenic
1002707656 5:181173680-181173702 CCTCACACGCGAAAGGTCCCCGG + Intergenic
1002715112 5:181222415-181222437 CCTCACACGCGAAAGGTCCCCGG - Intergenic
1005514074 6:26538084-26538106 CCTCACACGCGAAAGGTCCCCGG + Intergenic
1005577797 6:27206108-27206130 CCTCACACGCGAAAGGTCCCCGG - Intergenic
1005586397 6:27280290-27280312 CCTCACACGCGAAAGGTCCCCGG - Intergenic
1019720729 7:2569024-2569046 CCTCTCACGCCGACGTTCCCTGG + Intronic
1050091011 9:2016489-2016511 CCTAGCACCCGGACGATCGCAGG - Intronic