ID: 928973421

View in Genome Browser
Species Human (GRCh38)
Location 2:37056848-37056870
Sequence TGTTCACGCAATAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 48}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928973421_928973425 16 Left 928973421 2:37056848-37056870 CCACCCACCTTATTGCGTGAACA 0: 1
1: 0
2: 1
3: 3
4: 48
Right 928973425 2:37056887-37056909 AATCCCACAATTATTTTAAATGG 0: 1
1: 0
2: 1
3: 40
4: 489
928973421_928973427 18 Left 928973421 2:37056848-37056870 CCACCCACCTTATTGCGTGAACA 0: 1
1: 0
2: 1
3: 3
4: 48
Right 928973427 2:37056889-37056911 TCCCACAATTATTTTAAATGGGG 0: 1
1: 0
2: 2
3: 27
4: 283
928973421_928973426 17 Left 928973421 2:37056848-37056870 CCACCCACCTTATTGCGTGAACA 0: 1
1: 0
2: 1
3: 3
4: 48
Right 928973426 2:37056888-37056910 ATCCCACAATTATTTTAAATGGG 0: 1
1: 0
2: 1
3: 30
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928973421 Original CRISPR TGTTCACGCAATAAGGTGGG TGG (reversed) Intronic
902789138 1:18753553-18753575 TTTTCATGCATTAAGATGGGTGG - Intergenic
908515343 1:64886655-64886677 TGTTCACACAATCAGGAGAGGGG - Intronic
912433228 1:109640720-109640742 TGGTCACGAGATAATGTGGGTGG - Intergenic
918459960 1:184766226-184766248 TGTTTAGGCAACAAGGTGGTAGG - Intergenic
1073283963 10:102376084-102376106 TGTTGACCAAATAAGGTGGCAGG - Intronic
1084203343 11:67576796-67576818 TGTTCAAGGAGGAAGGTGGGGGG + Intergenic
1088331704 11:108661039-108661061 TGTTTAAGCAAAAAAGTGGGAGG + Intergenic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1095836572 12:46646018-46646040 CGTGCAAGCAAGAAGGTGGGGGG - Intergenic
1108070897 13:46627616-46627638 TGTGCATGCACTAAGGTAGGTGG - Intronic
1110477889 13:75939324-75939346 TCTTCAGGTAATAAGGTGGAAGG + Intergenic
1111186290 13:84740466-84740488 TGCTCAAGCAAAAAGGTGGCTGG - Intergenic
1118051203 14:62030061-62030083 TCTTCATGGAAGAAGGTGGGAGG - Intronic
1119684651 14:76622000-76622022 TGTTCAAGCAATAGGGTCAGGGG + Intergenic
1119697515 14:76725435-76725457 AGTTCCTGCATTAAGGTGGGAGG - Intergenic
1124702849 15:31931835-31931857 TGATAACACAATAAGGTGGCTGG - Intergenic
1131961645 15:97795622-97795644 TTTTCACGCAATAAGGTGTGAGG - Intergenic
1141797581 16:86285572-86285594 TGTCCACCCAGGAAGGTGGGTGG - Intergenic
1142863800 17:2778439-2778461 TGTTGAGGCAATTTGGTGGGAGG + Intronic
1157813884 18:50717331-50717353 TGATCAAGCAAGGAGGTGGGTGG - Intronic
1159926743 18:74276315-74276337 TGTTCAGAAAAAAAGGTGGGGGG - Intronic
1162016887 19:7851005-7851027 AGGTCACGTAACAAGGTGGGGGG + Intronic
1165618256 19:37221470-37221492 TATTCAGGGGATAAGGTGGGAGG + Intronic
925367493 2:3320463-3320485 TCTTCTTGCACTAAGGTGGGAGG + Intronic
925509518 2:4609694-4609716 TGTTCAAGCAAAAAGCTGGGTGG + Intergenic
928973421 2:37056848-37056870 TGTTCACGCAATAAGGTGGGTGG - Intronic
936228724 2:110680926-110680948 TGTTCACGCTAGAAGGAGGTTGG + Intergenic
940823826 2:158387649-158387671 GGCTCACGCAATGGGGTGGGGGG - Intronic
941245208 2:163087494-163087516 TGTTCATGCAAGAAGGTGCACGG + Intergenic
941404144 2:165068435-165068457 TGTTCATGAAATAAGGTTTGGGG - Intergenic
1172641907 20:36445541-36445563 TGTTCACCCAATTTGGAGGGTGG - Intronic
1173422867 20:42918193-42918215 TGTTCATGCAACACAGTGGGTGG + Intronic
1177767748 21:25477342-25477364 TATTGACAGAATAAGGTGGGAGG + Intergenic
1178576772 21:33799784-33799806 TGTTTACAAAAAAAGGTGGGGGG - Intronic
957307043 3:78470557-78470579 TGTTAACACAAAAAGGTGGAGGG - Intergenic
962305802 3:134284688-134284710 TGTCCACTCAATTAGGTGGTAGG + Intergenic
963344573 3:144079264-144079286 AGTTCAAGCACTTAGGTGGGTGG - Intergenic
965811041 3:172592121-172592143 TGTTCAGCCAGTGAGGTGGGTGG + Intergenic
969242230 4:5907034-5907056 TGCTCATGCATTAAGCTGGGGGG + Intronic
969683017 4:8653580-8653602 TGATCCCGCAATGAGGTGGCGGG - Intergenic
990709746 5:58567009-58567031 TGTTCAGGAAATAAGGTGGATGG - Intergenic
998592739 5:143495300-143495322 GGTTTACGCAATAACTTGGGTGG + Intergenic
1000057839 5:157623829-157623851 TGTTAACACAAAAAGTTGGGGGG + Intergenic
1004072751 6:12316340-12316362 TGTGCACGGTATAAGGCGGGGGG + Intergenic
1006807643 6:36798978-36799000 TGGTCACTCAAGAAGGAGGGAGG + Intronic
1012676921 6:102126666-102126688 TGTTTACACAGTATGGTGGGAGG - Intergenic
1019351432 7:555921-555943 TGGTCATGCATTGAGGTGGGGGG - Intronic
1032719844 7:134542003-134542025 TGTTAACATTATAAGGTGGGCGG - Intergenic
1046138941 8:110064188-110064210 TGTTCTTGCAATAAGGCAGGGGG + Intergenic
1050498848 9:6272902-6272924 GGATCACTTAATAAGGTGGGAGG - Intergenic
1051887143 9:21905117-21905139 TGTCCTTGCAATAAGGTGGAGGG - Intronic
1199545531 X:149004312-149004334 TGTTCCCGCAGAAAGGTGGGTGG - Intergenic
1201610187 Y:15833937-15833959 TCTTGAAGCAAGAAGGTGGGTGG + Intergenic