ID: 928975364

View in Genome Browser
Species Human (GRCh38)
Location 2:37081528-37081550
Sequence CAGGACCCCCTAAGAGATCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928975361_928975364 15 Left 928975361 2:37081490-37081512 CCAACAGGGAAAGCTGCAAAATG 0: 1
1: 1
2: 2
3: 26
4: 259
Right 928975364 2:37081528-37081550 CAGGACCCCCTAAGAGATCACGG 0: 1
1: 0
2: 0
3: 3
4: 74
928975359_928975364 25 Left 928975359 2:37081480-37081502 CCAACTGTTCCCAACAGGGAAAG 0: 1
1: 0
2: 0
3: 22
4: 191
Right 928975364 2:37081528-37081550 CAGGACCCCCTAAGAGATCACGG 0: 1
1: 0
2: 0
3: 3
4: 74
928975360_928975364 16 Left 928975360 2:37081489-37081511 CCCAACAGGGAAAGCTGCAAAAT 0: 1
1: 1
2: 4
3: 26
4: 243
Right 928975364 2:37081528-37081550 CAGGACCCCCTAAGAGATCACGG 0: 1
1: 0
2: 0
3: 3
4: 74
928975363_928975364 -9 Left 928975363 2:37081514-37081536 CCTAACTTACAACACAGGACCCC 0: 1
1: 0
2: 0
3: 6
4: 104
Right 928975364 2:37081528-37081550 CAGGACCCCCTAAGAGATCACGG 0: 1
1: 0
2: 0
3: 3
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928975364 Original CRISPR CAGGACCCCCTAAGAGATCA CGG Intronic
900681247 1:3917962-3917984 CAGGACCTCGTCAGAGACCAGGG - Intergenic
905117832 1:35657934-35657956 CAGGAGGCCCTGAGAGAGCAAGG - Intergenic
906073908 1:43037795-43037817 CAGGACCCCCTGAGAGATGGAGG - Intergenic
907303009 1:53500009-53500031 CAGGACACCCTGAGAGAAGAAGG - Intergenic
911584020 1:99669487-99669509 CAGGACTCCTTCAGAGATAAGGG - Intronic
918388635 1:184036532-184036554 CAGGTCCCCCTAGGAGAGCTAGG + Intronic
1065072026 10:22035043-22035065 CAGGATTTCTTAAGAGATCAGGG + Intergenic
1068116641 10:52743644-52743666 CAGGATGCCCTGAGAGAGCAAGG + Intergenic
1078054220 11:7994210-7994232 AAGGCCCCCCTTACAGATCAAGG + Intronic
1081873652 11:46394584-46394606 CAGGACCCACTATCAGACCAAGG + Intergenic
1083082838 11:60111532-60111554 CAGGACCGGATAAGAGAGCATGG + Intergenic
1084384894 11:68837422-68837444 CAGGACCCCCTGAGTGAGCCAGG + Intronic
1087892208 11:103548145-103548167 CAGGAAGCCCTGAGAGATGAAGG - Intergenic
1092797957 12:12132439-12132461 CAGGAACGCCTAAGGGTTCATGG - Intronic
1104881672 12:132075771-132075793 CAGGACCCAGCAAGAGACCAGGG + Intronic
1114137532 14:19868813-19868835 CAGCACCCCCTAAGAGATGTAGG + Intergenic
1114686331 14:24535209-24535231 CAGCATCCCCCATGAGATCAGGG - Intergenic
1118364284 14:65081172-65081194 CAGGGCACCCTAAGTGACCAGGG - Intronic
1118684030 14:68273028-68273050 CAGGACCCCACAGGACATCATGG - Intronic
1118822277 14:69353275-69353297 CAGGAGCCCCTAAGTCATTAGGG + Intronic
1122301327 14:100732809-100732831 CAGGGCCGCCAAAGAGATAATGG - Intronic
1123449459 15:20350901-20350923 CAGGACCTGCTGAAAGATCAGGG + Intergenic
1132285025 15:100656680-100656702 CAGGAGCCCCTCAAAGATGAGGG + Intergenic
1132901199 16:2255443-2255465 CAGGAGCCCTTCAGAGCTCATGG - Intronic
1135815272 16:25626942-25626964 CAGGATCTCCTAAGCTATCATGG + Intergenic
1138213880 16:55186149-55186171 TGGGAACCCCTAAGAGAGCAAGG - Intergenic
1141504473 16:84465518-84465540 CTGGAACCACTAAGAGGTCAAGG + Intergenic
1142623116 17:1177473-1177495 CAGAACCCCCTAAGAGGCCTTGG + Intronic
1145247733 17:21280543-21280565 AAGGACCCACAAAGAGATCCGGG - Intergenic
1152339175 17:79714985-79715007 CAGGACCTGCCAAAAGATCAGGG - Intergenic
1155356700 18:24960450-24960472 CAGAACTTCCTTAGAGATCAGGG - Intergenic
1156112255 18:33743001-33743023 CAGGACCCTCGCAGATATCAAGG + Exonic
1163761167 19:19137597-19137619 CAGGACGCCGTAGGAGATGAAGG - Intronic
1166021026 19:40029695-40029717 CAGGACTCCCTAAGATAAGAGGG + Exonic
928975364 2:37081528-37081550 CAGGACCCCCTAAGAGATCACGG + Intronic
933296680 2:80498779-80498801 CAGCACCCCCAAATATATCAGGG - Intronic
939698626 2:145360596-145360618 GAGGACAATCTAAGAGATCAAGG - Intergenic
944917547 2:204376599-204376621 CATGACTCTCTAAGATATCAAGG + Intergenic
945818794 2:214637508-214637530 CAGGATGCACTAAGAGATAAAGG - Intergenic
947871702 2:233442205-233442227 CAGGTCCCCCTCATACATCATGG - Intronic
948575513 2:238947125-238947147 CAGGCCCCCCCAAGAGTGCAGGG + Intergenic
1170883738 20:20319823-20319845 CAGAACCCCCTAGGGAATCATGG + Intronic
1171305725 20:24104196-24104218 CAGGACCCCCCATGAGCTCCAGG - Intergenic
1172667757 20:36612663-36612685 CTGGATCCGCTAAGGGATCAGGG - Exonic
1173893235 20:46529753-46529775 CAGCAGCCCCCAGGAGATCAAGG + Intergenic
1176197612 20:63844611-63844633 CAGGACCCCCCAAGGGAGGAGGG - Intergenic
1183070176 22:35390694-35390716 CAAGAACCCCTCAGAAATCATGG + Intronic
1185018507 22:48359467-48359489 CAGGACTCCCTTGGAGATGAGGG + Intergenic
951332550 3:21384026-21384048 TAGGACCTCCTAAGAGGTGATGG + Intergenic
952905344 3:38136463-38136485 CAGGACCCCTTCAAAGGTCAAGG + Intronic
953788504 3:45929118-45929140 GAGGTCCCCCAAAGAGACCATGG - Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
956792297 3:72689518-72689540 CAGAACGCTCTGAGAGATCAAGG + Intergenic
961643276 3:128378629-128378651 TAGGAGCCCCTGAGAGTTCATGG + Intronic
961893164 3:130147054-130147076 AAGGACCCCCAAAGAGCCCATGG - Intergenic
969494334 4:7517606-7517628 CAGGACCCCCTAAGAGTAAACGG + Intronic
973168474 4:47108818-47108840 CAGGACACCAAAACAGATCATGG + Intronic
974100719 4:57412883-57412905 CAGGACTGCCTAAGAAATCTTGG - Intergenic
992459910 5:76951426-76951448 CCAGACCCCCTAAGAGGTAAAGG + Intergenic
993505038 5:88698650-88698672 CAGGAACCACCAAGAGGTCAGGG + Intergenic
995036866 5:107544052-107544074 CAGGACCCCCACAGATATAATGG - Intronic
997035289 5:130183572-130183594 CATAACCCCATAACAGATCACGG - Intronic
999302237 5:150498501-150498523 CAGGACCAGCTTAGAGAGCAGGG + Intronic
1013776608 6:113685642-113685664 CAGTACCCCACAAGTGATCATGG + Intergenic
1014803044 6:125798209-125798231 CAGTAGCCTCTCAGAGATCATGG - Intronic
1017244551 6:152208340-152208362 CAAAACCCAGTAAGAGATCATGG - Intronic
1022056555 7:26741453-26741475 GAGGATCCCCCAAGAGGTCAAGG + Intronic
1032263696 7:130355952-130355974 ATGGACCCCCTCAGAGGTCAAGG - Intronic
1032994633 7:137431603-137431625 CAGGAACTCCTTAGAGAGCAGGG + Intronic
1040549488 8:48427526-48427548 CAGGAGCCCCTCAGAGGACAGGG - Intergenic
1057872363 9:98727935-98727957 CAGAACCCCGTAAGAGTTCCAGG - Intergenic
1059015992 9:110516587-110516609 CAGGATCCTCAAAGAGATAAAGG + Intronic
1060545438 9:124456520-124456542 CAGGACCACCTCCCAGATCATGG + Intronic
1186199685 X:7144558-7144580 CAGGAGACCCTAAAAGGTCATGG - Intronic
1198260100 X:134958201-134958223 ATGGACTCCCTAAGAGTTCATGG - Intergenic
1198739095 X:139821713-139821735 CATGAGCTCTTAAGAGATCATGG + Intronic
1199471215 X:148198412-148198434 CAAGACCCCCTCAAAGATCCTGG + Intergenic
1199802710 X:151267386-151267408 CAGGAGCGCCTCAGAGGTCATGG + Intergenic