ID: 928979762

View in Genome Browser
Species Human (GRCh38)
Location 2:37125559-37125581
Sequence CTCCACATGGCCTCCCTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 9, 3: 41, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928979762_928979769 22 Left 928979762 2:37125559-37125581 CCCCATAGGGAGGCCATGTGGAG 0: 1
1: 0
2: 9
3: 41
4: 273
Right 928979769 2:37125604-37125626 CTGAACTTCCAGCCCACAGCCGG 0: 1
1: 0
2: 2
3: 29
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928979762 Original CRISPR CTCCACATGGCCTCCCTATG GGG (reversed) Intronic
900101266 1:963090-963112 CTCCACCTGCCCTCCCCAGGCGG + Exonic
900530992 1:3153128-3153150 CCCCACCTGGCCTCCCTGTTTGG + Intronic
900982477 1:6054173-6054195 CACCACATGGCCTTCTTATAAGG - Intronic
901053040 1:6435254-6435276 CTCTTCCTGGCCTCCCTCTGGGG + Intronic
901070144 1:6512881-6512903 CCCCCCATGGCCACCCTGTGAGG - Intronic
901450308 1:9332588-9332610 CTCCACAGGACCTCCCTCCGTGG - Intronic
902078706 1:13806488-13806510 CTCCTGCTGTCCTCCCTATGTGG + Intronic
902481198 1:16712795-16712817 CTCTTCCTGGCCTCCCTCTGGGG - Intergenic
903215150 1:21839601-21839623 CTCACCATGGCCACCCTCTGCGG - Intronic
903771975 1:25769897-25769919 ATCCCCGTGGCCACCCTATGGGG + Intronic
904325340 1:29724322-29724344 CCTCTCATGGCCTCCCTCTGGGG + Intergenic
904341227 1:29836203-29836225 CTCCCCATGGCCTTCCCATTAGG - Intergenic
904720361 1:32503154-32503176 CTCTACATGGCCTCTCCTTGTGG - Intronic
904796009 1:33057007-33057029 CTAAACGTGGCCTCCCCATGTGG + Intronic
904971763 1:34424655-34424677 TTCCATATGGCCACTCTATGTGG - Intergenic
905664882 1:39757114-39757136 CTACACATGGCATCCCTCAGAGG - Intronic
906171044 1:43725515-43725537 CTGCACTTGGCCTCCCTGTATGG - Intronic
906547300 1:46628862-46628884 CTCCACATGGCCCCCCTGCAAGG - Intergenic
906634834 1:47402464-47402486 CTGCCCATGGCCTCCCTCTGGGG + Intergenic
907284762 1:53372544-53372566 CTCCACACGGCCTCATTTTGGGG + Intergenic
908259108 1:62325901-62325923 CTACACATGGCCTGTCTGTGTGG + Intergenic
909100393 1:71341734-71341756 CTGCACAAGGCCTCACTCTGTGG - Intergenic
910441122 1:87253007-87253029 CTCCACATGGCCTCTCCACATGG - Intergenic
910465185 1:87491499-87491521 CTACACATGGCCTCTCTAGTAGG + Intergenic
911061325 1:93750707-93750729 CTACACGTGGCCTCCCTGTGTGG - Intronic
911948062 1:104137049-104137071 CTCCATAGGGCCTCACTCTGTGG + Intergenic
914360016 1:146926570-146926592 CTACACATGGCCTCTCTAGTAGG + Intergenic
914431507 1:147623986-147624008 CTCCTCATGGGGTCCCAATGGGG + Exonic
914493735 1:148173325-148173347 CTACACATGGCCTCTCTAGTAGG - Intergenic
915629792 1:157143816-157143838 CTCCTCATGGCTTTCTTATGAGG + Intergenic
918119911 1:181529411-181529433 CCCCACATGGAGTCCCTACGGGG + Intronic
921129438 1:212207248-212207270 TTCCACCTGGCCTCCCCATTAGG - Intergenic
921601592 1:217111982-217112004 CTCCATATGGCTTCTCTCTGTGG - Intronic
923227963 1:231956855-231956877 CTACACAGGGCCTCTCCATGTGG + Intronic
923558192 1:235018381-235018403 CTCCATGTGGCCTCCCAGTGTGG + Intergenic
1062806183 10:421300-421322 CGGCACTTGGCCTCCCTTTGCGG - Intronic
1063608862 10:7546249-7546271 GTCCACAGGGCCTCACTGTGAGG + Intergenic
1067091642 10:43268680-43268702 CTCCACTTGGCCTCCTTCTAAGG - Intergenic
1067296422 10:44977568-44977590 CTTCACAGAGCCTCCCTCTGGGG + Exonic
1068357784 10:55933058-55933080 CTCCACATGTCCTCTCTATGTGG - Intergenic
1069560301 10:69424551-69424573 CTCAATATGGCTTCCCTCTGTGG - Intergenic
1069826807 10:71259748-71259770 CTCCACACTCCCTCCCTGTGGGG - Intronic
1072555138 10:96509058-96509080 CTCCATGTGGTCTCTCTATGTGG - Intronic
1072761321 10:98059397-98059419 CACCACATTGCCTCTCTAAGAGG + Intergenic
1073196151 10:101694182-101694204 CTCCCCAAGGCCTCCATCTGAGG - Intronic
1075560780 10:123467021-123467043 CTCCACGTGTCATCCCCATGTGG + Intergenic
1075646354 10:124099389-124099411 ATCCACATGGCTTCCCAAAGTGG + Intergenic
1075699094 10:124457043-124457065 CTACACATGGCCTCTGCATGTGG - Intergenic
1076441918 10:130485981-130486003 CTCCACACGTCCTCCCCATGGGG + Intergenic
1078512938 11:11998992-11999014 CTCCTCATAGCAACCCTATGAGG - Intronic
1079003469 11:16776479-16776501 CTGCAGATGGCCACCCTGTGGGG + Intergenic
1079108749 11:17591495-17591517 CTCCACCTGCACTGCCTATGGGG + Exonic
1080114220 11:28603952-28603974 CTCCAAAAGGCCTCCCTATGTGG - Intergenic
1080200350 11:29662162-29662184 CTCCACATGGCCTCTCCATATGG - Intergenic
1080985272 11:37455751-37455773 CCACACATGGCCTCTCTCTGAGG - Intergenic
1081074040 11:38646506-38646528 CTCCATGTGGTCTCCCCATGTGG - Intergenic
1081408853 11:42731311-42731333 CTCCACATGGTCTCTCTGTGTGG - Intergenic
1084105775 11:66979358-66979380 CTCCACATGGCCTTCCTATCAGG - Intergenic
1084154053 11:67303964-67303986 CTCCACGGGGCCTCCCGGTGGGG + Intronic
1084443195 11:69187733-69187755 CCACACATGGCCTCTCCATGTGG - Intergenic
1084487403 11:69456906-69456928 CTGCACACAGCCTCCCCATGTGG - Intergenic
1085716741 11:78879568-78879590 CTCCACACGGCCGCCCTGTCTGG + Intronic
1085880031 11:80455670-80455692 CTTCACATGGCCTTCTTATAAGG + Intergenic
1086223315 11:84476717-84476739 CTACACATGGCTTCTCCATGTGG - Intronic
1087927148 11:103931903-103931925 CTCCACATGCCATCACCATGTGG - Intronic
1090512247 11:127387652-127387674 CTCCACATGGCTTCTCCATGTGG - Intergenic
1090947971 11:131448459-131448481 CTCCACCTGGCCTCCCTGGAAGG - Intronic
1091368308 11:135039623-135039645 CTCCACTTGGGCTTCCTGTGTGG - Intergenic
1091373602 12:12598-12620 CTCAACAAGGCCTCTCTGTGTGG + Intergenic
1091766434 12:3123044-3123066 CTCCACCAGGGCTCCCTGTGGGG - Intronic
1092674074 12:10897035-10897057 CTGCACATGGCCTCTGCATGTGG - Intronic
1093771680 12:23025363-23025385 CTACAAATGGCCTGCCTCTGTGG + Intergenic
1093785555 12:23188147-23188169 CTCCACATGGTCTCCCCAGCAGG - Intergenic
1095384464 12:41634257-41634279 CTCCACACGGCCCCTCCATGTGG - Intergenic
1096131537 12:49162916-49162938 CTTCACATGGCCTTCTTATAAGG - Intergenic
1096595102 12:52690119-52690141 CTTCACATGCCCACCCAATGGGG + Exonic
1097439120 12:59587807-59587829 CTAAACATGGCTTCTCTATGTGG - Intergenic
1097960291 12:65525860-65525882 CTACACATGGCCTTTCCATGTGG - Intergenic
1099030442 12:77519725-77519747 CTACACATGGGCTCTCTCTGGGG + Intergenic
1102762470 12:115400182-115400204 CTGCACATGGCCTCTCTGCGTGG + Intergenic
1103100069 12:118166074-118166096 ATCCAAATTGCCACCCTATGAGG + Intronic
1103293541 12:119866964-119866986 GTCCACATGGCACCTCTATGTGG - Intronic
1104253534 12:127119732-127119754 CACCACATGGCCTCCCCACTGGG - Intergenic
1104383663 12:128329742-128329764 CTCCACATGCCTTCTCCATGGGG - Intronic
1104674017 12:130700544-130700566 CTCCACATGGCCTTCTCCTGCGG - Intronic
1104866704 12:131960257-131960279 ATCCTCATGGCCGCCCTGTGGGG - Intronic
1106034751 13:26033565-26033587 CTCCCTGTGGCCTCCCCATGTGG + Intergenic
1106174722 13:27320512-27320534 CTTCATGTGGCCTCTCTATGTGG + Intergenic
1107344700 13:39446608-39446630 ATCCTCATAGCTTCCCTATGAGG + Intronic
1108198692 13:48020775-48020797 CTCTACATAGCCTCCCTATGTGG + Intergenic
1108407637 13:50121676-50121698 CTACACATGGCCTCTCCATGTGG - Intronic
1108834870 13:54530975-54530997 ATCCACATGCTCTCCCTAAGAGG + Intergenic
1109656328 13:65395661-65395683 CCCCACATGACCTCGCTATATGG - Intergenic
1110168203 13:72469107-72469129 CTCCACGTGACCTCTCTGTGTGG + Intergenic
1110769983 13:79331248-79331270 CCCCACTTGGCCTCCCAAAGTGG + Intronic
1110799956 13:79683169-79683191 CTACACAAGGCCTCTCCATGTGG + Intergenic
1111399935 13:87721074-87721096 GGCCCCATGGCCTCTCTATGAGG + Intergenic
1112128520 13:96496542-96496564 TTCCACATGGCCTCTCCATGAGG - Intronic
1113199397 13:107849524-107849546 CTGCCCAAGGCCTCTCTATGAGG + Intronic
1115431034 14:33319110-33319132 CTGCACATGGCCTCTCTAGTTGG + Intronic
1115484565 14:33898136-33898158 CTCCTCCTGGCATCCCTAGGAGG - Intergenic
1116041023 14:39686666-39686688 CTCCACATGGTCTCTCTCCGTGG + Intergenic
1117440644 14:55756046-55756068 TTCCACATGGCCTCTCTCTGTGG + Intergenic
1117476281 14:56098295-56098317 CTCCATGTGGCCTCCCCATGTGG + Intergenic
1118002350 14:61535419-61535441 CTCCAGATGGCCTCCTTTGGTGG - Intronic
1118132739 14:62985819-62985841 CTCCACTAGGGCTTCCTATGGGG + Intronic
1118805051 14:69228852-69228874 CTACAAATGGCCTCCCCAAGTGG + Exonic
1120585854 14:86311567-86311589 CTACAGTTGGCCTCCCTTTGGGG - Intergenic
1120800170 14:88679107-88679129 CTTCACATGGCCTTCTTATAAGG + Intronic
1121117728 14:91355346-91355368 CTGCACACCGCCTCACTATGGGG + Intronic
1121267134 14:92611553-92611575 CATCACATGGCCTTCTTATGAGG + Intronic
1124221589 15:27854254-27854276 CTCCACATGTCCTCCCCATGGGG - Intronic
1124620249 15:31269828-31269850 CTCCACATCACCTTTCTATGTGG - Intergenic
1125745509 15:41994899-41994921 CTCACCCTGGCCTCCCTGTGGGG + Intronic
1125830351 15:42711439-42711461 CTCCACATAGCCTTCTTATAAGG + Intronic
1126644516 15:50861589-50861611 CTGCACATGACCTTTCTATGTGG - Intergenic
1127451843 15:59124152-59124174 CTCTGCATGGCCCACCTATGAGG + Intronic
1128144186 15:65323255-65323277 CTCCACATGGCCTCTCCGTGTGG - Intergenic
1128660515 15:69497571-69497593 CTCCTCATGGCCTTACTAGGAGG + Intergenic
1128763892 15:70239107-70239129 CTACACATGGCCTCCCCATGAGG + Intergenic
1129890319 15:79067408-79067430 CTCCACATGCCCTCTAAATGGGG - Intronic
1130869377 15:87958517-87958539 TTCCCCAGGGCGTCCCTATGTGG + Intronic
1134763691 16:16737005-16737027 CTGCATGTGGCCTCCCTAGGTGG + Intergenic
1134982363 16:18622152-18622174 CTGCATGTGGCCTCCCTAGGTGG - Intergenic
1136000106 16:27286025-27286047 CTCCACGTGGCCTCTCCTTGTGG + Intronic
1137628805 16:49927751-49927773 CTACACATGACCTCCTCATGTGG + Intergenic
1140984900 16:80148931-80148953 CTCCACATGGTCTCCCACTCAGG - Intergenic
1141044403 16:80703588-80703610 GGCCACAGGGCCTCCCTGTGGGG + Intronic
1141924805 16:87161003-87161025 CTCCACACTCCCTCCCTCTGGGG - Intronic
1142748714 17:1974641-1974663 CTCCACCTGGCTTCCCTGTTTGG - Intronic
1143013816 17:3881119-3881141 TTCCACATGTCTGCCCTATGCGG - Intronic
1144407222 17:14963823-14963845 TTCAACATGTCCTCCCTTTGGGG - Intergenic
1146285012 17:31568484-31568506 CTCCTCATTGCCTCCCTGTGAGG + Intergenic
1146940904 17:36843695-36843717 TTCCTCATGGCCACCCTGTGTGG - Intergenic
1148516084 17:48218897-48218919 TTTCACATGGCCACCCCATGAGG - Intronic
1148768586 17:50053947-50053969 ATCCTCCTGGCCTCCCTGTGAGG - Intergenic
1149438657 17:56656179-56656201 CTACACATGGCCTTTCCATGTGG + Intergenic
1149635321 17:58162857-58162879 ATGCAAATGGCCTCTCTATGTGG - Intergenic
1149715965 17:58790672-58790694 CTACACAAGGCCTCTCCATGTGG - Intronic
1150795016 17:68229911-68229933 CTCCACGTGGCCTCTCTAACAGG + Intergenic
1154437500 18:14357997-14358019 CCCCACATGGTCTCCCCATCTGG - Intergenic
1155072229 18:22326713-22326735 CTTCACGTGGCCTTCCTATAAGG - Intergenic
1155444719 18:25899168-25899190 CTGCACATGGCCTCTCCATATGG + Intergenic
1156228722 18:35133703-35133725 CTGCACATGGACTCCCTCTTGGG - Intronic
1158052873 18:53244652-53244674 CTCCACGTGGCCTCTCCTTGAGG + Intronic
1160732268 19:646687-646709 CTCCTCGTGGCCGCCCTCTGGGG - Intergenic
1164529887 19:29040474-29040496 CTCCACGTGTCCTCCCTCTGGGG - Intergenic
1168388300 19:55984723-55984745 CCCCACTTGGCCTCCCAAAGGGG - Intronic
1202715240 1_KI270714v1_random:38706-38728 CTCTTCCTGGCCTCCCTCTGGGG - Intergenic
926631447 2:15140125-15140147 TTACACGTGGCCTCTCTATGTGG - Intergenic
926752138 2:16206322-16206344 CTTCACATGGCCTTCTTATGAGG - Intergenic
926800974 2:16660391-16660413 CTCCACATGGGCGCTCTCTGTGG - Intronic
927140333 2:20125844-20125866 CTCCATGTGGCCTCCCCATGTGG - Intergenic
927452700 2:23222687-23222709 CTCCTCATGGCCTCTTCATGAGG - Intergenic
928024726 2:27730260-27730282 CTCCACCAGGCCTCCCTGTGAGG + Intergenic
928979762 2:37125559-37125581 CTCCACATGGCCTCCCTATGGGG - Intronic
932025941 2:68133031-68133053 CACCACATGGCTTCACTAAGGGG + Intronic
933186881 2:79288613-79288635 CTCCACATGGTCTTTCCATGTGG + Intronic
933848637 2:86348084-86348106 CTCCACATGGCTTTCTTATAAGG + Intergenic
935025124 2:99269402-99269424 CTTCACTTGGCCTCCCTTTAAGG - Intronic
937850931 2:126635347-126635369 CTGCACATGCTCTTCCTATGAGG + Intergenic
940307301 2:152240212-152240234 CTCCATGTGGCCTCTCCATGTGG + Intergenic
940575453 2:155497855-155497877 CCCAACATGGCCTCCCAAGGTGG - Intergenic
942310955 2:174656089-174656111 CTTCAAGTGGCCTCTCTATGTGG - Intronic
944544659 2:200787416-200787438 CTCTACATGGCCTCCCACTATGG - Intergenic
944645623 2:201778154-201778176 GTTCACATGGCCTCCCTATCAGG - Intronic
945117420 2:206421737-206421759 CTCCATATGGCCTCTCTGTGTGG + Intergenic
946186976 2:217986540-217986562 GTCCACATAGCCTCCCTCTGGGG + Intronic
946452897 2:219796237-219796259 CTACACATGGCCCCTCTATGTGG - Intergenic
947173811 2:227339540-227339562 TTACACATGGCCTCACTGTGTGG + Intronic
947986949 2:234456361-234456383 CTTCACATGGCCTCCTTAGAAGG - Intergenic
948051056 2:234979696-234979718 TGCCACATGGCCTCTCTATATGG - Intronic
948135409 2:235632659-235632681 CTCCACCTGGCCTCCCTCTGGGG + Intronic
948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG + Intronic
1168865222 20:1080520-1080542 CTACACATGGCTTCTCCATGTGG + Intergenic
1168890042 20:1289240-1289262 CTCTACCTGGCCTCCCTCTATGG + Intronic
1170423946 20:16219497-16219519 CTCTACATGCCCTCCCTGTGTGG - Intergenic
1170539195 20:17371033-17371055 CTCCACGTGGCTGCCCTGTGAGG - Intronic
1170622522 20:18007728-18007750 CTCCACAAGGCCTGTCTATGTGG + Intronic
1170736026 20:19014942-19014964 CTACACATGGCCTCCCCATGAGG + Intergenic
1170873308 20:20228482-20228504 CTCCACACACCCTGCCTATGTGG + Intronic
1170928768 20:20749336-20749358 TTCCACCTGGCCTCTCCATGTGG - Intergenic
1170987481 20:21271857-21271879 CTCCACATGTCCTCTCCATGTGG - Intergenic
1172695986 20:36823145-36823167 AGCCACATGGCCTCTCTCTGTGG - Intronic
1173932411 20:46831912-46831934 CTACACACGGCCTCCCCATCTGG + Intergenic
1173991939 20:47310255-47310277 CTCCACACCTCCTCCCTGTGGGG - Intronic
1175783988 20:61700671-61700693 CCCCATACGGCCTCCCTGTGGGG + Intronic
1176839551 21:13827647-13827669 CCCCACATGGTCTCCCTGTCTGG + Intergenic
1178622036 21:34185641-34185663 GGCCACATGGCCACCCTCTGTGG - Intergenic
1179018890 21:37619673-37619695 CTCCACATGGCTTCTCTCTTAGG - Exonic
1180218734 21:46344440-46344462 CTCCACAAGGGCTGCCTGTGCGG - Intronic
1181712109 22:24697191-24697213 CTCCCCATGGCCTTCATTTGGGG + Intergenic
1183020702 22:35023885-35023907 CTGCCCATGGCCTCCCTTGGTGG - Intergenic
1183315535 22:37135067-37135089 TTCCACAGGGCCCCCCTGTGGGG + Intronic
1184106669 22:42371336-42371358 CTTCACATGGCCTTCTTATAGGG + Intergenic
950118965 3:10469283-10469305 ATCCACATCACATCCCTATGAGG + Intronic
950442112 3:13016160-13016182 CTCCAGATGGCACCCCTGTGGGG - Intronic
951445565 3:22775825-22775847 CTATACATGGCCTCTCCATGTGG + Intergenic
952894371 3:38067656-38067678 CACCACATAGCTTCTCTATGTGG + Intronic
953673057 3:44978711-44978733 CTCCACATGTCCTCCACCTGAGG - Intronic
956095549 3:65712298-65712320 CTACACATGGCCTCCCTGTGCGG - Intronic
958517449 3:95136198-95136220 CTCCACTTGGCCTTTCCATGTGG + Intergenic
958579386 3:95998122-95998144 CTGCTCATGGCCTCCTCATGCGG + Intergenic
958966370 3:100563244-100563266 CTTCACATGGCCTTCTTATAAGG + Intronic
959351960 3:105276916-105276938 CTACACATGGCTTCTCCATGTGG + Intergenic
960144891 3:114190546-114190568 GTCCACATGGCTTCCCTGTTGGG - Intronic
961064748 3:123865954-123865976 CTACATATGGCCTCTCCATGTGG - Intronic
962905173 3:139794793-139794815 CTCCACAGGTCCTCCACATGCGG - Intergenic
963210614 3:142685571-142685593 CTCCACAAGGCCTCTCTACATGG + Intronic
963933093 3:151024630-151024652 CTCCAAATGCCCTCCCCATGTGG + Intergenic
967115132 3:186330599-186330621 ATCCACGTGGCCTCTCCATGTGG - Intronic
968278242 3:197456936-197456958 CCCCACCTGTCCTCCCTCTGGGG + Intergenic
968581353 4:1396822-1396844 CTCCACATGTCCTGCCTCTGGGG - Intergenic
968725664 4:2246717-2246739 CTCCAAAAGGCCTCCCTGTGGGG + Intergenic
968963163 4:3755865-3755887 CTGCACATGGCCTCCCTCCCTGG + Intergenic
969094201 4:4719747-4719769 CTCCACATAGCCTTCTTATAAGG - Intergenic
969532557 4:7737937-7737959 CTGCACATGGTCTCGCTGTGTGG + Intronic
971198350 4:24490455-24490477 CTCCATGTGGCCTCTCCATGGGG - Intergenic
973120537 4:46516348-46516370 CTTCATAAGGCCTCTCTATGTGG - Intergenic
973882223 4:55285028-55285050 CTGCACCTGGCCTGCCTTTGTGG - Intergenic
974848796 4:67381494-67381516 CTCCACCTGGCCACCCCATCTGG + Intergenic
976673880 4:87683254-87683276 TGCCACATGGCCTCTCCATGGGG + Intergenic
978085367 4:104645460-104645482 CTCCACATGACCTCTCCATGTGG + Intergenic
978482700 4:109212367-109212389 CTACACATAGACTCTCTATGTGG + Intronic
978879836 4:113688560-113688582 CTCCAGATGGCTGTCCTATGAGG + Intronic
982245533 4:153346764-153346786 CTCCTCATTGCCTGCCTCTGGGG + Intronic
982470422 4:155782841-155782863 CTACACGTGGCCTCTCCATGTGG - Intronic
985053551 4:186016650-186016672 TTCCTCTTGGCCTCCCTGTGTGG + Intergenic
985442899 4:189997394-189997416 CCCCACTTGGCCTCCCAAAGTGG + Intergenic
986526482 5:8684046-8684068 TGCAACATGACCTCCCTATGTGG + Intergenic
987744876 5:21957992-21958014 CTCCACCTGGTCTCTCCATGTGG - Intronic
988890367 5:35609946-35609968 CTTCTCATGGCCTCCCTCTTTGG - Intergenic
989164517 5:38421603-38421625 CTCCACATGGCAACTATATGAGG - Intronic
989697026 5:44213303-44213325 CTCCACCTGGTCTTTCTATGAGG - Intergenic
990979757 5:61592052-61592074 CTGCAGGTGGCCTCCCCATGTGG + Intergenic
991765082 5:69968121-69968143 CTCCACCTGGTCTCTCCATGTGG - Intergenic
991782243 5:70150032-70150054 CTCCACCTGGTCTCTCCATGTGG + Intergenic
991844314 5:70843192-70843214 CTCCACCTGGTCTCTCCATGTGG - Intergenic
991874686 5:71150347-71150369 CTCCACCTGGTCTCTCCATGTGG + Intergenic
992021621 5:72630402-72630424 CTCTGCATGGACTCCCTCTGTGG + Intergenic
992546040 5:77814856-77814878 CTCCACATGGTATCTCCATGTGG - Intronic
998127536 5:139634663-139634685 CTCCCCCAGGCCTCCCTCTGGGG + Intergenic
998432509 5:142078367-142078389 CTCCACCAAGCCTCCCTAAGGGG - Intergenic
998475356 5:142416701-142416723 CTCCTCCTGCCCTGCCTATGAGG - Intergenic
998517328 5:142768427-142768449 CTCCATATGGCCTTTCTCTGTGG - Intergenic
998990513 5:147810338-147810360 CTCCACATGGCCTCTCTAGCAGG + Intergenic
999200663 5:149813977-149813999 CTCCTCATGGCCTCACCATGGGG + Intronic
1000917663 5:167101705-167101727 CTACACATGGCCTCTACATGTGG - Intergenic
1001144974 5:169175915-169175937 GTCCATATGGCTTCCTTATGGGG - Intronic
1001689425 5:173621828-173621850 CTCCACATCACCTCACTTTGAGG - Intergenic
1001771394 5:174299621-174299643 CCCCACTTGGCCTCCCAAAGTGG + Intergenic
1001909896 5:175507194-175507216 TTGCACATGGCCTTCCTATAAGG + Intronic
1003078618 6:3003300-3003322 CTCCTCAAAGCCTCCCGATGAGG - Intronic
1003946865 6:11084066-11084088 CTTCACATGGCCTTCTTATAAGG - Intergenic
1004564586 6:16784184-16784206 CTCCACATGGCCTTCTTGTAAGG - Intergenic
1005022853 6:21434217-21434239 CCGCACATGGCCTCCCTGAGGGG - Intergenic
1006784339 6:36655200-36655222 CTACACATGGTCTCTCCATGTGG + Intergenic
1006837965 6:37010657-37010679 CTCCACGTGGCCTGTCCATGAGG + Intronic
1007747857 6:44054283-44054305 CTCCACAGGCCCTCCCTCTGTGG + Intergenic
1007904199 6:45442932-45442954 CTCCACGTGGCCTCTCCATGTGG + Intronic
1012198157 6:96370685-96370707 CTACACATGACCTCTCCATGTGG + Intergenic
1013212928 6:108002820-108002842 CTGCACATGATCTCCCTATGGGG - Intergenic
1016387033 6:143538324-143538346 ATCCACATAACCTCCCAATGTGG - Intronic
1016622458 6:146128035-146128057 CTACACATGGCCTCTCTACGTGG + Intronic
1018637765 6:165879451-165879473 CTGCACATGGCCTTCTTTTGAGG + Intronic
1021124999 7:16841767-16841789 CTCCATGTGGTCTCCCAATGTGG - Intergenic
1021474910 7:21049970-21049992 CTCCACATGGCTTCTCCATGTGG + Intergenic
1021668003 7:23006113-23006135 CTCCCCATTCCCTTCCTATGGGG - Intronic
1021743530 7:23713168-23713190 CACCACATGGCCTAGGTATGTGG - Intronic
1022183261 7:27942516-27942538 ATCCACACAGCATCCCTATGAGG + Intronic
1022248541 7:28584420-28584442 CTCCACATGGCCTTCTTATAAGG - Intronic
1026233867 7:68509328-68509350 CTACACATGGCCTCTTCATGTGG - Intergenic
1029344301 7:99967272-99967294 CTCCACAGATCCTCCCTCTGTGG - Exonic
1029347192 7:99987250-99987272 CTCCACAGATCCTCCCTCTGTGG + Intergenic
1029985756 7:104921881-104921903 CCACACCTGGCCTCACTATGTGG + Intergenic
1030090080 7:105850709-105850731 CTCCATATGGCCTGCCTGTTTGG + Intronic
1030542776 7:110852778-110852800 CTCCACTTGGGCTCTCTATGTGG - Intronic
1032580623 7:133099991-133100013 CCATACATGGCCTCTCTATGTGG - Intergenic
1032726387 7:134593238-134593260 CTTCACATGACCTTCTTATGAGG + Intergenic
1034384400 7:150726899-150726921 CTCCACATTGCCTATCTATTTGG - Intronic
1035361677 7:158317687-158317709 CTGCAGATGGCCGCCCTGTGTGG - Intronic
1035460245 7:159034163-159034185 CTCCACACGGCATCCCCATCAGG + Intronic
1035478239 7:159158925-159158947 CTCCACGTGGGCTCTCTGTGTGG + Intergenic
1035638244 8:1163236-1163258 CTCCCAATCGCCTCCCTCTGGGG + Intergenic
1036826286 8:11978514-11978536 CTCAACATGACTTCCCTGTGTGG + Intergenic
1038049607 8:23796420-23796442 CACCTCATGGAATCCCTATGGGG + Intergenic
1038057136 8:23870956-23870978 CTCCATGTGGCTTCTCTATGTGG + Intergenic
1038741142 8:30218193-30218215 CTTCACATGGCCTTCTTATAAGG - Intergenic
1038868732 8:31469301-31469323 CTTCACATGGTGTTCCTATGTGG - Intergenic
1039370642 8:36980944-36980966 CTCCCTGTGGCCTCCCTCTGGGG + Intergenic
1039400846 8:37267752-37267774 CTCCACATGGTCTCTTCATGCGG + Intergenic
1039451765 8:37680564-37680586 CGGCCCATGGCCTCCCTATTTGG - Intergenic
1039749000 8:40459306-40459328 CTGCACATGGCATCTCCATGTGG - Intergenic
1040031001 8:42823543-42823565 CTCCAGACGGCATCCCTATATGG + Intergenic
1041089598 8:54289734-54289756 CTGCATGTGGCCTCCCTATACGG - Intergenic
1042193554 8:66212415-66212437 CTACACCTGGCCTCTCCATGTGG - Intergenic
1044063569 8:87669891-87669913 CTTCACATGGCCTTCTTATAAGG + Intergenic
1044428835 8:92085047-92085069 ATCCTCATGACCACCCTATGAGG + Intronic
1045398320 8:101784261-101784283 CTACTCTTGGCCTCTCTATGTGG + Intronic
1047178600 8:122566188-122566210 CCCCACATGGCCTCTCCATGGGG + Intergenic
1047551526 8:125877921-125877943 CTCCAAATGACCTCCCTAGAAGG - Intergenic
1053173307 9:35906063-35906085 CTCCACCTGGCCTCCCTGCCAGG + Intergenic
1055594055 9:77847720-77847742 CTATGCAGGGCCTCCCTATGTGG + Intronic
1056237610 9:84610770-84610792 TTCCAAATGGCCTCCCCATGTGG + Intergenic
1056545791 9:87612358-87612380 CTCCACAGGGCCTTCTTATAAGG - Intronic
1056597405 9:88019138-88019160 CTACACATAGCCCCACTATGTGG - Intergenic
1056810973 9:89763701-89763723 CTCCACATGGCCTCTCCAGGAGG + Intergenic
1056931400 9:90880903-90880925 CTGCACATGGCCTCTCCTTGGGG + Intronic
1057000315 9:91503193-91503215 GTCCACATGGCCTCCTCATGAGG + Intergenic
1058137375 9:101321703-101321725 CTCCAGATGTCTTCCCCATGGGG + Intronic
1058165215 9:101611349-101611371 CTCCACAGGGTCTCCTTATAAGG + Intronic
1058710255 9:107672896-107672918 ATCTTCATAGCCTCCCTATGAGG - Intergenic
1058732041 9:107859639-107859661 CTGCACATGGCCTCTCTGTGTGG - Intergenic
1059801405 9:117753007-117753029 CTCCACATTGCCTCTCTCTAAGG + Intergenic
1060546989 9:124467713-124467735 CTCCTCAGGGCCTCTCTGTGTGG - Exonic
1060975794 9:127764263-127764285 CACCCCATGGCCTCACCATGGGG + Intronic
1188432240 X:30117352-30117374 CTCCATGTAGCCTCTCTATGTGG - Intergenic
1189161465 X:38813434-38813456 CTACAGGTGGCCTCTCTATGTGG - Intergenic
1189283427 X:39835234-39835256 CTATACATGGCCTCTCCATGTGG - Intergenic
1192229850 X:69257272-69257294 CTCCCCATAGCCACCCCATGTGG - Intergenic
1194552349 X:95317706-95317728 CTCCCCTTGGCCTCCCAAAGTGG - Intergenic
1197233797 X:124035739-124035761 CTACAAATGGCCTTTCTATGTGG + Intronic
1197835952 X:130693914-130693936 CTCCACATGGTCTCTCTAGCAGG - Intronic
1198755022 X:139973673-139973695 CTCCACATGACCTCTCCCTGTGG - Intergenic