ID: 928980390

View in Genome Browser
Species Human (GRCh38)
Location 2:37130466-37130488
Sequence ACCAGATGGCTCCTATAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 4, 1: 2, 2: 2, 3: 13, 4: 74}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928980384_928980390 8 Left 928980384 2:37130435-37130457 CCCACAATACTCCTATTCTCCCA 0: 5
1: 4
2: 2
3: 23
4: 190
Right 928980390 2:37130466-37130488 ACCAGATGGCTCCTATAGACTGG 0: 4
1: 2
2: 2
3: 13
4: 74
928980385_928980390 7 Left 928980385 2:37130436-37130458 CCACAATACTCCTATTCTCCCAA 0: 5
1: 2
2: 3
3: 13
4: 198
Right 928980390 2:37130466-37130488 ACCAGATGGCTCCTATAGACTGG 0: 4
1: 2
2: 2
3: 13
4: 74
928980386_928980390 -3 Left 928980386 2:37130446-37130468 CCTATTCTCCCAATTACAAAACC 0: 1
1: 1
2: 7
3: 25
4: 258
Right 928980390 2:37130466-37130488 ACCAGATGGCTCCTATAGACTGG 0: 4
1: 2
2: 2
3: 13
4: 74
928980383_928980390 9 Left 928980383 2:37130434-37130456 CCCCACAATACTCCTATTCTCCC 0: 5
1: 3
2: 6
3: 23
4: 220
Right 928980390 2:37130466-37130488 ACCAGATGGCTCCTATAGACTGG 0: 4
1: 2
2: 2
3: 13
4: 74
928980379_928980390 21 Left 928980379 2:37130422-37130444 CCCACCCATTCTCCCCACAATAC 0: 4
1: 2
2: 4
3: 24
4: 233
Right 928980390 2:37130466-37130488 ACCAGATGGCTCCTATAGACTGG 0: 4
1: 2
2: 2
3: 13
4: 74
928980380_928980390 20 Left 928980380 2:37130423-37130445 CCACCCATTCTCCCCACAATACT 0: 3
1: 4
2: 5
3: 25
4: 264
Right 928980390 2:37130466-37130488 ACCAGATGGCTCCTATAGACTGG 0: 4
1: 2
2: 2
3: 13
4: 74
928980378_928980390 22 Left 928980378 2:37130421-37130443 CCCCACCCATTCTCCCCACAATA 0: 4
1: 3
2: 4
3: 33
4: 325
Right 928980390 2:37130466-37130488 ACCAGATGGCTCCTATAGACTGG 0: 4
1: 2
2: 2
3: 13
4: 74
928980382_928980390 16 Left 928980382 2:37130427-37130449 CCATTCTCCCCACAATACTCCTA 0: 3
1: 3
2: 1
3: 22
4: 286
Right 928980390 2:37130466-37130488 ACCAGATGGCTCCTATAGACTGG 0: 4
1: 2
2: 2
3: 13
4: 74
928980381_928980390 17 Left 928980381 2:37130426-37130448 CCCATTCTCCCCACAATACTCCT 0: 3
1: 3
2: 3
3: 23
4: 255
Right 928980390 2:37130466-37130488 ACCAGATGGCTCCTATAGACTGG 0: 4
1: 2
2: 2
3: 13
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928980390 Original CRISPR ACCAGATGGCTCCTATAGAC TGG Intronic