ID: 928986787

View in Genome Browser
Species Human (GRCh38)
Location 2:37189883-37189905
Sequence CTGGAAGGCAGATACTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928986779_928986787 5 Left 928986779 2:37189855-37189877 CCAATTTTCTTTAGTGCCTTCCC 0: 1
1: 0
2: 2
3: 26
4: 302
Right 928986787 2:37189883-37189905 CTGGAAGGCAGATACTGTGTTGG 0: 1
1: 0
2: 3
3: 20
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928986787 Original CRISPR CTGGAAGGCAGATACTGTGT TGG Intronic
901194460 1:7432692-7432714 CAGAAAGGCAGCTGCTGTGTGGG - Intronic
901777624 1:11571097-11571119 CTGGCTGGCAGCTTCTGTGTTGG - Intergenic
902236026 1:15057973-15057995 ATGTGAGGCAGATACTGTGGAGG - Intronic
903709357 1:25311258-25311280 ATGGAAGGCAGAAAATCTGTAGG + Intronic
903917590 1:26775454-26775476 GTGGAAGGCAGTTTCTGTCTGGG - Intronic
904480051 1:30787887-30787909 GTGGAAGCCAGAGACTGCGTGGG - Intergenic
907300203 1:53482219-53482241 CTGGAGGTCAGATACTGTCCGGG - Intergenic
907372737 1:54013783-54013805 CTTGAAGGCAGGCACTGTGTTGG + Intronic
909102363 1:71365154-71365176 CTGTGAGGCAGATACTGTCAGGG - Intergenic
909643428 1:77891398-77891420 CTGGATGGCAGACACTGCATGGG - Intronic
909923381 1:81409391-81409413 CTGGAACACAGAAGCTGTGTGGG + Intronic
910342748 1:86206769-86206791 CTGAAATGCAGATACTATGAAGG + Intergenic
910532573 1:88256716-88256738 CTGGAAGGCAGATAATTTACTGG + Intergenic
910659481 1:89655941-89655963 CTTGAAGGCAGGTATGGTGTGGG - Intronic
913394060 1:118346947-118346969 CTGGAAAGCAGACACTGAGATGG - Intergenic
913489694 1:119367489-119367511 CTGGAAGGGAGAGACAGAGTCGG + Intergenic
915510124 1:156382348-156382370 CAGGAAGGCAGTTTCTGGGTTGG - Intronic
915535249 1:156531415-156531437 CTCAAAGGCAGATAGTTTGTTGG - Intronic
916287609 1:163127816-163127838 CTGGTAAGCAGATAATTTGTTGG - Intronic
917053611 1:170953593-170953615 CTGAAAGTTAGAAACTGTGTGGG - Intronic
917491071 1:175499082-175499104 CTTCAAGGTTGATACTGTGTGGG + Intronic
918153322 1:181818071-181818093 CTAGAAGGCAGATATGGTGCTGG + Intergenic
919975353 1:202607193-202607215 CATGAGGGCAGATCCTGTGTTGG + Intronic
921933697 1:220776958-220776980 CAGGAAGGCAGCTACTGTACTGG - Intronic
922662757 1:227444473-227444495 CAAGAAGGGAGTTACTGTGTTGG + Intergenic
1067969482 10:50953604-50953626 AAGGAAGGGAGCTACTGTGTAGG - Intergenic
1068525352 10:58122755-58122777 GTGGTAGGTAGATACTGTGGAGG - Intergenic
1070960897 10:80499544-80499566 GTGGAAGGCAGCTGCTCTGTGGG + Intronic
1071097256 10:81991504-81991526 CTGGAGTGCATACACTGTGTGGG + Intronic
1072267517 10:93744703-93744725 CTAGAAGGCAGGAACTCTGTGGG + Intergenic
1072695837 10:97602078-97602100 CTGAAAGGAAGAGACTGAGTGGG - Intronic
1075922133 10:126222463-126222485 CTGGGAGTCAGAGACTGTGCCGG - Intronic
1076009010 10:126971989-126972011 CTGGGAGGCAGAGGCTGTGGTGG - Intronic
1077021345 11:418452-418474 ATGGAAGGCAGAGGCTGGGTGGG - Exonic
1078492375 11:11781396-11781418 CTGAAAGTCACATTCTGTGTAGG + Intergenic
1080330144 11:31127504-31127526 CTGGAAGGCTTTTAATGTGTTGG + Intronic
1081228660 11:40557425-40557447 CTGGGTGCCAGATATTGTGTTGG - Intronic
1084433857 11:69126660-69126682 CTGAGAGGCAGGTCCTGTGTGGG + Intergenic
1085743502 11:79096006-79096028 CTGGAAGTCAGACACCGTCTGGG - Intronic
1087753122 11:102027149-102027171 CTGGAAGACAGCTAGTGTGGGGG - Intergenic
1089339736 11:117749231-117749253 CTGGAAACCAGATGCTGTGGCGG + Intronic
1089604440 11:119633752-119633774 CTGGGAGGCAGAGGCTGTGGTGG + Intronic
1089931670 11:122319247-122319269 GTGGAAGGATGATACTGTGGGGG - Intergenic
1095583562 12:43826884-43826906 CTGGAATGCAGTGACTGTGAAGG + Intergenic
1097105570 12:56621645-56621667 CTGGATGACAGACACTGTGCTGG - Intronic
1097541142 12:60945359-60945381 CTGGAATACAGATATGGTGTTGG - Intergenic
1098497965 12:71158647-71158669 CTGGAATCCAGAAACTGAGTTGG - Intronic
1098808754 12:75056224-75056246 TTAAAAGGCAGATTCTGTGTTGG - Intronic
1100311434 12:93398263-93398285 CTGGGAGGCAGAGATTGTGGGGG + Intronic
1100713521 12:97282311-97282333 CTGAAAGGCAAATGCAGTGTCGG + Intergenic
1101802916 12:108037985-108038007 CTAGAAGGCAGAGCCTGTGGTGG + Intergenic
1101852054 12:108411257-108411279 CTGTAATGCAGTAACTGTGTGGG - Intergenic
1102151159 12:110689586-110689608 CTGCATGGCAGAAACTGTGCAGG - Intronic
1102912503 12:116728345-116728367 CTGGATGGCAGAGACAGAGTGGG - Intronic
1103504489 12:121432716-121432738 CTGGAAGGCAGATAGGGAGCTGG - Intronic
1104335871 12:127894447-127894469 CTGGAAGGCAGATCCTGCTCTGG - Intergenic
1107109126 13:36676577-36676599 CTGGATGCCAGGCACTGTGTAGG + Intronic
1107667328 13:42704915-42704937 CTGGGAGGCAGAGACTGAGCAGG - Intergenic
1110424049 13:75345290-75345312 CAGTAAGGCAGATCCTCTGTAGG - Intronic
1112508758 13:99990793-99990815 CTGCCAGGCAGAGAGTGTGTGGG + Intergenic
1113311190 13:109134830-109134852 CTGGAAAGGATATACTGTGGTGG + Intronic
1113320205 13:109225716-109225738 CTGGAATCCAGATACTATGGTGG + Intergenic
1114083986 14:19224747-19224769 CTGGAAGGCAGAGACTGCAGTGG + Intergenic
1114192939 14:20454507-20454529 ATGGAAGGCTGATTCTGTGCGGG + Intronic
1115163451 14:30421372-30421394 GTGGAAGGGAGATACCTTGTTGG + Intergenic
1117661184 14:58006528-58006550 CTGGGAGGCAGAAACAGTGAGGG - Intronic
1118412822 14:65500564-65500586 CTGGAAGGCAGTTAATATGTTGG + Intronic
1118887075 14:69876534-69876556 CTGGCAGAGAGATACTGTTTGGG + Intronic
1119129121 14:72155428-72155450 CTGGAAGTCATATCCTGGGTGGG - Intronic
1125745117 15:41992586-41992608 CTGGAAGACCGATAAGGTGTCGG - Intronic
1127613520 15:60660207-60660229 CTGGAACACAGATAATGTGAAGG + Intronic
1127628160 15:60800704-60800726 CTGGGAGGTAGATGCTGTGTGGG - Intronic
1127764731 15:62173935-62173957 CTGGGAAGCAGATGCTGTGTTGG + Intergenic
1128624276 15:69183471-69183493 CTGGAAGCCACATGCTGTGTGGG + Intronic
1129738559 15:77978846-77978868 TACAAAGGCAGATACTGTGTGGG + Intergenic
1129847513 15:78774764-78774786 TACAAAGGCAGATACTGTGTGGG - Exonic
1130254391 15:82319145-82319167 TACAAAGGCAGATACTGTGTGGG + Intergenic
1130600574 15:85270825-85270847 TACAAAGGCAGATACTGTGTGGG - Intergenic
1131297892 15:91168174-91168196 CTGGGAGCCAGAGACTGTGAGGG - Intronic
1133857749 16:9565399-9565421 CTGGAACTCAGATACACTGTGGG + Intergenic
1134192653 16:12134534-12134556 TGGGAAGTCAGCTACTGTGTTGG - Intronic
1137484110 16:48877379-48877401 CTGGAATGGGGATACTGGGTAGG - Intergenic
1137929551 16:52574045-52574067 CTGGAGGTTAGATAATGTGTGGG - Intergenic
1140125343 16:72113414-72113436 CTGGTTGGCAGGTTCTGTGTTGG + Intronic
1140451302 16:75072898-75072920 CTGAGATGCAGATACTGTGTTGG + Intronic
1140625541 16:76789714-76789736 CTGGCAGGCAGATATGGTGCAGG + Intergenic
1141461280 16:84180029-84180051 CTGGAAGGAAGAGACTGGGGGGG + Exonic
1141639123 16:85330877-85330899 CTGGAAGTCTGCTGCTGTGTGGG + Intergenic
1145127699 17:20315549-20315571 CTGGAAGGATGATCCTTTGTTGG - Intronic
1147357555 17:39909724-39909746 CTGGGAGGCAGGGACTGTGGAGG - Intronic
1147884278 17:43674311-43674333 CTGGAAGGCAGGTGCTGTCGGGG + Intergenic
1148982026 17:51585130-51585152 CTTGAGTGCAGATACAGTGTAGG - Intergenic
1149669251 17:58391346-58391368 CTGGAAGGAAAAAAATGTGTTGG - Intronic
1150023891 17:61651202-61651224 CTGGAAGGCAGTTACACTGCTGG - Intergenic
1150602281 17:66661284-66661306 CTGGAGGGCAGATATGGGGTGGG + Intronic
1150709011 17:67514104-67514126 CTGTGAGGGAGAGACTGTGTGGG + Intronic
1152903386 17:82957761-82957783 CTGGAAGGCAGAATTTCTGTAGG + Intronic
1153658497 18:7306014-7306036 CTGGAATGCAGATGCAGTGCTGG + Intergenic
1161679968 19:5675106-5675128 CTGGAATGCAGAGATGGTGTGGG + Intronic
1161950096 19:7463163-7463185 CTGGAAGGCAGGGGCTGAGTCGG - Intronic
1162159001 19:8698072-8698094 CTGGAAGACGGGCACTGTGTAGG + Exonic
1164809762 19:31146925-31146947 CTGGAAGGAAGATGCTGTCAGGG + Intergenic
1167112481 19:47470467-47470489 AAGGAAGGCAGACAGTGTGTTGG + Intronic
925212793 2:2064460-2064482 CTGAAATGTAGATACGGTGTAGG + Intronic
928986787 2:37189883-37189905 CTGGAAGGCAGATACTGTGTTGG + Intronic
932093109 2:68824321-68824343 GTGGAAGGTAGAATCTGTGTGGG - Intronic
932753117 2:74385044-74385066 CCGCAAGGCAGATACTGAGTAGG - Intronic
933371271 2:81418680-81418702 CAGGAAGGCAGATAGTGTGGAGG + Intergenic
933828902 2:86190691-86190713 GAATAAGGCAGATACTGTGTCGG + Intronic
934129227 2:88931548-88931570 CTGCATGGCAGATTCTGAGTTGG - Intergenic
936902067 2:117492804-117492826 CAAGAAGGCAGATATTGTGGTGG + Intergenic
937765351 2:125654555-125654577 CAGGATGACAGATACTGTGCTGG - Intergenic
938925260 2:136034374-136034396 CTGTATGTCAGATACTGTGTTGG - Intergenic
939212387 2:139193430-139193452 CTGTGAGGCAGATAATGTGCTGG + Intergenic
939450623 2:142368861-142368883 CTGAAAAGCAGATACTGTGTAGG + Intergenic
943788634 2:191907383-191907405 GTGGAAGGCAGGCACTGAGTAGG - Intergenic
944910292 2:204304450-204304472 CTTTCAGCCAGATACTGTGTTGG + Intergenic
945032159 2:205675720-205675742 CTGGAAGGCATTTATTGTGCTGG - Intergenic
945135873 2:206627101-206627123 CTGGAAGGCAGACAGGGTGATGG - Intergenic
945141441 2:206690871-206690893 CTGGAACACAGAGACTGTGGAGG + Intronic
947389881 2:229628105-229628127 TTGGAAGACAGCTACTGTGTTGG + Intronic
947748529 2:232521523-232521545 CTTGGGGGCAGAGACTGTGTTGG + Intronic
948070235 2:235114970-235114992 CTGGGAGGCAGAGATTGTGGTGG + Intergenic
948601856 2:239111916-239111938 CTGGGAGGCAGAGCCTGTGCTGG - Intronic
1168989457 20:2081571-2081593 AAGGAAGACAGAAACTGTGTTGG - Intergenic
1169935675 20:10880799-10880821 CTGGAAGGCAGCAACTGCATAGG - Intergenic
1171849782 20:30300261-30300283 CTGGAAGGCAGACGCTGCGGAGG + Intergenic
1172865896 20:38097026-38097048 CTGGAAGGCTCATACATTGTAGG - Intronic
1172940925 20:38654014-38654036 CATGAAGGCAGAGACTATGTGGG + Intergenic
1173650331 20:44659702-44659724 CTGGAAGGCAGATGGTGAGTGGG - Intergenic
1173662611 20:44745050-44745072 CTGGGGGGCAGATACTTTGGGGG - Intergenic
1175746620 20:61461471-61461493 CTGGAAGGAAGAGACTGAGGGGG + Intronic
1176008836 20:62881035-62881057 CTGGAAGGCAGAGCCTGGGGAGG - Exonic
1177168452 21:17629059-17629081 CTTGAAGACAGAGACTGTGATGG - Intergenic
1177695661 21:24567189-24567211 TTGGCTGGCAGATACAGTGTTGG - Intergenic
1180293988 22:10868514-10868536 CTGGAAGGCAGAGACTGCAGTGG - Intergenic
1180496794 22:15897934-15897956 CTGGAAGGCAGAGACTGCAGTGG - Intergenic
1181013861 22:20057262-20057284 CTGGAAGCCAGCTCCAGTGTGGG - Intronic
1181294780 22:21828170-21828192 CTGGAAGGCAGAAGATGTGAAGG + Intronic
1183860537 22:40666598-40666620 CTGGAAGCCACTTGCTGTGTGGG + Intergenic
1183865077 22:40697972-40697994 GAGGAAGGCAGAGACTGTGAGGG + Intergenic
950431960 3:12955865-12955887 CTGGAAGATAGATTCTGTGTGGG + Intronic
957719641 3:83977556-83977578 ATGGATGGCAGAGACTGGGTAGG - Intergenic
961091938 3:124120245-124120267 TTGGCAGGCAGATCCAGTGTGGG + Intronic
961178196 3:124853476-124853498 CTTGGAGGCAGACACTGTGGAGG - Intronic
961457391 3:127031024-127031046 CAGGGAGGCAGATACTCTGGAGG - Intronic
961594755 3:128007204-128007226 CTGGAAGGCAGTCACTGTGTGGG - Intergenic
962167808 3:133068442-133068464 CTGGAAGGCAGATGCTTGTTTGG + Intronic
963419115 3:145037104-145037126 CTCAAAGTCAGATACTGTATTGG + Intergenic
963815959 3:149831140-149831162 GTGGAAGGGAAATACAGTGTTGG + Intronic
968357556 3:198121011-198121033 CTGCAAGGCAGAAGCTGTCTGGG + Intergenic
968489067 4:880526-880548 CTGGAAGGCACAGTCTCTGTGGG - Intronic
969337701 4:6521494-6521516 CTGGGAGGAAGCCACTGTGTGGG - Intronic
971372062 4:26027760-26027782 CTGGAAGGCAGAGTCTGGTTGGG + Intergenic
973699836 4:53525770-53525792 CTGAAAGGGAGATACTGTTTTGG - Intronic
978510368 4:109510550-109510572 CTGGAAGGTAGATACACTTTCGG + Intronic
981487228 4:145300345-145300367 CTGGAGGGCAGAAACTGAGATGG + Intergenic
981647720 4:147019019-147019041 CTGGATGTCAGGCACTGTGTTGG + Intergenic
989225657 5:39025194-39025216 CTGGAAGTCAAATACTGTCTGGG - Intronic
990408271 5:55513899-55513921 CTGGGAGACAGATGTTGTGTAGG + Intronic
991989739 5:72325797-72325819 CTGGAAAGCAGATGCTTGGTTGG + Intronic
994288481 5:97998348-97998370 CTGGAAGGGAGATGCTGTAATGG + Intergenic
994361608 5:98856304-98856326 ATGTAAGGCAATTACTGTGTTGG + Exonic
996024572 5:118630532-118630554 CTGGGAGGAAGAGGCTGTGTTGG - Intergenic
997041662 5:130263558-130263580 ATGGAATGCAGATACATTGTTGG - Intergenic
999979853 5:156947308-156947330 TGGGAAAGCAGATACTCTGTGGG + Intronic
1000440886 5:161261699-161261721 CTGGATGCCAGACACTGTGCTGG + Intergenic
1001029434 5:168251103-168251125 CTGGAAGGGACATTCTGTGTGGG - Intronic
1001941158 5:175740611-175740633 CTGGGAGGCAGAGAGTGTGCTGG - Intergenic
1004343252 6:14826048-14826070 CTGGAAGGCAGTTTCTTTCTAGG - Intergenic
1005855168 6:29855435-29855457 CAGGAAGTCAGTTACTGTGAAGG - Intergenic
1006782912 6:36644177-36644199 GTGGAATGCAGCTGCTGTGTGGG - Intergenic
1007595014 6:43045930-43045952 CAGGAGGGCAGATCCTGTGAGGG + Intronic
1007835789 6:44672566-44672588 CTGGGAGGCAGACAATGTGATGG - Intergenic
1008126118 6:47670606-47670628 CTGGAAAGCAGAGAATGGGTTGG + Intronic
1008195200 6:48510290-48510312 CTGGAAGGCAGATCAGGTCTAGG - Intergenic
1009644575 6:66381581-66381603 CTTGAAGACAGATACTTGGTTGG + Intergenic
1010930221 6:81792417-81792439 TTGAAAGCCAGATACTGTGCTGG - Intergenic
1013474096 6:110491681-110491703 CTGGATGGGAGTTTCTGTGTGGG + Intergenic
1014468425 6:121784472-121784494 CTGGGAGGCAGAGGCTGTGGTGG + Intergenic
1014926948 6:127283516-127283538 CTGCAAAACAGAGACTGTGTAGG + Intronic
1016058506 6:139603702-139603724 CTGGGAGGCAGAGAGTGGGTGGG + Intergenic
1017447403 6:154519382-154519404 CTGGAAGGCAGATAATGTTTTGG - Intergenic
1018316179 6:162558711-162558733 CTTGGAGGCAGAGACTGTGATGG - Intronic
1020097913 7:5378737-5378759 CGGGAAGGCAGATTCTGAGCTGG + Intronic
1021317013 7:19160448-19160470 ATGGAAGGCAAAAACTGTGTAGG + Intergenic
1022038530 7:26557332-26557354 CTGTGAGGCAGACACTGTGCTGG + Intergenic
1022190087 7:28009098-28009120 ATGGAAGGCAGAGACTCTGATGG + Intronic
1024864858 7:53893904-53893926 CTGGAAGGCAGAGAGTTTGTTGG - Intergenic
1025746957 7:64250929-64250951 CTGCAAGGCAGTTAGTCTGTGGG - Intronic
1028184519 7:87767540-87767562 CTGCAAGGCTGAGAGTGTGTAGG + Intronic
1032247113 7:130222524-130222546 CTGGAGGGCAGATACTGGTTTGG - Intergenic
1034065608 7:148133724-148133746 CAGGAAGGCAGTTACTGGCTGGG + Intronic
1034438411 7:151074652-151074674 CTGCAGGGCAGACACAGTGTAGG - Intronic
1037540231 8:19863753-19863775 CTGGCTAGCAGATGCTGTGTTGG - Intergenic
1040322835 8:46327210-46327232 CTGGCAGGCAGAAACTCTGGGGG - Intergenic
1042776313 8:72435842-72435864 CTGGAAGACATTTACTGTATTGG - Intergenic
1043855203 8:85257265-85257287 CTTTAAGGCAGAAACTGTTTTGG - Intronic
1046272962 8:111919623-111919645 CTGGAAAGCAGACACTGAGATGG - Intergenic
1046626473 8:116581826-116581848 CTGGAAGCCAGAAAAAGTGTTGG - Intergenic
1048168874 8:132086284-132086306 CTGGTGGGCAGAGCCTGTGTTGG + Intronic
1049596060 8:143483908-143483930 CTGGGAGGTAGATGCTGTGGGGG - Intronic
1050489099 9:6168343-6168365 AGGAAAGGCAGATACTGTCTAGG - Intergenic
1050905622 9:11001036-11001058 TTGGAAGGCATATATTATGTGGG - Intergenic
1053120714 9:35545769-35545791 CTTGAATGCAGACACTGAGTTGG - Intronic
1054253576 9:62741501-62741523 ATGGATGGTAGATACTTTGTTGG - Intergenic
1054967435 9:71045430-71045452 CCTGAAGACAGATACTGTGCTGG + Intronic
1055411725 9:76037656-76037678 GTGGAAGAAAGATACTCTGTAGG + Intronic
1055582849 9:77726128-77726150 ATGGAAGGAAGTGACTGTGTGGG - Intronic
1055592094 9:77827589-77827611 CTGAAAGGCAGTTTCTGTATAGG - Intronic
1056812473 9:89775247-89775269 CTGGAATTCAGATACTGGGCAGG - Intergenic
1058070496 9:100596835-100596857 CTGGAATGCAGAAACTGAGGAGG - Intergenic
1062141973 9:134964298-134964320 CTGGCAGGCAGCTTCTGTCTTGG - Intergenic
1062741404 9:138177501-138177523 CTGCAAGGCAGAAGCTGTCTGGG + Intergenic
1186200582 X:7151828-7151850 TTGAAAGGCAGATGCTGAGTTGG - Intergenic
1186834645 X:13425464-13425486 CTGGAATTCATATACTGTGGTGG - Intergenic
1189244469 X:39552810-39552832 CTGGAAGGCAGATTCTGAGACGG - Intergenic
1190043135 X:47088351-47088373 CTGTGAGGCAGATAATGTGCAGG + Intronic
1191715258 X:64189970-64189992 CTGGAAGGCCCATAGTGAGTGGG + Exonic
1191894794 X:65980780-65980802 ATGAAAGGTGGATACTGTGTTGG - Intergenic
1192139673 X:68637040-68637062 CAGGAGGGCAGAGACTGTGTTGG + Intergenic
1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG + Exonic
1197446269 X:126554228-126554250 CTGGAAGGCAGCTGCTGGATTGG - Intergenic
1197503623 X:127274173-127274195 GTGGCAAGTAGATACTGTGTTGG - Intergenic
1200427776 Y:3040373-3040395 CTAGGAAGCAGATACTGTGATGG + Intergenic
1200687316 Y:6268019-6268041 GTGGAAGGAAGATGATGTGTGGG + Intergenic
1201047957 Y:9906691-9906713 GTGGAAGGAAGATGATGTGTGGG - Intergenic