ID: 928990678

View in Genome Browser
Species Human (GRCh38)
Location 2:37230668-37230690
Sequence TAGTAAGAAAGGAGGGCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928990678_928990688 21 Left 928990678 2:37230668-37230690 CCCTCGGCCCTCCTTTCTTACTA 0: 1
1: 0
2: 0
3: 13
4: 194
Right 928990688 2:37230712-37230734 CCTCTGCTACACTGGCATTTTGG 0: 1
1: 1
2: 1
3: 22
4: 188
928990678_928990686 13 Left 928990678 2:37230668-37230690 CCCTCGGCCCTCCTTTCTTACTA 0: 1
1: 0
2: 0
3: 13
4: 194
Right 928990686 2:37230704-37230726 TCACTCTGCCTCTGCTACACTGG 0: 1
1: 0
2: 4
3: 40
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928990678 Original CRISPR TAGTAAGAAAGGAGGGCCGA GGG (reversed) Intronic
903088225 1:20883323-20883345 TAGAAGGAAATGAGGGCCGGGGG + Intronic
905380746 1:37559765-37559787 GAGAAAGAAAGGTGGGCCCAGGG + Intronic
905943921 1:41885799-41885821 TAGGAAGGAAGGAGGGAAGAAGG - Intronic
906017877 1:42598498-42598520 CAATAAGAAAGGAGGGACAATGG + Intronic
906176349 1:43776715-43776737 TATTAAGAATGGAGGGCACAGGG - Intronic
909533348 1:76706212-76706234 CAGGAAGAAAGGAGGGAGGAAGG - Intergenic
910424849 1:87111149-87111171 TGGAAAGAAAGGAGAGCGGAGGG - Intronic
910852129 1:91658810-91658832 GAGTAAGAAATGAGGACAGAGGG - Intergenic
912955760 1:114153381-114153403 TAGTAATACAGGAGGGCCGGGGG + Intronic
914690944 1:150026300-150026322 TACTAAGAAAGAAGGCCAGATGG + Intergenic
915038105 1:152945427-152945449 TAGTAACTAAGGAGGGCCAGAGG - Intergenic
917189582 1:172400406-172400428 TAGGAAGAAAGGAGGGAAGGAGG + Intronic
918594143 1:186273602-186273624 TAGGAAGAAAGGAGGGATGAAGG - Intergenic
920513051 1:206565002-206565024 TAGGAAGAGAGGTGGGGCGAGGG - Intronic
921964698 1:221075965-221075987 TAGTGAGAAAGGAGGGCTGGAGG - Intergenic
922412162 1:225387509-225387531 TAGCAAGAGAAGAGGGCTGAAGG + Intronic
922905516 1:229170716-229170738 TGGTAAGAAAGGAGAGTCCAGGG - Intergenic
923552597 1:234976050-234976072 GAGGAAGAAGGCAGGGCCGAGGG + Intergenic
923836804 1:237619768-237619790 TAGAAAGTATGGAGGGCAGAAGG + Intronic
924191185 1:241554278-241554300 TAGAAAGAAAGAAGGGAGGAAGG - Intronic
924786145 1:247201861-247201883 TCATAAGAAAGGAGGGGGGAAGG + Intergenic
1063242612 10:4186969-4186991 TAGAAAGAAAGGTAGGCCGATGG + Intergenic
1066299769 10:34086583-34086605 GAGTAAGAAAGGAGGGAGGAAGG + Intergenic
1070100474 10:73381343-73381365 TAGGAAGAAAGGAAGGAGGAAGG + Intronic
1071134966 10:82443136-82443158 GAGTAAGAAAGAAGGGGAGAGGG + Intronic
1072625617 10:97109409-97109431 AAGGAAGAAAGTAGGGCAGAAGG + Intronic
1072925606 10:99613832-99613854 TTATAAGAACGGAGGGCCTATGG - Exonic
1072944011 10:99793450-99793472 TGGGAAGAAAGGAGGGCTGAGGG - Intronic
1073662643 10:105493846-105493868 TATTAAGAAAGGAGGATGGAGGG + Intergenic
1074011530 10:109486452-109486474 TAGTAGGAAAAGATGGCCTAGGG - Intergenic
1074749155 10:116567101-116567123 GAGAAAGAAAGGAGGGAGGAAGG - Intronic
1076295109 10:129378054-129378076 TGGAAAGAAAGGAGGGCTGGGGG + Intergenic
1078188412 11:9071909-9071931 TAGGAACAAAGGCGGGCCGGGGG + Intronic
1078401039 11:11027395-11027417 TAGTAAGAAACGATGGCCTGAGG - Intergenic
1079583349 11:22093906-22093928 AGGGAAGAAAGGAGAGCCGAAGG + Intergenic
1087920595 11:103862433-103862455 TCAAAAGAAAGGAGGGCTGAGGG - Intergenic
1089395037 11:118131204-118131226 TGGTAAGGAAGGAGGGTAGATGG - Intergenic
1090464466 11:126921926-126921948 TAGGAAGACAGGAAGGCGGATGG - Intronic
1091632493 12:2172565-2172587 TAGGAAGAAAGGAGGACCCACGG + Intronic
1091714750 12:2768793-2768815 GAGTGAGGAGGGAGGGCCGAGGG - Intergenic
1091899974 12:4136734-4136756 GAGGCAGAAAGGAGGGCCCAGGG - Intergenic
1095970155 12:47896322-47896344 GAGCAAGAAAGGAGGGTTGAAGG - Intronic
1097059920 12:56275140-56275162 AAGTAAGAAGGGAGAGCCAAGGG + Intronic
1098307763 12:69118552-69118574 TAGGAAGAAGGGAGTGCCTATGG - Intergenic
1102453653 12:113058064-113058086 GAGTTAGAAAGGAGGCCAGACGG + Exonic
1102800204 12:115725724-115725746 TAGCAAGAGAAGAGGGCCTATGG + Intergenic
1102864735 12:116365307-116365329 GAGGAAGAAGGGAGGGCAGAAGG - Intergenic
1103767079 12:123287915-123287937 GAGTAAGAAATAATGGCCGAAGG - Intergenic
1106631807 13:31481921-31481943 AAGAAAGAAAGGAGGGGGGAGGG + Intergenic
1107739512 13:43434353-43434375 CAGGCAGAAAGGAAGGCCGAAGG - Intronic
1108086994 13:46803894-46803916 TAGAATGAAAGGAGGGCAGGTGG + Intergenic
1112317108 13:98372619-98372641 TAATAAGAAAAGAGGGAAGATGG + Intronic
1113664097 13:112128815-112128837 AAGGAAGAAAGGAGGGAAGAAGG - Intergenic
1115374665 14:32661096-32661118 TAGGTAGAAAGGAGGTCAGAAGG + Intronic
1118605040 14:67496675-67496697 TAGGAAGAAAGGAGGGAGGAAGG - Intronic
1118733043 14:68682725-68682747 TAGGAAGAAAGCAGGGACGTGGG + Intronic
1121381919 14:93479284-93479306 AAGAAAGAAAGAAGGGACGAAGG - Intronic
1121786978 14:96669312-96669334 TAGAAAGAATGGAGGTCAGAGGG + Intergenic
1121928835 14:97953578-97953600 AAGAAAGAAAGGAGGGCGGGAGG - Intronic
1122740270 14:103868098-103868120 GAGTTGGAATGGAGGGCCGAGGG - Intergenic
1123457139 15:20436455-20436477 TGGGAAGGAAGGAGGGCCGCAGG + Intergenic
1123660923 15:22563904-22563926 TGGGAAGGAAGGAGGGCCGCAGG - Intergenic
1123988865 15:25668486-25668508 AAGGAAGAAAGGAGGGATGAGGG - Intergenic
1124263293 15:28211608-28211630 TGGGAAGGAAGGAGGGCCGCAGG + Intronic
1124314724 15:28658138-28658160 TGGGAAGGAAGGAGGGCCGCAGG - Intergenic
1125278328 15:38017268-38017290 TAGTAAAGAAGGAGGGGTGATGG + Intergenic
1126547189 15:49886395-49886417 AAGGAAGAAAGGAGGGAGGATGG + Intronic
1128193685 15:65729557-65729579 TAGTAAGCACGGATGGCCGTAGG + Exonic
1128585199 15:68843168-68843190 TAGAAAGAAGGGAGGGGGGAAGG + Intronic
1130720118 15:86378383-86378405 TGGCAAGAGAGGAAGGCCGATGG - Intronic
1131146380 15:90016182-90016204 TAGAAAGAAAGGAGGGTAGGCGG + Intronic
1132288830 15:100685327-100685349 TACTCAGAAAGGAGGGCGGAAGG + Intergenic
1133717928 16:8467053-8467075 AAGAAAGAAAGGAGGGAGGAAGG + Intergenic
1133826745 16:9284717-9284739 AAGAAAGAAAGGAGGGAGGAAGG - Intergenic
1135521191 16:23179673-23179695 TAGGAAGAGACGAGGGCAGAGGG + Intergenic
1138486684 16:57349779-57349801 AAGAAAGAAAGGAGGGAAGAAGG - Intergenic
1140306446 16:73807308-73807330 AAGGAAGAAAGGAGGGAAGAAGG - Intergenic
1140410130 16:74736314-74736336 TAGAGAGAAAGGAGGCCCAAGGG + Intronic
1140604775 16:76522566-76522588 GAGAAAGAAAGGAGGGCGGCAGG - Intronic
1143223527 17:5281912-5281934 GAGTAAGAGAGGAGGACCGATGG - Intergenic
1144788437 17:17844491-17844513 TAGAAAGACAGGAGGACAGACGG + Intronic
1146145789 17:30415031-30415053 TAGTAAGAGAAGAGGACCAAAGG + Intronic
1147914103 17:43876542-43876564 TTATAAGAAATGAGGGCTGATGG + Intronic
1151276531 17:73038733-73038755 GAGAAAGAAAGGAGGGAGGAGGG + Intronic
1151393266 17:73802040-73802062 TGGGAAGAGAGGAGGGCCAAGGG - Intergenic
1151732754 17:75920956-75920978 CAGTCAGAAAGCAGGGCCGCAGG - Intronic
1151992406 17:77584655-77584677 TAATAATAAAAGAGGCCCGAGGG - Intergenic
1153583625 18:6599739-6599761 TAGTAGGAAATGAGGTCAGAAGG + Intergenic
1154234285 18:12589392-12589414 TACTAAGGAAGGAGGTCTGAAGG + Intronic
1155112472 18:22729658-22729680 GAGGAAGGAAGGAGGGCAGAAGG - Intergenic
1155685484 18:28543348-28543370 AAGAAAGAAAGGAGGGAGGAAGG - Intergenic
1158103825 18:53861488-53861510 GAGGAAGAAGGGAGGGCAGAAGG + Intergenic
1160053872 18:75461620-75461642 TAGGAAGAAAGGAGGGAGGGAGG - Intergenic
1160469656 18:79117592-79117614 TAGTTGGAAAGGAGGTCAGAGGG + Intronic
1164757399 19:30700358-30700380 AAGTAAGAAAGGAGGAAGGAAGG - Intronic
925102025 2:1255269-1255291 TAAAAGGAAAGGAAGGCCGAGGG - Intronic
925895180 2:8465875-8465897 TTGTAAGAAAGGGGGGCTGACGG + Intergenic
926244540 2:11113352-11113374 GAGGAAGAAAGGAAGGGCGAAGG - Intergenic
926913453 2:17872280-17872302 AAGGAAGAAAGGAGGGAGGAAGG - Intergenic
928990678 2:37230668-37230690 TAGTAAGAAAGGAGGGCCGAGGG - Intronic
930398824 2:50857213-50857235 TATTAAGAAAGGAGAGAAGAGGG + Intronic
931254608 2:60558749-60558771 AAGAAAGAAAGGAGGGAGGAAGG + Intergenic
937539507 2:122931259-122931281 CAGTGAAAAAGGAGGGCAGAAGG + Intergenic
937934875 2:127235281-127235303 AAGAAAGAAAGGAGGGCGGGAGG + Intergenic
938838612 2:135135815-135135837 TGGCAAGAAAGGAGGACCTAAGG + Exonic
941800430 2:169653332-169653354 TAGTAAGAGAAGAGGTCTGAGGG + Intronic
942529979 2:176899453-176899475 TAGTAAGAAAGGTTGGGTGATGG - Intergenic
945487457 2:210414122-210414144 TAGGAAGAAAGGAAGTCAGAAGG - Intergenic
945508964 2:210676868-210676890 TAGCAATAGAGGAGGGCAGATGG + Intronic
946399181 2:219459862-219459884 CAGTAAGGAAGGAGGGCTGGGGG - Intronic
1168990947 20:2095302-2095324 TCGTGTGAAAGGAGGGCCAATGG + Intergenic
1172782720 20:37446787-37446809 TGGAAAGAAAGGAGGGAAGAAGG - Intergenic
1178158453 21:29882459-29882481 TGGGAAGAAAGGAGGGCTGGTGG + Intronic
1179131789 21:38643995-38644017 GAGAAAGAAAGGAGGGGAGAGGG - Intronic
1179599586 21:42467305-42467327 TTGGAAGAAAGGAGGGCAGCAGG + Intergenic
1179838706 21:44055952-44055974 TAGAAAGAAAGGAGGAGAGAGGG - Intronic
1180765124 22:18341688-18341710 TAGCCAAAAAGGAGGGCAGAGGG - Intergenic
1180813905 22:18777996-18778018 TAGCCAAAAAGGAGGGCAGAGGG + Intergenic
1181200090 22:21212331-21212353 TAGCCAAAAAGGAGGGCAGAGGG + Intronic
1181701645 22:24624628-24624650 TAGCCAAAAAGGAGGGCAGAGGG - Intronic
1203226746 22_KI270731v1_random:82593-82615 TAGCCAAAAAGGAGGGCAGAGGG - Intergenic
1203264004 22_KI270734v1_random:3683-3705 TAGCCAAAAAGGAGGGCAGAGGG + Intergenic
951728999 3:25790168-25790190 AAGGAGGAAAGGAGGGGCGAAGG - Intronic
952838349 3:37623974-37623996 TAGTAAGAAAGGATGGAGGATGG + Intronic
956838782 3:73117725-73117747 CAGAAAGAAAGGAGGGAAGAGGG - Intergenic
957305653 3:78455635-78455657 TAGTACGAAAGAAGGGAAGAGGG - Intergenic
959934499 3:112015130-112015152 AAGTAAGAGAGGGAGGCCGATGG + Intergenic
961444807 3:126974802-126974824 TACTGTGAAAGGAGGGCCAAAGG - Intergenic
962128698 3:132649678-132649700 TAGAAAGAAAAGTGGGCCCAGGG - Intronic
962962303 3:140321884-140321906 TCGTAGGAAAGGAGGACTGAAGG + Intronic
963553443 3:146754696-146754718 AAGAAAGAAAGGAGGGACGGAGG - Intergenic
966457428 3:180133675-180133697 CAGTGAGAAAGGAGAGCGGAAGG - Intergenic
967150326 3:186642837-186642859 TAGCAAGAAAGGAAGCCTGAGGG - Intronic
967350704 3:188511125-188511147 TAGGAAGAAAGGAGGGAAGCAGG - Intronic
971917051 4:32884747-32884769 AAGAAAGAAAGGAGGGAGGAAGG - Intergenic
972353060 4:38255030-38255052 AAGGAAGAAAGGAGGGAAGAAGG + Intergenic
973212804 4:47635690-47635712 TAGTAAGAAAAGAAGACCAAAGG + Intronic
973583591 4:52369630-52369652 TTGTTAGAAATGAGAGCCGATGG - Intergenic
977594257 4:98861244-98861266 TAGAAAGAAATGAGGTCAGAAGG - Intergenic
983545716 4:168961889-168961911 TAGAAAGAAAGGAAGGGAGAGGG + Intronic
983822207 4:172209412-172209434 TTCTAAGAAAGGAGGACCCAGGG + Intronic
986627017 5:9731602-9731624 TATTAAGTAAGGAGTGCTGAAGG - Intergenic
988424676 5:31049743-31049765 TAGTAGGAAAGGTGGGAGGAAGG - Intergenic
990695201 5:58408733-58408755 GAGTAAGGAAGGAGTGCCAAGGG - Intergenic
993527771 5:88987715-88987737 AAGTAAGAAAGGAGGGAGAAAGG - Intergenic
993719783 5:91310986-91311008 AAGGAAGAAAGGAGGGCGGAAGG - Intergenic
995650891 5:114366699-114366721 AAGTAAAAAAGGAGGGCGGGGGG - Intronic
999246340 5:150156906-150156928 TAGGAAGAAAGCAGGGCAGGGGG - Intergenic
1000038345 5:157466020-157466042 AAGGAAGAAAGGAGGGAGGAGGG + Intronic
1000905181 5:166957592-166957614 TAGGAAGAAAGTGGGGCCAAGGG + Intergenic
1003637874 6:7850430-7850452 TAGTAAGGAGGGAGGGATGAAGG - Intronic
1004294079 6:14394580-14394602 TAGCATGAAAGGAGGGCAGGAGG - Intergenic
1004346345 6:14852706-14852728 TAGTAAGAAAGAAGGGTGGGAGG + Intergenic
1006687787 6:35851792-35851814 CAGGAAGAGAGGAGGGCCAAGGG + Intronic
1008410748 6:51175794-51175816 TATTAAGAAAGGAGGATGGATGG + Intergenic
1010163621 6:72889460-72889482 TGGCAAGAAAGGAGGGTGGAAGG - Intronic
1011855762 6:91688565-91688587 TAGAAAGCAAGGAGGGCGAAGGG - Intergenic
1013419481 6:109952908-109952930 ATGTAAGAAAGCAGGGCAGAAGG + Intergenic
1013658992 6:112275440-112275462 TAGCAAGAAAGGAGGGAGAATGG + Intergenic
1013844421 6:114432620-114432642 GAGTAAGAAAGGAGGGGTGGAGG + Intergenic
1015680897 6:135807462-135807484 TATTAATAAAGCAGGGCTGATGG + Intergenic
1017225018 6:152010936-152010958 TAGGAAGAAAGGAAGGAAGAAGG - Intronic
1017785339 6:157752307-157752329 GAGAAAGAAAAGTGGGCCGAGGG + Intronic
1018328556 6:162702482-162702504 TAGTAGGTAGGGAGGGCTGAGGG - Intronic
1018386145 6:163305048-163305070 CACAAAGAAAGGAGGGCCAAGGG + Intronic
1023171720 7:37396181-37396203 TAGGAAGAAAGGAGGCTCAAAGG - Intronic
1024673167 7:51615142-51615164 TAGAAAGGAAGCAGGGCAGATGG + Intergenic
1024696070 7:51857851-51857873 AAGAAAGAAAGGAGGAACGAGGG + Intergenic
1026157813 7:67842587-67842609 TAGAAAGAAAGGAGGGACAGAGG + Intergenic
1026394249 7:69935603-69935625 GAGTAAGAAAGGAAGGTCTAAGG + Intronic
1027710493 7:81594990-81595012 TTAGAAGAAAGGAGGGCAGAGGG - Intergenic
1029135395 7:98366876-98366898 AAGGAAGAAAGGAGGGAAGAAGG - Intronic
1033922336 7:146409890-146409912 TAGTATGAAAGCAGGGCAGTGGG + Intronic
1034000440 7:147406711-147406733 GAGTAAGAAAGGAATGCAGATGG + Intronic
1034818840 7:154198229-154198251 TAGTAAGACAGAATGGGCGAAGG - Intronic
1034942890 7:155243348-155243370 TAGTAAGGAGGGAGTGCAGAAGG + Intergenic
1034995135 7:155572169-155572191 AAGGAAGAAAGGAGGGAGGAAGG + Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414134 7:158668379-158668401 TAATAGGTAAGGAGGGCGGAGGG - Intronic
1035862043 8:3039428-3039450 AAGGAAGAAAGGAGGGAGGAAGG - Intronic
1036191102 8:6671163-6671185 TAGGAAGAAAAGAGAGCAGAGGG + Intergenic
1036497264 8:9280675-9280697 TAATAAGAAAGCAGAGCCCATGG + Intergenic
1038357317 8:26841373-26841395 GAGTAAGAAAGGAGGTGCAAGGG - Intronic
1038652706 8:29420244-29420266 TAGAAAGAAAGAAGGGAGGATGG - Intergenic
1038720451 8:30030675-30030697 GAGAAAGAAAGGAGGGAGGAAGG + Intergenic
1039973565 8:42340591-42340613 AAGTAAGAAAAGAGGGCTAAGGG - Intronic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043195476 8:77287297-77287319 GAGGATGAAAGGAAGGCCGAGGG + Intergenic
1044563346 8:93636242-93636264 TACCAAGAAAGGAGGGAGGAAGG + Intergenic
1046518875 8:115299336-115299358 TAGAGAGAAAGGAAGGCCTAGGG - Intergenic
1048100161 8:131342433-131342455 AAGTAAGAAAGGAGGGAACAGGG - Intergenic
1048426576 8:134329114-134329136 GAGGAAGAAAGGAGGGCCTGGGG - Intergenic
1050340955 9:4638176-4638198 TAGGAAGACAGGAGGGAAGATGG + Intronic
1051134432 9:13902289-13902311 AAGGAAGAAAGGAGGGCAGGGGG + Intergenic
1056253467 9:84774246-84774268 AAGTCAGAAACGAGGGCCAATGG + Intronic
1059360470 9:113738262-113738284 AAGAAAGAAAGGAGGGAAGAAGG - Intergenic
1061203756 9:129151518-129151540 TAGTTGCAAAGGAGGGCGGAAGG + Intergenic
1061788215 9:133043704-133043726 TAGAAAGAGAGGTGGGCAGATGG - Intronic
1199650877 X:149945259-149945281 GAGGAAGAAAGGAGGACAGAAGG + Intergenic