ID: 928992757

View in Genome Browser
Species Human (GRCh38)
Location 2:37252234-37252256
Sequence TTTTTAGCAGGGCCAGTGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928992757_928992761 3 Left 928992757 2:37252234-37252256 CCCTGCACTGGCCCTGCTAAAAA 0: 1
1: 0
2: 1
3: 15
4: 141
Right 928992761 2:37252260-37252282 GAAATTACTGACTGAACCCTAGG 0: 1
1: 0
2: 1
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928992757 Original CRISPR TTTTTAGCAGGGCCAGTGCA GGG (reversed) Exonic
900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG + Intronic
900778306 1:4600759-4600781 TTCTTTGCAGGCCCTGTGCAGGG - Intergenic
904078685 1:27858474-27858496 TTTGGAGCAGGGACGGTGCAGGG + Intergenic
904513654 1:31035954-31035976 TGTTTCGCAGTGCCAGTGCCTGG - Intronic
904974770 1:34447615-34447637 TTTCTAGAAGGGTGAGTGCAGGG + Intergenic
906046924 1:42838334-42838356 TGTCTAGCAGGGCCAATGCTGGG + Intronic
909127961 1:71699031-71699053 TTTTTTTCAAGGCCTGTGCAAGG - Intronic
910743645 1:90549442-90549464 TTTTTAGACGGCCCAGTGAAAGG - Intergenic
912472952 1:109918256-109918278 TTATCAGCATGGCCAGAGCATGG + Intronic
913699461 1:121360627-121360649 TTGGTAGCAGGGCCAGTGCTAGG - Intronic
914138084 1:144919409-144919431 TTGGTAGCAGGGCCAGTGCTAGG + Intronic
914972703 1:152325264-152325286 TTTATAGCAGGCCCCATGCAGGG + Intergenic
916259176 1:162823238-162823260 TTATTTGCATTGCCAGTGCAGGG + Intergenic
917299561 1:173559457-173559479 TTTTCAGCAAGGCCAATGCATGG + Intronic
918029044 1:180785328-180785350 TTTTTAGCAGAGACAGGACAGGG + Intronic
920486870 1:206379335-206379357 TTGGTAGCAGGGCCAGTGCTAGG - Intronic
923730608 1:236546187-236546209 TTTTTTGCAGAGACAGTGAAAGG + Intronic
1063962152 10:11315466-11315488 TTTCTACCAAGTCCAGTGCAAGG - Intronic
1064138640 10:12771731-12771753 TTTTTGAAAGGTCCAGTGCATGG + Intronic
1064255949 10:13742884-13742906 GTTTTAGCAAGGCCAGTGTTGGG + Intronic
1065489102 10:26264898-26264920 GTTTCAGCAGGGCCAATGAACGG + Intronic
1066234514 10:33472076-33472098 TGGTTAGCAGGGCCAGGGAAGGG - Intergenic
1067440934 10:46308928-46308950 CTTTCAGCAGGGCCAGAGAAAGG + Intronic
1068194649 10:53699943-53699965 TTTTTAGCAAAGACAGTTCAAGG - Intergenic
1072267431 10:93744064-93744086 TTTTTTGCAGGGGCAGTAGAGGG - Intergenic
1076112497 10:127871902-127871924 TGTTTACCAGGGCAAGTGAAGGG + Intergenic
1078437590 11:11338279-11338301 TTTTAAGCAGGGCGATGGCATGG + Intronic
1078444699 11:11395418-11395440 TATGTAGCAGGGCCTGTGCTAGG + Intronic
1083865070 11:65449235-65449257 TTTTCTGCAGGGCCAGAGAAAGG + Intergenic
1084951769 11:72670319-72670341 TGTTTGGTAGGGCCAGTGAACGG + Intronic
1085338156 11:75713189-75713211 GTGTTAGCAGAGCCAGTCCATGG - Intergenic
1087049478 11:93870839-93870861 TGTCTAGCACTGCCAGTGCACGG - Intergenic
1087370593 11:97279241-97279263 CTTTGAGGAGGGACAGTGCAGGG + Intergenic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090858807 11:130634713-130634735 ATCTTAGCAGGGACAGTGCCTGG + Intergenic
1094021621 12:25920648-25920670 TTTTAAGAAGTGTCAGTGCAGGG - Intergenic
1095741557 12:45612110-45612132 TTTTTATCAGGACCAGTACTAGG - Intergenic
1097535164 12:60860076-60860098 TTTTTAGCAGGGCCATTTGTTGG - Intergenic
1100691060 12:97038860-97038882 TTCTTAGAAAGGCCAGTGAAGGG + Intergenic
1102095031 12:110232300-110232322 TTTATACCAGGGCCGGGGCATGG + Intergenic
1102933276 12:116878558-116878580 ACTTGATCAGGGCCAGTGCAGGG + Intronic
1107439712 13:40415083-40415105 TCTTGAGCAGGGCCAGTTTATGG + Intergenic
1107723103 13:43270145-43270167 TTTTAAGCAGGGCCACTGTATGG + Intronic
1108589565 13:51901303-51901325 TTTTTAGCAGGTCAAATGCCAGG - Intergenic
1109034459 13:57237069-57237091 TGGTTAGCAGGGCCTGTGAAGGG + Intergenic
1109316637 13:60757030-60757052 CTTTGAGCATGGCCAGTGCTTGG + Intergenic
1111828090 13:93294445-93294467 TTTTTTGCAGGGGCAGGGGATGG - Intronic
1112877463 13:104062042-104062064 TTCCTAGCAGAGGCAGTGCAGGG - Intergenic
1118059724 14:62122297-62122319 TCATTAGCAGGGCCAGATCACGG + Intergenic
1121850475 14:97217878-97217900 TTTTTCCCAGGGCCTGTGGAGGG + Intergenic
1123436787 15:20260447-20260469 TTTTTAGGAGTGTCAGTGAAAGG - Intergenic
1125712592 15:41798875-41798897 TCTTGAGCAGAGCCAGTGCAGGG + Intronic
1129200916 15:73998753-73998775 TTTTTAGAAGTGCCACTGCTGGG + Intronic
1130084021 15:80762172-80762194 TTTTTAGGTGTGCCAGTTCAGGG + Intergenic
1131966850 15:97853332-97853354 TTTTCTGCAAGGCCTGTGCACGG + Intergenic
1134477475 16:14588391-14588413 TTTTCAGCAGGGTCAGTGACAGG + Intronic
1136105045 16:28024393-28024415 TTTAGAGCAGGGCCACTGCCGGG + Intronic
1139707807 16:68753827-68753849 TATTTGGCAGGGGCAGGGCACGG + Intronic
1140187935 16:72790972-72790994 TGTCTAGCATGGCTAGTGCAAGG - Intronic
1141152733 16:81575404-81575426 TTTCTAGCAGGCTCAGAGCAGGG + Intronic
1143420000 17:6781299-6781321 GTTATAGCAGTGCCAGTGCCTGG + Intronic
1144362143 17:14505730-14505752 TTGTTCTCAGGGCCAGGGCAAGG - Intergenic
1146557012 17:33834258-33834280 TTCATAGCAGAGCCAGGGCAGGG + Intronic
1147613401 17:41814070-41814092 TTGTTAGCGGGGACAGGGCAGGG + Intronic
1151784270 17:76267522-76267544 TTTTGAGAAAGGCCAGGGCAGGG + Intronic
1151960008 17:77400824-77400846 TGGTTATCAGGGCCAGAGCAGGG - Intronic
1153314996 18:3712585-3712607 TTTTAAGCAGGCCCATTACAGGG + Intronic
1153545872 18:6204234-6204256 TTCTTGGCACGGCCAGTGCTAGG - Intronic
1154406658 18:14098112-14098134 TTTTCAACAGGGACAGTGAAAGG - Intronic
1156007079 18:32454737-32454759 TTTTTAGCAGGTTCTGGGCAAGG - Intronic
1158467083 18:57700102-57700124 TTCTTAGCAGGGCTACTGGAAGG - Intronic
1159438388 18:68446867-68446889 GTTTTAGCAGGTCCAGGCCACGG - Intergenic
1160382556 18:78471755-78471777 TCTCCAGCAGGGCCAGGGCATGG + Intergenic
1162551995 19:11363114-11363136 TTTTTAGCAGGGACAGGGTTTGG - Intronic
1164876592 19:31694936-31694958 ATTTTAGCGAGGCCAGTGGAGGG - Intergenic
1165394519 19:35557134-35557156 TTCTTAGCAGGGCCAGGAAATGG + Intronic
925193870 2:1907908-1907930 TCTCACGCAGGGCCAGTGCAGGG + Intronic
926162334 2:10497903-10497925 TTCTTAGCAGGATCATTGCAGGG - Intergenic
928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG + Intronic
928992757 2:37252234-37252256 TTTTTAGCAGGGCCAGTGCAGGG - Exonic
931697083 2:64879472-64879494 ATTTCAGCAGGGCGAGTCCAGGG + Intergenic
932079184 2:68695985-68696007 GTTTTAGCATGGCGAGAGCATGG + Intronic
933312301 2:80675959-80675981 TTCTGAGGAGGGCCAGTGGAGGG + Intergenic
933798226 2:85938237-85938259 TTGTTAGCAAGGTCAGTGTAGGG - Intergenic
934322308 2:91981456-91981478 TTCATGGCAGGGCCAGTGCCAGG - Intergenic
935932163 2:108139076-108139098 TTCAAATCAGGGCCAGTGCATGG - Intergenic
937829401 2:126403258-126403280 TTTGTAGCAGGGCCTGGGCATGG + Intergenic
940258562 2:151757807-151757829 GTTTAAGCAGGGCCACTGGAGGG - Intergenic
942168614 2:173267046-173267068 TGGTTAGCAGGGCCAGGACAAGG + Exonic
943063741 2:183065301-183065323 TTTTTAGTAGAGACAGGGCAGGG - Intergenic
945789878 2:214291927-214291949 TTTCTTGTAGGGCCAGTGAAGGG + Intronic
946601082 2:221361062-221361084 TTTTTATCAGAGCTAGTGAACGG - Intergenic
1171522639 20:25787325-25787347 TTTTTTGCAGAGCAAGGGCAGGG + Intronic
1171554188 20:26068558-26068580 TTTTTTGCAGAGCAAGGGCAGGG - Intergenic
1172128334 20:32638791-32638813 TTCTCTCCAGGGCCAGTGCATGG - Intergenic
1172444119 20:34984390-34984412 CTTGGAGCAGGGCCACTGCATGG + Intronic
1174663141 20:52232961-52232983 TGTTTAGCAGGGCGTGTGAAAGG + Intergenic
1176937935 21:14888158-14888180 TTTTTAAAAGGGCAAGTGCATGG - Intergenic
1176947901 21:15006268-15006290 GTTTTAGCATTACCAGTGCATGG + Intronic
1179597190 21:42450778-42450800 TGTTTGCCAGGGCCAGTGCTTGG - Intergenic
1180917484 22:19499229-19499251 TTTTTAGCAGGGTCCCTGTAGGG + Intronic
1182662149 22:31932889-31932911 TTTTAAGCAGGGCGAGGACAAGG + Intergenic
1185053296 22:48564893-48564915 TTTTTTGCAGGGCCACTGGGGGG - Intronic
954517847 3:51195785-51195807 TTTTTTGTAGGGCCAGTCCAGGG + Intronic
956203104 3:66728101-66728123 ATATTAGCTGGGCAAGTGCAAGG - Intergenic
959750961 3:109834476-109834498 ATTTTATCTTGGCCAGTGCATGG - Intergenic
959944328 3:112111409-112111431 GTTCTAGCTGGGCCAGTCCAGGG - Intronic
960901166 3:122555810-122555832 CTTTTACCAGGGCCAGGGCCAGG + Exonic
964822088 3:160781891-160781913 ATTTTAGCAGAGCCACTGCTGGG - Intronic
965409209 3:168308542-168308564 TTCCTAGCAGGGTCCGTGCATGG + Intergenic
965508317 3:169540494-169540516 TTTTAAGCAGGGCCATGACATGG - Intronic
966569176 3:181421767-181421789 TGATTAGAAGGGGCAGTGCAGGG + Intergenic
967554476 3:190838395-190838417 TTATTACCTCGGCCAGTGCAGGG + Intergenic
969725818 4:8917528-8917550 CTTTTAGCAGGGCCTTTGGATGG + Intergenic
972602862 4:40588020-40588042 TTTTTTGCCTGGCCAGTTCATGG + Intronic
972663931 4:41145679-41145701 TTATCAACAGGGCCAGTGCTAGG - Intronic
972692883 4:41416935-41416957 TTTTTTGCAGGCCAAGTGCAGGG - Intronic
976784929 4:88808034-88808056 TTTTTCTCAGGGACTGTGCATGG - Intronic
981069251 4:140517587-140517609 TTTTTTGAAGGGCAAGTGAAGGG - Intergenic
983199152 4:164842096-164842118 TTTTTACCAGGTACAGTGCTAGG + Intergenic
996070462 5:119125435-119125457 ATTTTAGCAGGGCCACTATATGG + Intronic
996409953 5:123147470-123147492 TTTGTAGCAGGGCCTGTGGATGG + Intronic
998074955 5:139228345-139228367 TTATTAGGAGAGCCAGGGCAAGG - Intronic
999937258 5:156500977-156500999 CTCTCAGCATGGCCAGTGCAGGG - Intronic
1001187461 5:169588695-169588717 TTTTTAACAGGGACGGGGCAGGG - Intronic
1003307423 6:4942312-4942334 TTTTTGGCAGGGGCAGGTCAGGG - Intronic
1005516147 6:26556250-26556272 GTTTTGGGAGTGCCAGTGCAGGG + Intergenic
1006912391 6:37571880-37571902 TTTTTATGAGGGCCAATGCAAGG - Intergenic
1013536380 6:111066620-111066642 TCTGTAGCAGGGCAAGAGCAGGG + Intergenic
1014030804 6:116701487-116701509 TTATTAACAGAGCCAGTGCTGGG - Intronic
1014158156 6:118135966-118135988 CTTCTCGCAGGCCCAGTGCATGG - Intronic
1015513559 6:134062693-134062715 TTTTTATCAGGGTCAGGGCAGGG + Intergenic
1015527500 6:134187529-134187551 TTTTTTGCATGGCTGGTGCAAGG - Intronic
1018837828 6:167498420-167498442 CTCCTAACAGGGCCAGTGCACGG - Intergenic
1019404045 7:873685-873707 CCTTTAGAAGAGCCAGTGCAAGG - Exonic
1020372846 7:7453364-7453386 TTCTGATCAGTGCCAGTGCAAGG - Intronic
1023016596 7:35974355-35974377 ATTTTAGCAGGGCCAATATATGG - Intergenic
1023477654 7:40598454-40598476 TCTTTAGAAAGGCCAGTGGAGGG + Intronic
1025283117 7:57642525-57642547 TTTTTTGCAGAGCAAGGGCAGGG + Intergenic
1031513229 7:122673803-122673825 GTTTGAGGAGTGCCAGTGCACGG - Intronic
1032661115 7:133984767-133984789 TTTGTTGCAGGCACAGTGCAAGG + Intronic
1034333485 7:150304675-150304697 TTTTGAGATGGGGCAGTGCATGG - Intronic
1034664558 7:152805215-152805237 TTTTGAGATGGGGCAGTGCATGG + Intronic
1038375984 8:27040950-27040972 TTTGTAGCAGGGCAAGTCAAAGG - Intergenic
1040387226 8:46921687-46921709 ATTTCAGCAGAGCCAGTGCATGG - Intergenic
1045032403 8:98149869-98149891 TTTTTAGCATGCCTAGTGCAAGG + Intronic
1049538602 8:143194713-143194735 TGTTGCTCAGGGCCAGTGCAGGG + Intergenic
1049538616 8:143194760-143194782 TGTTGCTCAGGGCCAGTGCAGGG + Intergenic
1052464372 9:28811427-28811449 TTTTAAGCAAGGCCACTACAAGG - Intergenic
1056787576 9:89604084-89604106 CTTGTAGCAGGGCCAGTACTGGG + Intergenic
1060816923 9:126639857-126639879 TCTTTAGCAGGGCCTCTCCAGGG + Intronic
1185641894 X:1592950-1592972 GTTTTATCAGGGCAAGTACAGGG + Intronic
1187123098 X:16428067-16428089 TTTTTAGAAGTTCCACTGCAGGG + Intergenic
1188216735 X:27488222-27488244 TTTTTAGGAGGGGAAATGCAAGG - Intergenic
1188691009 X:33129352-33129374 TTTTTAGTAGATCCAGTGCCCGG + Intronic
1190318779 X:49167164-49167186 TTTTTAGCCCGGCCCGTCCAGGG - Intronic
1190471658 X:50786561-50786583 TTCTTAGCAGGGTAACTGCAAGG - Intronic
1201630268 Y:16063864-16063886 TCTTTACCAGGGCCAGGCCATGG + Intergenic