ID: 928994196

View in Genome Browser
Species Human (GRCh38)
Location 2:37269347-37269369
Sequence TCACACATACAGATGTTTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928994196 Original CRISPR TCACACATACAGATGTTTGT CGG (reversed) Intronic
900566770 1:3336470-3336492 ACATACATACACATGTGTGTTGG + Intronic
900688822 1:3966942-3966964 GCACACATACAGGTGACTGTGGG - Intergenic
901750477 1:11404079-11404101 TCCTGCATACAGATATTTGTTGG + Intergenic
902789043 1:18752679-18752701 TCTCACATTCACAGGTTTGTGGG + Intergenic
903430655 1:23296272-23296294 ACAGACATACAGATGTTGCTTGG - Intergenic
904943861 1:34184733-34184755 TAGCACAAAGAGATGTTTGTTGG - Intronic
905229972 1:36508963-36508985 TCATACGGAGAGATGTTTGTGGG - Intergenic
905909260 1:41642582-41642604 TAATACATACAAATGTGTGTGGG + Intronic
905944878 1:41893185-41893207 ACCCACATACAGAAGCTTGTCGG + Intronic
906076674 1:43056933-43056955 CCACACATACAGTTAGTTGTAGG + Intergenic
906615051 1:47228278-47228300 TCACAAACACTGATGGTTGTTGG + Intronic
908009471 1:59761334-59761356 TCACACATAGCTATGTTAGTAGG - Intronic
908899604 1:68941192-68941214 TCCCACATTCTCATGTTTGTTGG - Intergenic
908911046 1:69072511-69072533 ACACACACACAGAGGTTTATTGG + Intergenic
909197546 1:72647212-72647234 TCACTCATATAGTTGTTAGTAGG + Intergenic
910245942 1:85138210-85138232 TCACATATACAGATGAGTTTGGG - Intergenic
910712333 1:90194753-90194775 ACACACATACATGTGATTGTTGG + Intergenic
910998918 1:93141125-93141147 TAAGACATAAAGATTTTTGTTGG - Intergenic
915192132 1:154160315-154160337 TCACATATGCAGATGATTTTAGG - Intronic
916754555 1:167756501-167756523 TCACACAGAAAGATGATTCTTGG + Intronic
917561381 1:176160808-176160830 GCACACTTAAAGATGTATGTGGG - Intronic
919384249 1:196898832-196898854 TCACTCACACAGATTTTGGTAGG + Intronic
919971107 1:202579701-202579723 TCACAGAAATAGATGCTTGTTGG - Intronic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
924459555 1:244246545-244246567 TCTCTCATAAAGATGTTTGAAGG + Intergenic
924848922 1:247803829-247803851 GCACACATACACATGTATGTGGG + Intergenic
1066492680 10:35908661-35908683 TCTCAGATCCAGATATTTGTGGG - Intergenic
1067137085 10:43619515-43619537 GCACACACATAGATGATTGTTGG + Intergenic
1068426667 10:56874875-56874897 TCACAAATACAGGTGCATGTGGG - Intergenic
1068806357 10:61198382-61198404 TAACACAATGAGATGTTTGTTGG - Intergenic
1069396353 10:67993633-67993655 TAATACATACAGCTCTTTGTTGG + Intronic
1069553210 10:69379052-69379074 TTGCACATACAGATGTTTGCTGG + Intronic
1074158932 10:110821445-110821467 TCACACACAGACATGTTTCTGGG - Exonic
1074292767 10:112152669-112152691 TCACAGGTACAGCTGTTTCTTGG - Exonic
1081863340 11:46346571-46346593 ACACACATACATATGTGTGAGGG + Intronic
1081961378 11:47140141-47140163 TCACACATGCAAAATTTTGTAGG + Intronic
1082733045 11:56824026-56824048 ACACACATACAGAGTTTTCTTGG - Intergenic
1084157112 11:67319635-67319657 TTCCATATAAAGATGTTTGTTGG - Intronic
1084962420 11:72724187-72724209 GCACCCATACAGATGGGTGTGGG - Intronic
1085374875 11:76051268-76051290 TAACATTTACAGATTTTTGTGGG + Intronic
1085938954 11:81185313-81185335 TCACATAAAGAGATGTGTGTTGG + Intergenic
1089919499 11:122195042-122195064 CCACAGAGACAGATGTATGTGGG - Intergenic
1090248149 11:125231699-125231721 TTACACACACAGGTGTGTGTGGG + Intronic
1091049990 11:132358716-132358738 TCAAACCTACAGGTGTTTGTAGG - Intergenic
1091837081 12:3593661-3593683 ACGCATATACAGGTGTTTGTGGG - Exonic
1095669904 12:44846830-44846852 TGACACATACAAATGTTATTTGG + Intronic
1097197838 12:57253872-57253894 TTGCACATACAGATGTTTGCTGG - Exonic
1100012806 12:89973469-89973491 TTACAAAAACAGATATTTGTGGG - Intergenic
1100221792 12:92512484-92512506 TTAAACATACACATGTTTCTAGG + Intergenic
1103302543 12:119939049-119939071 TCCCACAAACAGATGGTGGTGGG - Intergenic
1103891188 12:124240324-124240346 GCACACACACAAAGGTTTGTTGG + Intronic
1104108764 12:125687140-125687162 TCTCACATCCACATGTTGGTGGG - Intergenic
1104737464 12:131145529-131145551 TCATACCTACAGATGTTTCTGGG - Intergenic
1108152723 13:47553172-47553194 TCACACAGACAGATGAGGGTGGG - Intergenic
1108681691 13:52786254-52786276 TCACACATCCAGTTGGTTCTCGG + Intergenic
1110032802 13:70638505-70638527 ATACACATATATATGTTTGTTGG - Intergenic
1110577376 13:77074537-77074559 ACTCACATACAGATCTTTGCAGG - Intronic
1111061038 13:83018998-83019020 TGACACAAAAAGATTTTTGTTGG - Intergenic
1112120320 13:96403171-96403193 TCACAAACAAAGATGTTTGCAGG - Intronic
1113146024 13:107208493-107208515 TCACAAATACAGATACATGTAGG + Intronic
1114407876 14:22473541-22473563 CCACACGTTCAGATGTTTCTAGG - Intergenic
1115514536 14:34172602-34172624 TCACAATTACACATGTCTGTTGG + Intronic
1117312153 14:54538125-54538147 AAACACAGACAGAAGTTTGTTGG + Exonic
1120871101 14:89338203-89338225 TCACAAGTCCAGATGTTTGGAGG - Intronic
1123794837 15:23761110-23761132 TGATACCTACAGATATTTGTGGG + Intergenic
1124359001 15:29020897-29020919 TTGCACATACAAATGTTTGCTGG - Intronic
1125545865 15:40504237-40504259 ACACACATATATATGTGTGTGGG + Intergenic
1125620329 15:41055467-41055489 TCACACATACACATGCATCTAGG - Intronic
1127641831 15:60923403-60923425 TCCCACATACATTTGTTTGAGGG - Intronic
1129633359 15:77287702-77287724 TCCTACATCCAGTTGTTTGTTGG + Intronic
1132016700 15:98324271-98324293 TCACACACAGAGTTGTTTGCAGG + Intergenic
1135622049 16:23964313-23964335 TCATACACACAGAATTTTGTGGG + Intronic
1135998308 16:27269829-27269851 TCACAGAGACAGATATTTGCAGG - Intronic
1138943140 16:61814535-61814557 TAAAACATACAGTTATTTGTTGG - Intronic
1139411845 16:66768562-66768584 TCAAACATACAAATGTTTTGGGG - Intronic
1143460945 17:7103007-7103029 TTACACATACAGCTGTTCCTGGG + Intronic
1144135006 17:12286281-12286303 ACACACATACACATGTATGCAGG - Intergenic
1147520013 17:41161920-41161942 TCACACACACACAGGTTTGGGGG + Intergenic
1149027532 17:52046041-52046063 TCACACATACTAAGATTTGTGGG + Intronic
1149161810 17:53702874-53702896 CCCCCCATCCAGATGTTTGTCGG + Intergenic
1150308694 17:64109343-64109365 TCATAAATACAGTTGTTTGTAGG - Intronic
1151737917 17:75957072-75957094 ACACACATATATTTGTTTGTTGG + Intronic
1152160959 17:78668390-78668412 TCACACTGGTAGATGTTTGTGGG + Intergenic
1153884316 18:9449672-9449694 TCCCTCATAGAGATGTTTATTGG - Intergenic
1154300881 18:13191504-13191526 TTGTACATGCAGATGTTTGTTGG - Intergenic
1157847346 18:51016355-51016377 ACATACATGCATATGTTTGTTGG - Intronic
1158088188 18:53679248-53679270 TATCACATACAAATGTTTTTTGG - Intergenic
1163204358 19:15791464-15791486 ACACACACACACATTTTTGTTGG + Intergenic
1166167574 19:41003084-41003106 ACACACATACACATTTTTGCTGG + Intronic
1167966357 19:53150367-53150389 TCACACACACAGGTATTTTTGGG + Intronic
926501110 2:13653428-13653450 GCATACATACAGATGTTTTTTGG - Intergenic
927336741 2:21933249-21933271 TCACACATGATGATTTTTGTTGG + Intergenic
928994196 2:37269347-37269369 TCACACATACAGATGTTTGTCGG - Intronic
929423482 2:41819331-41819353 TCACACACACAAATGTCTGTTGG - Intergenic
929519248 2:42632802-42632824 ACACACAAACAGATGTTTCAGGG + Intronic
929862082 2:45687570-45687592 TCACACATAAATATTTCTGTGGG - Intronic
930986507 2:57594629-57594651 ACACAGGTACAGATGTGTGTGGG + Intergenic
932958984 2:76389917-76389939 TACCACATAAAAATGTTTGTAGG + Intergenic
933699114 2:85242058-85242080 TTAGACTTACAGATGTTTTTAGG - Intronic
934043050 2:88145989-88146011 TTACACATTCAGGTGTTTCTGGG - Intergenic
938596724 2:132794677-132794699 ACACACATACACATGTGTCTTGG + Intronic
938767419 2:134469558-134469580 TCACTCATGCAGATGTCTCTGGG - Intronic
940297145 2:152138904-152138926 ACACACATACAGTTGTTGGTAGG - Intronic
943401823 2:187421934-187421956 TCAAGCATACAGATGCTGGTGGG + Intronic
944015375 2:195030019-195030041 TCACACCTACAGATATTTGCAGG - Intergenic
945655587 2:212619125-212619147 TCACACATATACACATTTGTTGG - Intergenic
1169544255 20:6634901-6634923 TCACACACAGAGATGGGTGTTGG + Intergenic
1169820009 20:9700038-9700060 TCACACATACATACATTTTTGGG + Intronic
1170862119 20:20116052-20116074 AAACATATACATATGTTTGTAGG - Intronic
1173196585 20:40919054-40919076 ACACACACAGAGATGTTTATGGG + Intergenic
1175067675 20:56303747-56303769 TCACACAAGCAGATTTTTGCAGG + Intergenic
1175533423 20:59690245-59690267 GCACAAACACAGATGTTTGCTGG + Intronic
1176994264 21:15536263-15536285 ACACACACACAGATGTCTGGTGG + Intergenic
1178066411 21:28909155-28909177 TTAGACATATAAATGTTTGTTGG - Intergenic
1181294464 22:21824648-21824670 TCTCATATACAGATGTCTGTAGG + Intronic
1182368054 22:29791900-29791922 TGACAAATTCAGATGTTTCTGGG - Intronic
1182733934 22:32517385-32517407 TCACACACACATCTGGTTGTTGG - Intronic
950533047 3:13564141-13564163 TCACACACAGATGTGTTTGTGGG - Intronic
951083621 3:18483190-18483212 ACACACACACACATTTTTGTAGG - Intergenic
951295566 3:20929863-20929885 TCACACATATTGAGGGTTGTTGG + Intergenic
951387721 3:22062854-22062876 TCACTCATATGGCTGTTTGTAGG - Intronic
952919153 3:38273121-38273143 TTCCACACACAAATGTTTGTTGG - Intronic
953888718 3:46734830-46734852 TTACACAAACAGATGGTTGGGGG + Intronic
957870984 3:86090378-86090400 TCACAGTTCCACATGTTTGTGGG + Intergenic
960829099 3:121825891-121825913 TCAAACATAGAGATGATTTTTGG + Intronic
962314240 3:134349091-134349113 ACACACATACACATTTTTGGAGG - Intergenic
963165639 3:142200133-142200155 ACACACATACATATGGTTTTTGG + Intronic
963562544 3:146884020-146884042 ACACAAATAAAGATTTTTGTAGG - Intergenic
964911564 3:161788909-161788931 ACACACATACCTATGCTTGTAGG + Intergenic
965538919 3:169852953-169852975 TCAGAGGTACAAATGTTTGTGGG + Intronic
965782818 3:172305696-172305718 CCACACATACACATGTGTCTTGG + Intronic
965937088 3:174127831-174127853 TCACAAACACAAATGTTTATAGG + Intronic
966016503 3:175145392-175145414 TAACACAGATATATGTTTGTGGG - Intronic
966753256 3:183342874-183342896 TCACATATACACACTTTTGTAGG - Intronic
968218415 3:196914619-196914641 ACACACATACATATGTGTGTGGG + Intronic
969160647 4:5255494-5255516 TCTTACATACATATGCTTGTCGG + Intronic
970009579 4:11444422-11444444 TCACACATAGAGCTTCTTGTTGG - Intergenic
972266863 4:37468747-37468769 TTACACAAACATATGTGTGTGGG - Intronic
973197106 4:47457680-47457702 TCACACATTCAGAAATTTTTTGG - Intronic
974144144 4:57925130-57925152 TCACTCATAAAGATGCCTGTTGG + Intergenic
977959945 4:103074284-103074306 TCATACATGAAGATGTTTGAAGG - Intronic
978087274 4:104668995-104669017 ACACACACACAGAGGTTTATTGG + Intergenic
978608315 4:110507414-110507436 ACACCCATATAGATGTTTGTAGG + Intronic
979271359 4:118766378-118766400 TAACAAAGACAGAGGTTTGTTGG - Intronic
980462045 4:133126624-133126646 TTGCACATACAAATGTTGGTTGG + Intergenic
981629189 4:146798516-146798538 TCACAGAAGCCGATGTTTGTGGG + Intronic
983801767 4:171939977-171939999 AGACACATACATATGATTGTGGG - Intronic
985228702 4:187790368-187790390 TGACTCATACAAATATTTGTGGG + Intergenic
985371963 4:189294799-189294821 TGACTCAGACAGATATTTGTAGG + Intergenic
985674237 5:1222119-1222141 GCACACATATACATGTGTGTGGG + Exonic
986080047 5:4381273-4381295 GCACACATACAGATGTATGCAGG + Intergenic
987125189 5:14805422-14805444 ACACACATATATATGTTTATAGG - Intronic
988412156 5:30900198-30900220 TCATACACACAGATTTTTCTTGG - Intergenic
989269234 5:39512488-39512510 TCACAGTTACAGAAGTTTGTTGG - Intergenic
989426835 5:41305335-41305357 TCACAGATCCAGATGTTTCCAGG + Intergenic
989462659 5:41718670-41718692 ACACACACACAAATGTTTGAGGG - Intergenic
990483351 5:56233306-56233328 TCACCCATTCAGATTTCTGTTGG - Exonic
990908259 5:60826344-60826366 TCACAGATACAGGTGTATCTGGG - Intronic
990914015 5:60882993-60883015 ACACACACACACATGTCTGTAGG + Intronic
992966576 5:82007827-82007849 ACACACATATATATATTTGTTGG + Intronic
993013143 5:82506812-82506834 TCACACATTCATATGTCTGTTGG + Intergenic
994125380 5:96164140-96164162 TCTCACATACATATGTTTTGGGG + Intergenic
994846592 5:104996091-104996113 ACACACACACACATCTTTGTAGG + Intergenic
995331914 5:110956184-110956206 TGACACATACATTTCTTTGTAGG - Intergenic
996370339 5:122746657-122746679 TTACACATACAGGTGTGTGTGGG - Intergenic
996482786 5:123993861-123993883 TAACACATATGTATGTTTGTGGG - Intergenic
998398122 5:141832695-141832717 TCACACTTACACATGTTGGGCGG + Intergenic
1000832813 5:166125151-166125173 ACACACATACACATGCTTATAGG - Intergenic
1001443222 5:171762247-171762269 ACACACATACACATGTTTAGCGG + Intergenic
1004081058 6:12393801-12393823 TCCCTCACACAGATGTATGTGGG - Intergenic
1004195498 6:13500567-13500589 TGGCACATTCAGATGGTTGTTGG - Intergenic
1010128456 6:72463261-72463283 TCACACACACAGCTGTTTGATGG + Intergenic
1010740412 6:79495949-79495971 GGACAGATACAGATGTTTGGAGG - Intronic
1010935593 6:81857362-81857384 TCACATATACAAATATCTGTTGG + Intergenic
1014640840 6:123907853-123907875 ACACAGCTACATATGTTTGTGGG + Intronic
1017249941 6:152269491-152269513 TCACACATAGAACTGTTTGAGGG + Intronic
1020473523 7:8567041-8567063 TCACACATACACATCTGTGATGG + Intronic
1021597516 7:22332980-22333002 TCACACAAACATATGTGTGTAGG + Intronic
1024168285 7:46757096-46757118 TCACACATGCAGATTTTCATGGG - Intronic
1024512781 7:50216477-50216499 TCACACACACACATTTCTGTTGG - Intergenic
1024713339 7:52043674-52043696 ACACACACACAGATTTTTTTTGG - Intergenic
1027618916 7:80458512-80458534 TAACACATAAATATTTTTGTGGG + Intronic
1028064550 7:86366659-86366681 TCACAGATACACATGTTTATGGG - Intergenic
1029966598 7:104747088-104747110 TCATAAATACAGGTGTATGTGGG - Intronic
1031011295 7:116526812-116526834 ACACACACACAGAGTTTTGTGGG + Intronic
1031646488 7:124232211-124232233 TCTCTCATACTGATGTTTATTGG + Intergenic
1031646912 7:124237235-124237257 TCTCTCATACTGATGTTTATTGG + Intergenic
1031647330 7:124242231-124242253 TCTCTCATACTGATGTTTATTGG + Intergenic
1033067593 7:138171200-138171222 ACACACAAACAGATGTATTTGGG - Intergenic
1033736203 7:144224288-144224310 TCACACATACACATATCTATAGG + Intergenic
1033746850 7:144326664-144326686 TCACACATACACATATCTATAGG - Intergenic
1034377619 7:150659747-150659769 GCCCACATACAGATATTTTTAGG - Intergenic
1034985766 7:155514401-155514423 TGAAACATGCAGATCTTTGTTGG - Intronic
1036034226 8:5001786-5001808 TCACACATACTGATATTTAAAGG - Intergenic
1036496373 8:9273560-9273582 TCTCTCACACAGATGTTTTTAGG + Intergenic
1037392836 8:18412743-18412765 GAATACATACATATGTTTGTTGG + Intergenic
1037762830 8:21753140-21753162 GCACACATATAGAGGTGTGTAGG - Intronic
1038858890 8:31363806-31363828 TGACACATCCAGATGCTTGCAGG + Intergenic
1039796170 8:40917482-40917504 TCACAGATGCAGATGTCTGGTGG + Intergenic
1041333667 8:56755479-56755501 TTACACATATAGCCGTTTGTTGG + Intergenic
1042120625 8:65484242-65484264 TTACTCATTCAGTTGTTTGTGGG - Intergenic
1043210002 8:77501512-77501534 TCACATATATAAATGTGTGTGGG + Intergenic
1043323596 8:79021852-79021874 TCACACAATCTTATGTTTGTAGG - Intergenic
1044863186 8:96543050-96543072 TCAAACATTTAGATGTTTTTTGG + Intronic
1045010866 8:97957333-97957355 AAACAAATACAGATGTTTTTTGG - Intronic
1046150584 8:110219312-110219334 ACACACATATGTATGTTTGTCGG - Intergenic
1047249430 8:123170585-123170607 ACACACATACAGCTGTGAGTGGG - Intergenic
1048922331 8:139242469-139242491 TCACACACAGAGATGTTTAATGG - Intergenic
1051998620 9:23249221-23249243 TCACACATTCCCATGTTTCTTGG - Intergenic
1052535146 9:29737060-29737082 TCATTCATACAGATGTTTTCTGG - Intergenic
1052777802 9:32751162-32751184 TCTCACATTCATTTGTTTGTTGG - Intergenic
1054849021 9:69827541-69827563 GTACACATACAGATGGTAGTGGG - Intronic
1056818512 9:89819157-89819179 TGACACCTACAGATGGCTGTAGG - Intergenic
1057323000 9:94031281-94031303 TCTCACATTCAGATGTCTGCAGG + Intronic
1057627855 9:96693551-96693573 ACACACAGACAGAAGTTTGTTGG - Intergenic
1058213061 9:102197395-102197417 ACACCCATACACATTTTTGTTGG - Intergenic
1060207719 9:121692355-121692377 TTACACATACATTTCTTTGTGGG + Intronic
1187617565 X:21014258-21014280 TCACACATACAGATGACACTTGG - Intergenic
1188878435 X:35461749-35461771 TCACACATAAATATTTCTGTGGG - Intergenic
1191593097 X:62911251-62911273 TCGTACTTGCAGATGTTTGTTGG + Intergenic
1192620815 X:72678341-72678363 ACAGAGATACAGATGTGTGTGGG - Intronic
1194156914 X:90401924-90401946 TCACAATTAGAGATGGTTGTTGG + Intergenic
1194845985 X:98809712-98809734 ACACACACACAAATGTTTTTAGG + Intergenic
1195027995 X:100897578-100897600 ACACACATATATATATTTGTGGG - Intergenic
1196197274 X:112849357-112849379 TCACACAACCAGCTGTATGTGGG - Intergenic
1197648243 X:129040138-129040160 GCACACATGCACATGTATGTTGG - Intergenic
1198565602 X:137901985-137902007 TCAGAAATAAAGATGTTTGATGG + Intergenic
1200503254 Y:3978898-3978920 TCACAATTAGAGATGGTTGTTGG + Intergenic
1200599722 Y:5190921-5190943 TCCCACAGACAGTTGTTTTTGGG - Intronic
1201747010 Y:17387648-17387670 TCACACAAAAAAATGTTTGCTGG + Intergenic