ID: 928995247

View in Genome Browser
Species Human (GRCh38)
Location 2:37282746-37282768
Sequence GGGGTGCTAAAGTGACTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928995247_928995257 17 Left 928995247 2:37282746-37282768 CCTACAAGTCACTTTAGCACCCC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 928995257 2:37282786-37282808 TTTTCTTCATTTGTATAATGAGG 0: 1
1: 4
2: 120
3: 1009
4: 4498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928995247 Original CRISPR GGGGTGCTAAAGTGACTTGT AGG (reversed) Intronic
900413207 1:2522851-2522873 GTGGTGCTATAGTGACTTAACGG + Intronic
900517657 1:3090677-3090699 GGGGTTCTGACGTGACCTGTTGG - Intronic
901514769 1:9737730-9737752 GGGGTGGTAAAGTCACTTCTGGG - Intronic
902330601 1:15729416-15729438 GGGGTGCTAGCATGAGTTGTTGG + Intronic
904278280 1:29398495-29398517 GGGGTGCTACCGTACCTTGTGGG - Intergenic
904712178 1:32438588-32438610 GGGGTGGTAAAAGGACTTCTAGG - Intergenic
912616048 1:111101503-111101525 TGGGTGTTAAAGAGGCTTGTTGG + Intergenic
912645201 1:111385657-111385679 GGAGTGCTTACTTGACTTGTAGG - Intergenic
913470380 1:119180379-119180401 GGGGTCCTAATGTGTCTGGTTGG - Intergenic
916913976 1:169385726-169385748 GAGGTGCTAAAGTAAGTTGATGG + Intronic
923785230 1:237060540-237060562 GGGGTGCTAGAGAGGCTTGCAGG - Intronic
1069184669 10:65408678-65408700 GGGATGCTGAAGTGACTGGTTGG + Intergenic
1069994205 10:72332610-72332632 GGGGTGCTCAGGTGACTGGGGGG - Intergenic
1071247322 10:83779079-83779101 GGGTTACTATAGTGACATGTTGG - Intergenic
1073054188 10:100688576-100688598 GGGGTGAAGAAGTGACTTGGAGG + Intergenic
1073173389 10:101532889-101532911 GGGGTGCTGTGGAGACTTGTTGG - Intronic
1084360355 11:68665017-68665039 AGGGTGCTGCAGTGAGTTGTGGG + Intergenic
1093996647 12:25650267-25650289 GCAGTGCTAAGGTGGCTTGTTGG - Intergenic
1100819910 12:98421125-98421147 GGGCTGCTGAATTGGCTTGTAGG + Intergenic
1104091789 12:125523793-125523815 GAGGTGCTAGAGTGACATGGAGG - Intronic
1104189950 12:126471177-126471199 GGGGTGCGAAACTGAAGTGTAGG + Intergenic
1104785335 12:131444915-131444937 AGGAGGCTAAAGTGACTTGATGG - Intergenic
1118301738 14:64622774-64622796 GTGGAGCTAAAGGGACTTCTGGG + Intergenic
1119184619 14:72631139-72631161 GGGGTGTAGAAATGACTTGTTGG + Intronic
1121122582 14:91385301-91385323 CTTGTGCTAAAGTTACTTGTGGG - Intronic
1122022700 14:98852246-98852268 GGGAAGATAAAGTGACTTTTTGG - Intergenic
1128345933 15:66852463-66852485 GGAGAGGTAAAGTGACTTGAAGG + Intergenic
1128668061 15:69553045-69553067 TGGGGGCTAAATTGACTTGCTGG - Intergenic
1137400960 16:48154160-48154182 GGGGTGCACCAGTGACTTTTTGG - Intronic
1144153373 17:12472909-12472931 AGTGTGCTAAAGTGACTTATAGG - Intergenic
1146504325 17:33391900-33391922 GAGAGGTTAAAGTGACTTGTAGG + Intronic
1156625309 18:38901097-38901119 GGAGTGGTAAAGGGAATTGTTGG + Intergenic
1157566832 18:48683998-48684020 GAGGTGCTAAAGTGTCAGGTGGG + Intronic
1162198152 19:9001725-9001747 GGGGTGCTGGAGTGTGTTGTGGG - Intergenic
927162090 2:20274635-20274657 AGGGTGCTAAAGTGTAATGTGGG - Intronic
927537059 2:23871734-23871756 GGGTTGCTAATGGGACATGTGGG - Intronic
928936788 2:36687665-36687687 TGAGTGTTCAAGTGACTTGTTGG + Intergenic
928995247 2:37282746-37282768 GGGGTGCTAAAGTGACTTGTAGG - Intronic
933824159 2:86143332-86143354 GGGCTGCTGAATTAACTTGTGGG + Intergenic
935242547 2:101190960-101190982 GGGTTGCCAAGGTGACTTGGTGG + Intronic
936988881 2:118340867-118340889 GTGGTGCTATGCTGACTTGTGGG + Intergenic
941886539 2:170533582-170533604 GGAGTCTTAAAGTAACTTGTGGG - Intronic
941999758 2:171634162-171634184 GAGGTGCTAAAATGATTTGAGGG - Intergenic
948622173 2:239243080-239243102 GAGGTGCTAAGGTGAAATGTGGG - Intronic
1173825644 20:46046077-46046099 GGGTTGCTAAAGTGTCTGGGTGG - Intronic
1178220305 21:30649803-30649825 GGGGTGCTAAAGTAAATAGTAGG - Intergenic
1181869150 22:25884260-25884282 GAGGTAGGAAAGTGACTTGTTGG + Intronic
1182057353 22:27370202-27370224 GGGGTGCAAATGTGGCTTCTAGG - Intergenic
1184289023 22:43488306-43488328 AGGGTGCTACAGTGACTCCTGGG + Intronic
952165742 3:30746581-30746603 GGGGTGATAAGGTGACAGGTGGG + Intronic
956293786 3:67690387-67690409 GGGGTACTAAGGGGCCTTGTAGG + Intergenic
969943847 4:10762466-10762488 GGGGTACAAAAGTGAGTTCTGGG + Intergenic
974366760 4:60960209-60960231 GGGCTGCTGAAGTGACATTTGGG - Intergenic
996709649 5:126531698-126531720 GAGTTGCTAAAATGACTTGAAGG - Intergenic
997607088 5:135182847-135182869 TGGATGCTAAGGTGACTGGTGGG - Intronic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1005526867 6:26659750-26659772 GGGGTGATCATGTGACTTGCGGG - Exonic
1011599766 6:89049126-89049148 GTGGTGCTTAAGTGACTTCATGG + Intergenic
1013413675 6:109905369-109905391 AGGGTGCAAAAGTGATCTGTTGG - Intergenic
1015118618 6:129676736-129676758 GGAGCGGTAAAGTGACTAGTTGG - Intronic
1016052658 6:139546364-139546386 GGGGTGCTAAAATGGCTTCAGGG + Intergenic
1018762352 6:166903456-166903478 GGGGTGGTGAAGGGAGTTGTGGG + Intronic
1019271337 7:150639-150661 GGGCTGCTAAAGCGAGATGTTGG + Intergenic
1019517821 7:1447504-1447526 GGGGTGCAGAAGGGGCTTGTGGG - Intronic
1022016888 7:26357858-26357880 GGCGTGCTCAAGGGACTTCTAGG + Intronic
1026054541 7:66973003-66973025 GGGCAGCCAAAGTTACTTGTAGG + Intergenic
1028363099 7:89992791-89992813 AGGGTGAGAAAATGACTTGTAGG + Intergenic
1034922991 7:155098997-155099019 GGGGAGCTAAAGGGACCTGTGGG + Intergenic
1040876956 8:52163650-52163672 GGAGTGCTCATCTGACTTGTGGG + Intronic
1044845679 8:96378285-96378307 GGATTGCTAAAGTGGCTTTTAGG + Intergenic
1046593983 8:116238899-116238921 GGGGTGCTAAGCTGGCTGGTTGG - Intergenic
1049051510 8:140200520-140200542 GGGGTGCCCACCTGACTTGTTGG - Intronic
1055346882 9:75349423-75349445 AGGGTGTTAAAGAGACTTGTTGG + Intergenic
1061120035 9:128636576-128636598 GGGGTGCTAGAGTGGAGTGTGGG - Intronic
1201705702 Y:16934291-16934313 TGAGTGGTAAAGTGAATTGTTGG - Intergenic