ID: 928995440

View in Genome Browser
Species Human (GRCh38)
Location 2:37285397-37285419
Sequence CTGGGTTAGTATCCAAATAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928995440 Original CRISPR CTGGGTTAGTATCCAAATAC GGG Intronic
902739830 1:18429644-18429666 CAGGGTTAGAATCCAATAACAGG - Intergenic
906880875 1:49588514-49588536 CTGGGTTAGAATCTACATTCTGG + Intronic
907025284 1:51111871-51111893 CTGGGCTGGTATCCAACTCCTGG + Intronic
914512550 1:148346572-148346594 CTTGGTTAGGATCCAAAACCTGG - Intergenic
914883141 1:151563092-151563114 CTGGGCTGGTCTCCAAATCCTGG + Intronic
918360112 1:183748860-183748882 CTGGGTAAATAACCAAATAAAGG - Intronic
920490971 1:206415000-206415022 TAAAGTTAGTATCCAAATACAGG - Intronic
922522638 1:226269737-226269759 CTGGGTTACTATGCAAATGGAGG + Intronic
923616939 1:235545889-235545911 CTGGGTTAGTCTCGAACTCCTGG - Intergenic
1064986496 10:21216024-21216046 CAGGGTCAGTATCCTAAGACAGG + Intergenic
1065463848 10:25998526-25998548 CTGGGTTAGTGTACTAATAAGGG + Intronic
1067124905 10:43507729-43507751 CAGGGTTAGGATCCACATCCAGG - Intergenic
1068896585 10:62210147-62210169 TTGAGTTAGGATCCAAATAAGGG - Intronic
1070437031 10:76403453-76403475 CTGGGTTAGCATCTACATATAGG - Intronic
1072204110 10:93187421-93187443 CTGGGTTAGAAACAAAATGCTGG + Intergenic
1072493420 10:95931622-95931644 CTGGGTAAGTATCAAAATTAAGG - Intronic
1074844792 10:117388218-117388240 CTGGGTTAGTGTCCATGTGCAGG - Intergenic
1086168612 11:83809246-83809268 CTGGGTTAGCTGTCAAATACAGG + Intronic
1087426417 11:97992857-97992879 ATGGGATAATTTCCAAATACTGG + Intergenic
1092686156 12:11049570-11049592 ATGTGTTAGTATGCAAATAAAGG + Intronic
1096058926 12:48680399-48680421 CTGGGTTGGTCTCCAACTCCTGG + Intronic
1099773005 12:87087540-87087562 CTGGGTTATTATCAGAATATGGG - Intergenic
1101432145 12:104635395-104635417 CTGGGTTTATATCAAAACACTGG - Intronic
1103038837 12:117678248-117678270 TTGGGTTAGAAGCCCAATACTGG - Intronic
1107882398 13:44844023-44844045 CTGGGTGAGAATCCAAGTAGAGG - Intergenic
1112800484 13:103104430-103104452 CTGGGTTAAAATCCAGATGCTGG + Intergenic
1113394948 13:109938663-109938685 CTCGGCTAGTATCGAAATACAGG + Intergenic
1117777723 14:59199704-59199726 CTGGGTTAGAATACAAAAATGGG - Intronic
1118692695 14:68354969-68354991 CTCGGATAGTACCCTAATACTGG - Intronic
1129417401 15:75393693-75393715 CTGGATTAGTATCTATATAAAGG + Intronic
1140411618 16:74744420-74744442 CTGGAATAATTTCCAAATACTGG - Intronic
1144202296 17:12952579-12952601 CTTGGTAAGTATCCACTTACCGG - Exonic
1145114266 17:20193835-20193857 CTGGATTAGTATTCTAATTCTGG - Intronic
1146014368 17:29220666-29220688 CTGGGCTAGTCTCCAACTCCTGG - Intergenic
1147469708 17:40648005-40648027 CTGGGAAAGTATCAAAATTCGGG - Exonic
1155626009 18:27835301-27835323 GTGGGTTAGTTTGCAAATTCAGG + Intergenic
1159849721 18:73513847-73513869 CTGGGTATATATCCAAAAACAGG - Intergenic
1162701800 19:12521355-12521377 CTGGGCTAGTCTCAAACTACTGG + Intronic
1164470629 19:28528216-28528238 CTGGATTAGTATTCTAATTCTGG + Intergenic
1164788286 19:30955106-30955128 CTGGGCTAGTCTCAAAGTACTGG - Intergenic
927251208 2:20996385-20996407 CTGGGTTAGAATCTAAACTCTGG + Intergenic
928995440 2:37285397-37285419 CTGGGTTAGTATCCAAATACGGG + Intronic
929970225 2:46567845-46567867 CTGGGCTAGTATCGAACTCCTGG - Intronic
932560860 2:72867534-72867556 CTGGGTTGGTCTCCAACTCCTGG - Intergenic
934546647 2:95223272-95223294 CTCAGTTGTTATCCAAATACAGG + Intronic
937816979 2:126261606-126261628 CTGGGTTCATATCCTATTACAGG - Intergenic
939234509 2:139474040-139474062 CTGGGCTATTTTCCAAATATGGG - Intergenic
943189439 2:184657294-184657316 CTGGGTTAGTCTCGAACTCCTGG + Intronic
1172566381 20:35933928-35933950 CTGGACTAGAATCCAAATCCTGG + Intronic
1179068548 21:38050094-38050116 CTGGGATAGTTTCCTAATACTGG - Intronic
1179954860 21:44732960-44732982 CTGGGTTACTCTCCTAATAAAGG + Intergenic
1182935227 22:34215920-34215942 CTGGGTGGGTATCAAAACACTGG + Intergenic
1184270642 22:43380405-43380427 ATGGGCTAGTATTAAAATACTGG + Intergenic
949842753 3:8337946-8337968 CTGGGTTAGGATTCAAACTCAGG + Intergenic
950847617 3:16030165-16030187 TTGGCTCAGTATACAAATACAGG + Intergenic
958013657 3:87913806-87913828 CTGTGTTAGTTTCCTAATAATGG - Intergenic
964223335 3:154369963-154369985 CTGAGTCAGTATCCCAATAAGGG - Intronic
964909279 3:161758259-161758281 CTAGATTAATATACAAATACTGG - Intergenic
966225256 3:177591097-177591119 CTGGGACATTATCCACATACAGG + Intergenic
967416717 3:189227101-189227123 CTAGGCTAGTATCCAACTCCTGG - Intronic
969342065 4:6548506-6548528 CTGACTCAGCATCCAAATACAGG - Intronic
971006631 4:22381750-22381772 CTGGATTAGTATTCTAATGCTGG + Intronic
975030986 4:69615904-69615926 CTGGGTATATATCCAAATAAAGG + Intronic
975643945 4:76527754-76527776 CAGGGTTTGTTTCCAAAAACAGG + Intronic
979118346 4:116858461-116858483 CTGGTTTAATATCCAATTATAGG - Intergenic
980514362 4:133835063-133835085 CTGGGTTTATATCCAAAAAAAGG - Intergenic
988053612 5:26062801-26062823 CTGGGTTAATATGTAAACACTGG - Intergenic
988082405 5:26430760-26430782 CTGGGATAGTATACAGCTACTGG - Intergenic
995916539 5:117252910-117252932 CTGAGTTATCATCCAATTACAGG - Intergenic
996120448 5:119665967-119665989 CTGGGTTAGTATCCACACTGGGG - Intergenic
997567427 5:134899931-134899953 CTGGATTACTTTCCAAATACTGG - Exonic
998469605 5:142373275-142373297 CTGGGTTGGTCTCAAACTACTGG + Intergenic
998790328 5:145759668-145759690 CTGGGTTTGAATCCAAGTGCTGG - Exonic
1000926072 5:167195860-167195882 AAGGTTTGGTATCCAAATACAGG - Intergenic
1006576107 6:35047652-35047674 CTGGGTTATAAGCCAAGTACTGG - Intronic
1008651863 6:53572250-53572272 CTGGGTTGGTTTCCAACTCCTGG + Intronic
1009454467 6:63839716-63839738 CTGGGTATGTATCCAAAGAAAGG - Intronic
1011865073 6:91815696-91815718 CAGGGTTGGTTTCTAAATACTGG + Intergenic
1014097286 6:117474236-117474258 CTGGATTAGTATTCTAATTCTGG - Intronic
1014632874 6:123808730-123808752 CTGGGTCATTACCCACATACGGG - Intronic
1015996816 6:139003251-139003273 CTGGGTTTGAAGCCAAATTCTGG + Intergenic
1031600000 7:123695830-123695852 GTTGGTTGGGATCCAAATACAGG - Exonic
1037950638 8:23017020-23017042 CTGGGTTCCTTTCCAAAGACGGG - Intronic
1040371178 8:46777322-46777344 CTGGGCTAGTCTCCAACTCCTGG + Intergenic
1041332492 8:56741752-56741774 CTGAATTAGTATCCTAATTCAGG - Intergenic
1043304079 8:78772143-78772165 CAGGGCTAGCATGCAAATACTGG + Intronic
1045937204 8:107694556-107694578 CTGGGGCAGTATCCAAATAAAGG + Intergenic
1046032660 8:108802496-108802518 CTGGGTAATTATCCAAAAATTGG + Intergenic
1047390228 8:124444534-124444556 CTGGATTAATATCCCAATTCTGG - Intergenic
1050070178 9:1802397-1802419 GTGGGTTAGTATACATATACAGG + Intergenic
1050254096 9:3776201-3776223 CTGAGTCAGCATCCAAATATAGG + Intergenic
1055190133 9:73508912-73508934 ATTGTTTAGTTTCCAAATACAGG - Intergenic
1055897377 9:81193994-81194016 CTTGGTTAATATCAAATTACTGG - Intergenic
1058256138 9:102766334-102766356 CCGGGTTAATATCAAAATATTGG - Intergenic
1185783854 X:2872858-2872880 ATGGGTCAGTATTCAAATCCAGG + Intronic
1192627750 X:72747802-72747824 CAAGGTTAGTATTCATATACGGG - Intergenic
1192653958 X:72973007-72973029 CAAGGTTAGTATTCATATACGGG + Intergenic
1193171635 X:78344043-78344065 CTGGGTAAATATCCAAATGAAGG + Intergenic
1193945212 X:87725444-87725466 CAGGGTTAGTCTAAAAATACAGG + Intergenic
1194299396 X:92166686-92166708 CTGGGCTGGTCTCCAACTACTGG - Intronic
1195000499 X:100638762-100638784 CTGGGTTTGTACCCAAACCCAGG - Intronic
1195892499 X:109711242-109711264 CTGGATTAGTTTAGAAATACAGG - Intronic
1197738888 X:129873978-129874000 CTGGGTCAGTATTCTAATTCTGG + Intergenic
1200617001 Y:5391520-5391542 CTGGGCTGGTCTCCAACTACTGG - Intronic
1200908114 Y:8506611-8506633 CTGTGTTAGAATCCAGAGACTGG - Intergenic