ID: 928997353

View in Genome Browser
Species Human (GRCh38)
Location 2:37307114-37307136
Sequence TTGGATGCACAACTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928997353_928997361 13 Left 928997353 2:37307114-37307136 CCCTGCTCCAGTTGTGCATCCAA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 928997361 2:37307150-37307172 CATTGCCAAATGTTCCCAGGGGG 0: 2
1: 34
2: 194
3: 500
4: 941
928997353_928997360 12 Left 928997353 2:37307114-37307136 CCCTGCTCCAGTTGTGCATCCAA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 928997360 2:37307149-37307171 ACATTGCCAAATGTTCCCAGGGG 0: 2
1: 41
2: 231
3: 630
4: 1197
928997353_928997358 10 Left 928997353 2:37307114-37307136 CCCTGCTCCAGTTGTGCATCCAA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 928997358 2:37307147-37307169 AGACATTGCCAAATGTTCCCAGG 0: 30
1: 273
2: 661
3: 1143
4: 1449
928997353_928997359 11 Left 928997353 2:37307114-37307136 CCCTGCTCCAGTTGTGCATCCAA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 928997359 2:37307148-37307170 GACATTGCCAAATGTTCCCAGGG 0: 1
1: 48
2: 284
3: 780
4: 1388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928997353 Original CRISPR TTGGATGCACAACTGGAGCA GGG (reversed) Intronic
904496199 1:30888236-30888258 TGGGATTCAGGACTGGAGCAGGG + Intronic
906436406 1:45800560-45800582 CTGGGTGCTCAACTGGAGAAGGG + Intronic
908599765 1:65726105-65726127 TAGGATGCACCACTGTAGCTAGG + Intergenic
909784417 1:79593228-79593250 TTGGTTGCACAGCTGGAGAAGGG - Intergenic
910989369 1:93039127-93039149 TTTGAGTCACAACTGGAGGATGG + Intergenic
913439447 1:118882408-118882430 TTGAATGCATCACTGCAGCATGG - Intergenic
915249624 1:154578853-154578875 CTGGATGGAAACCTGGAGCAAGG + Exonic
915914878 1:159934826-159934848 TGGGATGCACAAGGGGAGGAAGG + Intronic
918485026 1:185019671-185019693 TTGGATGAATAAATGTAGCAGGG + Intergenic
918923874 1:190753476-190753498 TTGAGGGCACAACTGGAACAGGG + Intergenic
1065299742 10:24310648-24310670 TTAGAGGCACACCTGGAGCAAGG - Intronic
1065377196 10:25055269-25055291 TTGCATGCAAAAGTTGAGCAGGG + Intronic
1067802636 10:49369660-49369682 TTGGCTGCACAACAGCAGGAAGG + Intronic
1072984796 10:100130245-100130267 ATGAATGCACCACTGCAGCAGGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1076389705 10:130090256-130090278 ATGGAGGGACAACTGAAGCAGGG + Intergenic
1078313775 11:10273785-10273807 TTGGATGGAAAACTGGAACCAGG + Intronic
1081407401 11:42714010-42714032 TTGGATGCACATCTATTGCATGG - Intergenic
1083571996 11:63765923-63765945 TGGGATGCACACCTGGGGCTGGG - Exonic
1084793758 11:71490928-71490950 CTGGATGCAGAACTGGACGAAGG - Exonic
1085045090 11:73347982-73348004 GGAGAAGCACAACTGGAGCAAGG + Intronic
1085122069 11:73973678-73973700 TTGGATGCCTAGCTGGGGCAGGG + Intergenic
1089084119 11:115802441-115802463 TTGGATGCACAAGTGGTGGATGG + Intergenic
1093459499 12:19395547-19395569 ATTGCTGCACAACTGGAGCAGGG - Intergenic
1094773796 12:33697603-33697625 TTGAATGCAAAAATGGAGCAAGG - Intergenic
1094782976 12:33814329-33814351 TTGGGTTCAAAACTGGAGTAAGG + Intergenic
1095672653 12:44877944-44877966 TTAGATGCACAGCTGTAGAAAGG - Intronic
1096604003 12:52752128-52752150 TTGGAAGCTCAGCTGGGGCAGGG + Intergenic
1099699088 12:86061486-86061508 TTGCAGGCACCACTGGGGCATGG - Intronic
1100322287 12:93507272-93507294 CTGAATGCATAACTGGAACAAGG - Exonic
1101116563 12:101537669-101537691 TTGGTTGGATAACTGGAGAAGGG - Intergenic
1101137934 12:101764755-101764777 TTGGATTTGCAACTGGAACATGG - Exonic
1101303981 12:103509049-103509071 TTAGCTGCACACCTTGAGCAAGG - Intergenic
1103070052 12:117933868-117933890 GTGGATGGAGAACTGGAGCACGG - Intronic
1106208915 13:27622661-27622683 GTGGATGGTCAAATGGAGCAGGG + Intronic
1110029356 13:70586704-70586726 TAGGATGAACAACTGTAGGATGG + Intergenic
1110462851 13:75765412-75765434 TTGGATCTGCAACTTGAGCATGG + Intronic
1111055078 13:82938470-82938492 TTGGATGCAAAACAAGAACATGG + Intergenic
1113050202 13:106202779-106202801 TTGTCTGTCCAACTGGAGCAGGG - Intergenic
1121145994 14:91582867-91582889 TTGGATGCAGGACAGGAACATGG + Intronic
1121570362 14:94942462-94942484 TTCTATGCACAACGGGAACAGGG - Intergenic
1123893606 15:24806163-24806185 TAAGATTCAGAACTGGAGCATGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1128602913 15:69012807-69012829 TTGAAAGCAGAACTGGAGCAGGG - Intronic
1130708901 15:86260137-86260159 TTGGAGGCACAGCAAGAGCAAGG + Intronic
1134233744 16:12449606-12449628 GGAGATGCACAGCTGGAGCACGG - Intronic
1135565235 16:23506756-23506778 TTGGGTGCTCAAGTGGAACAGGG - Intronic
1137879886 16:52034996-52035018 TTGGAGGTACAGCTGGAACAGGG - Intronic
1138505563 16:57476663-57476685 TTGGGTTCCCAGCTGGAGCAGGG - Intronic
1140453763 16:75092589-75092611 TTGTATGGACAAATGGATCAGGG + Intronic
1156645463 18:39156290-39156312 TTGGATGCAAAACAAGAGCTTGG + Intergenic
1158407781 18:57175662-57175684 TTAAATGCAGAGCTGGAGCAAGG - Intergenic
1160384511 18:78486658-78486680 ATGGATGACCAACAGGAGCAAGG + Intergenic
1167945680 19:52986701-52986723 TTGAATGCAAAGATGGAGCAAGG - Intergenic
926297790 2:11581097-11581119 TGGGCTGCACAGCTGGAGGATGG + Intronic
926911787 2:17858278-17858300 TTGGAGAGACCACTGGAGCATGG + Intergenic
927203916 2:20595082-20595104 TAGCCTGCACAGCTGGAGCAGGG + Intronic
927213339 2:20651735-20651757 TTGGGTCCCCAGCTGGAGCAGGG + Intergenic
928416348 2:31095286-31095308 TTGGTAGCACAACTGGAGCAAGG - Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929246787 2:39710983-39711005 GTCGATGCACATCTGGAGCCAGG + Intronic
937313999 2:120919645-120919667 TGGGATTCACACCTGCAGCATGG + Intronic
938238350 2:129724044-129724066 TGGGAAGCAGAATTGGAGCAGGG - Intergenic
938404977 2:131027154-131027176 TTGGCTGTACTGCTGGAGCAGGG - Intronic
939002886 2:136756604-136756626 TTGGATACAGAATTGGAGCATGG + Intergenic
939073627 2:137573122-137573144 TTGGAAGCACAACAGGAGTATGG + Intronic
939392736 2:141589862-141589884 TAGGGTGCACATCTGGAGAAAGG + Intronic
942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG + Intronic
948554540 2:238798636-238798658 TTGGAAGCACAATAGGAGGAAGG + Intergenic
1170979220 20:21195554-21195576 CAGGATGCAAACCTGGAGCAAGG - Intronic
1174087706 20:48020710-48020732 TGGGATGCACAGCTGGAAGAAGG + Intergenic
1182103849 22:27675126-27675148 TGGGGTGAACAACTGGAGAACGG - Intergenic
1183192942 22:36333340-36333362 TAGGATTCACTCCTGGAGCACGG + Intronic
1184914585 22:47560761-47560783 GTGGATGAAAAACTGGAGCTTGG + Intergenic
950987410 3:17389700-17389722 TTGAATCTACAACTTGAGCAGGG - Intronic
953095674 3:39773189-39773211 TTTGTTGCACAACAGGAGCTGGG + Intergenic
953717739 3:45330354-45330376 TAGGAGGGAGAACTGGAGCAAGG - Intergenic
954403969 3:50334872-50334894 TCGGATGCACAGCAGGACCATGG + Intronic
955167875 3:56532677-56532699 CTGGATGCATGACTGGAGAAAGG + Intergenic
959978086 3:112484189-112484211 ATTGATACACAACTGGATCATGG + Intronic
967051773 3:185791589-185791611 TGTGATGCACACCTGGAGGAAGG - Intronic
969856071 4:10000850-10000872 TTGGCTGAGCAACTGGAGAATGG - Intronic
970389373 4:15592165-15592187 TTGGATGGAATAGTGGAGCATGG - Intronic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
974260384 4:59518383-59518405 TTGGATCCACAGCTGTGGCAGGG + Intergenic
974480249 4:62433545-62433567 AAGGATGCACAACTGGAGGATGG + Intergenic
975349199 4:73327373-73327395 ATGGATGCACATATGGAGGATGG - Intergenic
981841159 4:149113940-149113962 TTGGAGGCAGAGCTGGAGGATGG + Intergenic
982402430 4:154983046-154983068 TTGGATGCAGAAATGAACCAAGG + Intergenic
982412672 4:155096884-155096906 TAGGCTGCACCACTAGAGCAGGG - Intergenic
983323830 4:166227881-166227903 ATACATGGACAACTGGAGCAAGG - Intergenic
983661011 4:170130933-170130955 TTGGAAGCACAAATTCAGCAGGG - Intergenic
987964477 5:24853948-24853970 TTGAATGGACAAATGGACCAGGG - Intergenic
1003488142 6:6597249-6597271 CTGGCTGCACTACTGGAGCTGGG - Intronic
1005266804 6:24120688-24120710 TTGGCTGCAGAACTGATGCAGGG - Intergenic
1005866287 6:29940088-29940110 TTGGTTGAATAACTGGAGGAAGG - Intergenic
1010382093 6:75236998-75237020 ATGGATGCACAACAGGACCCAGG + Intergenic
1010651240 6:78457631-78457653 TTGGATGAATAAATGGAGCAGGG - Intergenic
1015239432 6:131007028-131007050 TTGGGTGCACATCTGAAGTAAGG - Intronic
1017026284 6:150184244-150184266 TTTAAGGCACAAATGGAGCATGG + Intronic
1017195433 6:151695176-151695198 TTGAATGCATACCTGGAGCTTGG + Intronic
1020882444 7:13779008-13779030 TTGGATGGAGCACTGGAGCTGGG + Intergenic
1022419773 7:30209565-30209587 TTGGATACACAATTGGAGTCAGG + Intergenic
1026366040 7:69649459-69649481 AAGGAGGCACAACTGGACCACGG - Intronic
1028768272 7:94585061-94585083 TGGGTTGCTCAACTGGAACACGG + Intergenic
1033813569 7:145046173-145046195 GAGAATGCACAGCTGGAGCATGG + Intergenic
1033918382 7:146356716-146356738 TTGGATGGAGAAGTGGATCATGG + Intronic
1036382833 8:8249485-8249507 TGGGTTCCACATCTGGAGCAGGG + Intergenic
1037087812 8:14874834-14874856 TTGAATGGATAACTGGAGGAAGG - Intronic
1039494912 8:37973442-37973464 TTGGATGCAGGACAGGAGCTTGG - Intergenic
1041307161 8:56473235-56473257 TTGGATGCACAGATGGAGGCCGG + Intergenic
1043441837 8:80283159-80283181 AGGGATGCACATCTGGAGCCAGG + Intergenic
1045102325 8:98857902-98857924 TTAGAAGCAAAACTGGAGAAAGG + Intronic
1045597740 8:103675410-103675432 TAGGAGGCAAAACTGGACCAGGG + Intronic
1049610168 8:143551432-143551454 TTGGATGCAGTACAAGAGCATGG + Intergenic
1050500846 9:6295897-6295919 TAGGATCCACCTCTGGAGCAGGG + Intergenic
1053607307 9:39673411-39673433 TTGGACTCACAACTAGAGTAAGG + Intergenic
1053865161 9:42429766-42429788 TTGGACTCACAACTAGAGTAAGG + Intergenic
1054246227 9:62668998-62669020 TTGGACTCACAACTAGAGTAAGG - Intergenic
1054560348 9:66703531-66703553 TTGGACTCACAACTAGAGTAAGG - Intergenic
1054805707 9:69394138-69394160 TTAGATGGACACCAGGAGCAAGG + Intergenic
1056886565 9:90448962-90448984 CTTGTTGCCCAACTGGAGCAAGG + Intergenic
1058187999 9:101877866-101877888 TTGGAGGCAACACTGGAGAATGG - Intergenic
1187617950 X:21018682-21018704 ATGGAAGCACCACTAGAGCAGGG + Intergenic
1190263425 X:48813958-48813980 CTGGAGGCCCAAATGGAGCATGG - Intronic
1199188091 X:144939852-144939874 CTGGATCCACAGCTGTAGCAGGG + Intergenic