ID: 928997358

View in Genome Browser
Species Human (GRCh38)
Location 2:37307147-37307169
Sequence AGACATTGCCAAATGTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3556
Summary {0: 30, 1: 273, 2: 661, 3: 1143, 4: 1449}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928997353_928997358 10 Left 928997353 2:37307114-37307136 CCCTGCTCCAGTTGTGCATCCAA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 928997358 2:37307147-37307169 AGACATTGCCAAATGTTCCCAGG 0: 30
1: 273
2: 661
3: 1143
4: 1449
928997351_928997358 12 Left 928997351 2:37307112-37307134 CCCCCTGCTCCAGTTGTGCATCC 0: 1
1: 0
2: 0
3: 18
4: 220
Right 928997358 2:37307147-37307169 AGACATTGCCAAATGTTCCCAGG 0: 30
1: 273
2: 661
3: 1143
4: 1449
928997349_928997358 30 Left 928997349 2:37307094-37307116 CCACTAGATGCTGGAAGCCCCCC 0: 1
1: 0
2: 2
3: 39
4: 286
Right 928997358 2:37307147-37307169 AGACATTGCCAAATGTTCCCAGG 0: 30
1: 273
2: 661
3: 1143
4: 1449
928997352_928997358 11 Left 928997352 2:37307113-37307135 CCCCTGCTCCAGTTGTGCATCCA 0: 1
1: 0
2: 1
3: 10
4: 167
Right 928997358 2:37307147-37307169 AGACATTGCCAAATGTTCCCAGG 0: 30
1: 273
2: 661
3: 1143
4: 1449
928997356_928997358 -9 Left 928997356 2:37307133-37307155 CCAAAAACGTCTCCAGACATTGC 0: 10
1: 262
2: 703
3: 1124
4: 1219
Right 928997358 2:37307147-37307169 AGACATTGCCAAATGTTCCCAGG 0: 30
1: 273
2: 661
3: 1143
4: 1449
928997355_928997358 3 Left 928997355 2:37307121-37307143 CCAGTTGTGCATCCAAAAACGTC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 928997358 2:37307147-37307169 AGACATTGCCAAATGTTCCCAGG 0: 30
1: 273
2: 661
3: 1143
4: 1449
928997350_928997358 13 Left 928997350 2:37307111-37307133 CCCCCCTGCTCCAGTTGTGCATC 0: 1
1: 1
2: 2
3: 19
4: 197
Right 928997358 2:37307147-37307169 AGACATTGCCAAATGTTCCCAGG 0: 30
1: 273
2: 661
3: 1143
4: 1449
928997354_928997358 9 Left 928997354 2:37307115-37307137 CCTGCTCCAGTTGTGCATCCAAA 0: 1
1: 0
2: 0
3: 9
4: 132
Right 928997358 2:37307147-37307169 AGACATTGCCAAATGTTCCCAGG 0: 30
1: 273
2: 661
3: 1143
4: 1449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928997358 Original CRISPR AGACATTGCCAAATGTTCCC AGG Intronic
Too many off-targets to display for this crispr