ID: 928997359

View in Genome Browser
Species Human (GRCh38)
Location 2:37307148-37307170
Sequence GACATTGCCAAATGTTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2501
Summary {0: 1, 1: 48, 2: 284, 3: 780, 4: 1388}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928997355_928997359 4 Left 928997355 2:37307121-37307143 CCAGTTGTGCATCCAAAAACGTC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 928997359 2:37307148-37307170 GACATTGCCAAATGTTCCCAGGG 0: 1
1: 48
2: 284
3: 780
4: 1388
928997352_928997359 12 Left 928997352 2:37307113-37307135 CCCCTGCTCCAGTTGTGCATCCA 0: 1
1: 0
2: 1
3: 10
4: 167
Right 928997359 2:37307148-37307170 GACATTGCCAAATGTTCCCAGGG 0: 1
1: 48
2: 284
3: 780
4: 1388
928997350_928997359 14 Left 928997350 2:37307111-37307133 CCCCCCTGCTCCAGTTGTGCATC 0: 1
1: 1
2: 2
3: 19
4: 197
Right 928997359 2:37307148-37307170 GACATTGCCAAATGTTCCCAGGG 0: 1
1: 48
2: 284
3: 780
4: 1388
928997353_928997359 11 Left 928997353 2:37307114-37307136 CCCTGCTCCAGTTGTGCATCCAA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 928997359 2:37307148-37307170 GACATTGCCAAATGTTCCCAGGG 0: 1
1: 48
2: 284
3: 780
4: 1388
928997351_928997359 13 Left 928997351 2:37307112-37307134 CCCCCTGCTCCAGTTGTGCATCC 0: 1
1: 0
2: 0
3: 18
4: 220
Right 928997359 2:37307148-37307170 GACATTGCCAAATGTTCCCAGGG 0: 1
1: 48
2: 284
3: 780
4: 1388
928997354_928997359 10 Left 928997354 2:37307115-37307137 CCTGCTCCAGTTGTGCATCCAAA 0: 1
1: 0
2: 0
3: 9
4: 132
Right 928997359 2:37307148-37307170 GACATTGCCAAATGTTCCCAGGG 0: 1
1: 48
2: 284
3: 780
4: 1388
928997356_928997359 -8 Left 928997356 2:37307133-37307155 CCAAAAACGTCTCCAGACATTGC 0: 10
1: 262
2: 703
3: 1124
4: 1219
Right 928997359 2:37307148-37307170 GACATTGCCAAATGTTCCCAGGG 0: 1
1: 48
2: 284
3: 780
4: 1388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928997359 Original CRISPR GACATTGCCAAATGTTCCCA GGG Intronic
Too many off-targets to display for this crispr