ID: 928997361

View in Genome Browser
Species Human (GRCh38)
Location 2:37307150-37307172
Sequence CATTGCCAAATGTTCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1671
Summary {0: 2, 1: 34, 2: 194, 3: 500, 4: 941}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928997354_928997361 12 Left 928997354 2:37307115-37307137 CCTGCTCCAGTTGTGCATCCAAA 0: 1
1: 0
2: 0
3: 9
4: 132
Right 928997361 2:37307150-37307172 CATTGCCAAATGTTCCCAGGGGG 0: 2
1: 34
2: 194
3: 500
4: 941
928997353_928997361 13 Left 928997353 2:37307114-37307136 CCCTGCTCCAGTTGTGCATCCAA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 928997361 2:37307150-37307172 CATTGCCAAATGTTCCCAGGGGG 0: 2
1: 34
2: 194
3: 500
4: 941
928997352_928997361 14 Left 928997352 2:37307113-37307135 CCCCTGCTCCAGTTGTGCATCCA 0: 1
1: 0
2: 1
3: 10
4: 167
Right 928997361 2:37307150-37307172 CATTGCCAAATGTTCCCAGGGGG 0: 2
1: 34
2: 194
3: 500
4: 941
928997355_928997361 6 Left 928997355 2:37307121-37307143 CCAGTTGTGCATCCAAAAACGTC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 928997361 2:37307150-37307172 CATTGCCAAATGTTCCCAGGGGG 0: 2
1: 34
2: 194
3: 500
4: 941
928997350_928997361 16 Left 928997350 2:37307111-37307133 CCCCCCTGCTCCAGTTGTGCATC 0: 1
1: 1
2: 2
3: 19
4: 197
Right 928997361 2:37307150-37307172 CATTGCCAAATGTTCCCAGGGGG 0: 2
1: 34
2: 194
3: 500
4: 941
928997356_928997361 -6 Left 928997356 2:37307133-37307155 CCAAAAACGTCTCCAGACATTGC 0: 10
1: 262
2: 703
3: 1124
4: 1219
Right 928997361 2:37307150-37307172 CATTGCCAAATGTTCCCAGGGGG 0: 2
1: 34
2: 194
3: 500
4: 941
928997351_928997361 15 Left 928997351 2:37307112-37307134 CCCCCTGCTCCAGTTGTGCATCC 0: 1
1: 0
2: 0
3: 18
4: 220
Right 928997361 2:37307150-37307172 CATTGCCAAATGTTCCCAGGGGG 0: 2
1: 34
2: 194
3: 500
4: 941

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928997361 Original CRISPR CATTGCCAAATGTTCCCAGG GGG Intronic
900590438 1:3457063-3457085 CGTTGGCAAATGTGCCCTGGGGG + Intronic
900794838 1:4701678-4701700 TATTGCCAAATGTCCCCTGAGGG + Intronic
900884890 1:5408121-5408143 CATGGCCAAATGTCCCCTCGGGG + Intergenic
901875272 1:12163923-12163945 CATTGCCAAATGTGCTGGGGAGG + Intergenic
901889394 1:12249662-12249684 CATCATCAAATATTCCCAGGTGG - Intronic
902104333 1:14021231-14021253 CATTGCCAAATGCCCCACGGTGG + Intergenic
902279097 1:15361403-15361425 CATTGCCCAATGTCCCCTAGAGG + Intronic
902288622 1:15422522-15422544 CATTGCCAGATGTCTCCTGGGGG + Intronic
902289058 1:15424934-15424956 CATTGTCGAATGTCCCCAGCAGG - Intronic
902302771 1:15514236-15514258 CATTGTCAAATGTCCCTTGGAGG + Intronic
902389430 1:16094520-16094542 CATCTCCAGCTGTTCCCAGGAGG + Intergenic
902593099 1:17488984-17489006 CATTGACAGATGTTCCCTGGGGG + Intergenic
902605399 1:17566326-17566348 CATTGCCAAATGTCCCTTGGGGG + Intronic
902681206 1:18045142-18045164 CATCGCCAAATGTCCCCTGGGGG + Intergenic
902706766 1:18210788-18210810 CATTGCCAAGTGTCCCCTGGGGG + Intronic
902813055 1:18900459-18900481 CATTGTCAGATGTTACCTGGGGG - Intronic
902951629 1:19888075-19888097 CATTGCCAAATGTCCCCTGGAGG - Intronic
903262383 1:22138408-22138430 CTTTGCCAAATGTCCCCTGGGGG - Intronic
903303748 1:22397713-22397735 CATTGCCAACTGTCCCCTGGGGG + Intergenic
903344505 1:22675840-22675862 CATTGTCAAATGTCCCCTGGGGG - Intergenic
903609225 1:24597916-24597938 CAATGCCAAATGGCCCCTGGTGG - Intronic
903718390 1:25386286-25386308 CATTGTCAGATGTCCCCTGGGGG + Intronic
904246715 1:29193374-29193396 CATTGTCAAATGTCTCCTGGGGG + Intronic
904889456 1:33768278-33768300 CATTGCCAAATATTCCCTGGGGG - Intronic
904933005 1:34105353-34105375 TATTGCCAAATGTCCCCTAGGGG + Intronic
905158238 1:36007124-36007146 CATTGCCAAATGTCCCCTGGGGG + Intronic
905187841 1:36209509-36209531 CATTGCCAAATATCCTCTGGGGG + Intergenic
905704582 1:40045202-40045224 CATTGCCATATGTCTCCTGGAGG + Intronic
905775789 1:40666283-40666305 CATGGTCGAATGTTCCCTGGGGG - Intergenic
907009408 1:50949465-50949487 CATTGCCCAATGTCCCCTGGGGG + Intronic
907398424 1:54208791-54208813 CACTGCCAAATGTTCTCCAGAGG - Intronic
907468904 1:54658923-54658945 CATTGCTGAATGTTCCATGGGGG + Intronic
907708446 1:56853259-56853281 CATTGCCAAATATCCCCTGAGGG + Intergenic
907714064 1:56911521-56911543 CATTGCCAAATATTCCTTGGGGG - Intronic
907840783 1:58155289-58155311 CATTGCCAGATGTTCCCTGGAGG - Intronic
907841552 1:58162899-58162921 CATTGCCAAATGTTCCCTGGAGG - Intronic
907984771 1:59519929-59519951 CATTGCCAAATGTCCCCTGAGGG - Intronic
908151987 1:61311633-61311655 CATTGCCAAATGTCACCTGGGGG + Intronic
908288517 1:62637417-62637439 TATTGCCAAATGTTCCCTTGGGG - Intronic
908695204 1:66832101-66832123 CATTGCCAAATGTTCCCTAACGG + Intronic
908772186 1:67607341-67607363 CACTGCCAAATGTTCCCTTGGGG + Intergenic
908849236 1:68357863-68357885 CATTGGCAAATGTTCTCTGGAGG - Intergenic
908849368 1:68359310-68359332 CATTTGAAAATGTTCCCTGGAGG - Intergenic
909071924 1:71005037-71005059 CATTGCCAAATGTACTATGGGGG - Intronic
909356156 1:74712371-74712393 CATTGCCAAATGTCCCAGAGCGG + Intronic
909506151 1:76392155-76392177 CATTGCCAAATGTTCCCTAGGGG + Intronic
909574120 1:77154107-77154129 CTTTCCCTAATGTTACCAGGAGG + Intronic
909784422 1:79593265-79593287 CAGTGCCACATGTCCCCTGGAGG + Intergenic
909849440 1:80441843-80441865 CATTGCCAAATGTTTCCTGGAGG + Intergenic
910164352 1:84308462-84308484 CATTGCCAAATGTTCCCTGAGGG + Intronic
910241352 1:85089707-85089729 CATTGCCAAATGTCCCATGAGGG + Intronic
910447915 1:87317599-87317621 CATTGCCAAATGTCCACTGGGGG + Intergenic
910898039 1:92089322-92089344 CATTGCCAGATGTCCTCTGGAGG + Intronic
910948913 1:92623690-92623712 CATTGCCAAATGTCCCCTGGGGG - Intronic
910949024 1:92624863-92624885 CATTGCCAAATGTCCCCTGGCGG - Intronic
910973389 1:92880026-92880048 CATTGCCAAGTGTCCCCTGTGGG - Intronic
910990782 1:93053693-93053715 CATTGCCAAACGTTCCAAGGGGG - Intergenic
911102131 1:94103469-94103491 TCTTGCCAAATATTTCCAGGAGG - Intronic
911142033 1:94514344-94514366 CATTGCCAAATGTCCCCCTGAGG + Intronic
911598965 1:99827217-99827239 CATTGCCAAATGACCCCTGCAGG - Intergenic
911694188 1:100869920-100869942 CATTGCCAGATGTCCCCTCGGGG + Intergenic
911711044 1:101073401-101073423 CATTGCCAAATATCCCTGGGGGG + Intergenic
911956853 1:104247060-104247082 CATTGTCAAATGTCCTCTGGGGG + Intergenic
912198052 1:107423282-107423304 CATTGCCAAATGTCCCCTGGGGG - Intronic
912397294 1:109355846-109355868 CATTACCAAATGTTTCTTGGGGG - Intronic
912699895 1:111869559-111869581 CATTGCCCAATGTGCTCAGTTGG + Intronic
913373121 1:118122625-118122647 CATTGCCAAATGTTCCCTTGGGG + Intronic
913429646 1:118776608-118776630 CATTGCCAAATGCCCCCGAGGGG + Intergenic
913700222 1:121367343-121367365 CATTGCCAAATGTCCTCTCGGGG - Intronic
913715213 1:121526859-121526881 CATTGCCAAATGTCTCCTGTGGG + Intergenic
914040771 1:144047798-144047820 CATTGCCAAATGTCCTCTCGGGG - Intergenic
914137318 1:144912679-144912701 CATTGCCAAATGTCCTCTCGGGG + Intronic
914868018 1:151449318-151449340 CATTGCCAAATGCCCTCTGGGGG - Intronic
915036629 1:152932976-152932998 CATTGCCAAAGGCTTCCTGGAGG - Intergenic
915168388 1:153961465-153961487 CATTACCAAATGTTTCCTGAGGG + Intronic
915495431 1:156279236-156279258 CATTGCCAAATGTCCCCTGGTGG - Intronic
915847696 1:159285240-159285262 CATTACCAAATATTGCCTGGAGG + Intergenic
915892541 1:159784854-159784876 CATTGCCAAATGTTCCCTGGGGG + Intergenic
916064866 1:161128201-161128223 CATTGCCACATATTCCCCAGGGG - Intronic
916142780 1:161713706-161713728 CATTGCCCAATGTCCTCTGGGGG - Exonic
916335409 1:163665488-163665510 CATTGCCAAAGGTCCCCTAGGGG - Intergenic
916416425 1:164596468-164596490 TATTGCCAAATGGCCCCTGGGGG - Intronic
916463183 1:165047475-165047497 CATTTCCAAATGCTTCCTGGAGG - Intergenic
916698502 1:167265696-167265718 CATTGCCAAATGTTGGGGGGTGG - Intronic
916723012 1:167499144-167499166 CGTTGCCAAATGTTTCCTGGGGG - Intronic
916786931 1:168093135-168093157 CATTGCTAAATGCTACCAGGTGG - Intronic
916850537 1:168698609-168698631 CATTGCCAAGTATTCCCTTGGGG - Intronic
916854387 1:168735190-168735212 CATTGCTAAATGTCTCCTGGAGG + Intergenic
916923170 1:169490238-169490260 CATTGCCAAATGTCCCCTGTGGG - Intergenic
917037730 1:170767736-170767758 CATTGCCAAATGTTTCCTGGGGG - Intergenic
917224798 1:172770107-172770129 CATTGCTAAATGTTACCTGGAGG - Intergenic
917277653 1:173347927-173347949 TATTGCCAAATGTTCCTGGCAGG + Intergenic
917328345 1:173856275-173856297 CATTGTCAAATGCTGCCGGGAGG - Intronic
917412822 1:174777462-174777484 CATTGCCCAGTGTTCCCCTGGGG + Intronic
917469103 1:175310895-175310917 CATTGCCAAATGTCCTCTGGGGG - Intergenic
917758154 1:178124273-178124295 CTTTGTCAAATGTCCCCTGGAGG - Intronic
917960301 1:180138342-180138364 CATTGCCAACTGTCCACTGGAGG + Intergenic
918020123 1:180679313-180679335 CATTGCCGAATGTCCCCTGAAGG - Intronic
918058023 1:181039312-181039334 CACTGGGAAATGTTCCAAGGAGG - Intronic
918314344 1:183310572-183310594 CATTGCCAAATGTGCCCTGGGGG - Intronic
918371950 1:183869923-183869945 CATTGGCAAATGTCCTCTGGAGG - Intronic
918499657 1:185179846-185179868 CATTGCCAAATGTCCCCTGAGGG - Intronic
918510787 1:185311856-185311878 CTCTGCCAAATGCTCCCAGTTGG + Intronic
918512096 1:185322296-185322318 GATTGCCAAATATTCCCCAGGGG - Intergenic
918517213 1:185376160-185376182 CACTGCCAAATGTCTCCTGGGGG + Intergenic
918553635 1:185773150-185773172 CAATGCCAAATGTCCCCTGGAGG - Intronic
919571242 1:199251180-199251202 CATAGCCAAATGCACCAAGGGGG + Intergenic
919807744 1:201390773-201390795 CATTGCCAAATGTCTCCTGGGGG + Intronic
920008063 1:202847805-202847827 CATTGCCAAATGTCCGCTGGAGG + Intergenic
920023985 1:202978500-202978522 CATTGCCAAATGTCCCCAGGGGG + Intergenic
920220239 1:204392571-204392593 CTTTTCCAAATGTCCCCATGGGG + Intergenic
920293857 1:204943915-204943937 CATTGGCAATTGTTCCCTGGAGG - Intronic
920307335 1:205027324-205027346 AATTGCTACAAGTTCCCAGGTGG - Intergenic
920487636 1:206386066-206386088 CATTGCCAAATGTCCTCTCGGGG - Intronic
920532069 1:206709916-206709938 CATTGCCAAACGTCCCCTGGGGG + Intronic
920928667 1:210366668-210366690 CATTGCCAAATGCCCCCAGGAGG + Intronic
921165564 1:212504369-212504391 CATTACCAGATCTTCCCTGGAGG - Intergenic
921327184 1:213997792-213997814 CATTGCCAAAGGTGTCCAGGGGG - Exonic
921883899 1:220284813-220284835 CATTGCCAAATGTCCTCTGGAGG + Intergenic
922088916 1:222377137-222377159 CATTGTCAAAGGTTCCCTGCAGG + Intergenic
922097655 1:222456140-222456162 CATTGCCAAATGTTTCCTGGGGG + Intergenic
922194278 1:223346193-223346215 CATTGCCAAATGTCCCCTGGGGG + Intronic
922236669 1:223727419-223727441 CCTTGCCAAATGTCCCCTGGGGG + Intronic
922546660 1:226463098-226463120 CATTGCCACCTGTTCCCTGGGGG + Intergenic
922583333 1:226714882-226714904 CATTGCCAAATGTCCCCCATGGG - Intronic
922612754 1:226942117-226942139 CATTGCCACGTGTCCCCTGGAGG + Intronic
923054802 1:230417964-230417986 CATTGCCAAATGTCCCCTGGGGG - Intronic
923584393 1:235253423-235253445 CATTGCCAAATGTTCCCTGGGGG + Intronic
923637395 1:235713552-235713574 CATTGCCAAATAACCCCTGGAGG - Intronic
924095005 1:240542029-240542051 CATTGACAAATGTCCCCTGAGGG - Intronic
924176224 1:241393935-241393957 CATTGCCAAATATCCCCTTGGGG + Intergenic
924277751 1:242405304-242405326 CATTGCCAAATGTCCCTGGAGGG - Intronic
924368426 1:243321147-243321169 CATTGCCAAATGTCCTCTGGTGG + Intronic
924430420 1:243991735-243991757 CATTACCAGATGTTCCCTGAGGG + Intergenic
924491130 1:244538826-244538848 CATTTCTAACTGATCCCAGGTGG - Intronic
1062789475 10:292698-292720 CCTTCCCACCTGTTCCCAGGAGG - Intronic
1063270689 10:4507517-4507539 CATTGCTAAATGTACCCTGTAGG - Intergenic
1063276771 10:4577853-4577875 CATTAACAAATGTTCCCTAGGGG + Intergenic
1063476399 10:6332442-6332464 CATTGCCAAATGTCCCCTGGGGG - Intergenic
1063484986 10:6411358-6411380 CAATGCCAAGTTTTCCCAAGGGG - Intergenic
1063498454 10:6531342-6531364 CATTGCCAAATGTTGCTCAGAGG - Intronic
1063521665 10:6747108-6747130 TATTGCCAAATGTCCTCCGGGGG + Intergenic
1063630056 10:7724843-7724865 CATTGCCAAATGTCCGCTGGGGG + Intronic
1063687203 10:8248476-8248498 CATTACCAAATGTTCCCCAGGGG - Intergenic
1063705855 10:8430210-8430232 CATTGCCAAGTGTCCCCTGGTGG + Intergenic
1065177069 10:23088072-23088094 CATTGCCAGATGTTCCCTTAGGG - Intergenic
1065391301 10:25185091-25185113 CATTGCCAAATATCCCCTGTGGG + Intronic
1065412431 10:25444099-25444121 CATTGCCAGATATCCCCTGGGGG + Intronic
1066434266 10:35382507-35382529 CCTTGCCAAATGTGCCCTGGGGG - Intronic
1066551467 10:36563179-36563201 CGTTGCCAAATATTCCCTGAGGG - Intergenic
1066587214 10:36949119-36949141 CATTGCCAAATGTGCCCTGGGGG - Intergenic
1066705448 10:38173014-38173036 CAGAGTCAAATGTTGCCAGGAGG - Intergenic
1066985044 10:42457638-42457660 CAGAGTCAAATGTTGCCAGGAGG + Intergenic
1067109610 10:43390955-43390977 CATTCCCAAATGTTCTCTGGTGG + Intronic
1067705380 10:48603151-48603173 CAATGCCAAATGTTCTCTAGTGG + Intronic
1067727455 10:48781061-48781083 CATTTCCAAATATACCCTGGGGG + Intronic
1068005670 10:51390788-51390810 TATTGCCAAATGTTCCCTCGAGG - Intronic
1068022216 10:51599199-51599221 CATTGCTAAATGTTTCCTGGGGG - Intronic
1068066918 10:52143447-52143469 CATTGCCAAATGTCTCCTGTGGG + Intronic
1068569167 10:58609274-58609296 TCCTGCAAAATGTTCCCAGGAGG + Intronic
1068724105 10:60281393-60281415 AATTGCCAAATGTCCCTTGGGGG + Intronic
1068942737 10:62695715-62695737 CATTGCTAAATGTCCCTGGGGGG + Intergenic
1069090044 10:64189239-64189261 TATTGCCAAATGTTCCTAGAGGG + Intergenic
1069423778 10:68271673-68271695 CATTGCCCAATGTCCCAGGGAGG - Intergenic
1069692417 10:70362742-70362764 CATTTCCAAATGTCCCCTGGGGG - Intronic
1069771287 10:70901867-70901889 CCTTGCCAACTGTCCCCTGGGGG - Intergenic
1070502434 10:77084246-77084268 CATTGCAAAATGTCCCCTGGGGG + Intronic
1070666619 10:78349561-78349583 CATTGCCAAATGTCCCCTGGTGG - Intergenic
1070978021 10:80621150-80621172 TATTGTCAAATGTCCCCTGGTGG - Intronic
1071685018 10:87745321-87745343 CATTGCCACATGCTCCCAAGTGG + Intronic
1072065763 10:91869808-91869830 CATTGCCAAATGTCCCCTGGAGG + Intergenic
1072233735 10:93435423-93435445 CATTGCCAGTTGTTCCCTGGAGG + Intronic
1072330785 10:94349571-94349593 CATTGCCTAATGTTCCCTGGGGG + Intronic
1072490459 10:95900437-95900459 CATTGTCAAATGTCTCCTGGTGG + Intronic
1072504470 10:96050840-96050862 CGTTGCCAAGTGTTCCCTGTGGG - Intronic
1072642947 10:97226949-97226971 CATTGCCAAATGTCCCATGGTGG - Intronic
1072894121 10:99350981-99351003 CATGGCCAAATGTCCCCTGGGGG + Intronic
1073594187 10:104784219-104784241 CTTTGCCAAAAGTCCCCTGGGGG - Intronic
1074277507 10:112018142-112018164 CATTGCCAAATGTCCCTTGGAGG - Intergenic
1074404520 10:113169487-113169509 CATCGCCAGATGTCCCCTGGGGG + Intergenic
1074580779 10:114717553-114717575 CATTGTCAAATGTCCCCTGAGGG + Intergenic
1074625107 10:115174920-115174942 AATGGCCCAAAGTTCCCAGGGGG + Intronic
1074659949 10:115642914-115642936 CATTGCCAAATGTTTCCTGAGGG - Intronic
1074699335 10:116079556-116079578 CACTGCCAAATGTCTCCAGGGGG - Intronic
1074824457 10:117204491-117204513 CATTGCCAAATTTCCTCTGGGGG + Intronic
1074851080 10:117440158-117440180 CATTGCCAAACGTCCCTTGGAGG + Intergenic
1074930384 10:118119139-118119161 TATTACCAAATGTCCCCTGGTGG + Intergenic
1075124464 10:119688580-119688602 CATTGCCAAATGTCCCCTGGTGG + Intergenic
1075149708 10:119916219-119916241 AATTGCCAGATGTCCCCTGGAGG + Intronic
1075168960 10:120095533-120095555 CATCACCAAATGTCCCCTGGGGG + Intergenic
1075215495 10:120529131-120529153 CATTGCTAAATGTCCCCTGGGGG - Intronic
1075270459 10:121044928-121044950 CATTGCTAAGTGTCCCCTGGGGG - Intergenic
1075306205 10:121369959-121369981 CATTGCCAAATGACTCCTGGGGG - Intergenic
1075363834 10:121864796-121864818 CTTTGCCAAATGTCCCTAGGGGG - Intronic
1075475668 10:122731259-122731281 CATTGCCAAATATCCCCTGGAGG - Intergenic
1075505247 10:123015535-123015557 CATGGCCAAATGTCCCGTGGGGG + Intronic
1075507554 10:123038121-123038143 CGTTGCCCAATGTCCCCTGGAGG - Intronic
1075607330 10:123821666-123821688 CATTGTCAAATGTCCCCTGGAGG - Intronic
1075615419 10:123887547-123887569 CATTGCCAAATATCCCCAGGGGG - Intronic
1075827860 10:125375393-125375415 CATTGCCAAATGTCCCCGGGAGG - Intergenic
1075931544 10:126301017-126301039 CATTGCCACATGTTCCCTGGGGG - Intronic
1076044011 10:127276069-127276091 CATCGAGAAATGTTCACAGGAGG - Intronic
1076618737 10:131773459-131773481 CACTGCCAGATGTCCCCTGGGGG - Intergenic
1077458346 11:2694332-2694354 CATTGCCATATGTCCCCTGGGGG - Intronic
1077590562 11:3487785-3487807 CATGGCCACATGTTCTCTGGGGG - Intergenic
1077598373 11:3554309-3554331 TATTGCCTAATGTCCCCAGGGGG - Intergenic
1077749082 11:4943652-4943674 CATTGCCAAATGTCTCTTGGAGG + Intronic
1078025961 11:7695972-7695994 CATTGCCAAATGTGTCCTGAGGG + Intronic
1078265541 11:9753753-9753775 CGTTGCCAAATGTCCCCTGGAGG - Intergenic
1078570026 11:12449674-12449696 CATTGCTTAGTGTTCCCCGGAGG - Intronic
1078672658 11:13378507-13378529 CATTGCAAAATATTGCCTGGGGG - Intronic
1079021203 11:16910612-16910634 CATTATCAAATGTCCCCTGGGGG - Intronic
1079226766 11:18613578-18613600 GATTGCCAAAAGTCCCCTGGAGG + Intronic
1079409602 11:20174939-20174961 AACTGCCAAATGTTCCCGGGTGG + Intergenic
1079410325 11:20181419-20181441 CATTGCCAAATGTCCCGTAGAGG - Intergenic
1079468827 11:20758805-20758827 CATTGCCAGATGTCCCCTGGGGG + Intronic
1079765074 11:24381907-24381929 CATTATCAAATGTCCCCAGTTGG - Intergenic
1079786014 11:24673740-24673762 CATTACCAAATGTCCCCTGTAGG + Intronic
1079938506 11:26648577-26648599 CATTGCCAGATGTCCTCTGGGGG + Intronic
1080112163 11:28580668-28580690 CATTTGAAAAAGTTCCCAGGTGG + Intergenic
1080210457 11:29779851-29779873 CATTGCCAAATGTCCCCTGTTGG + Intergenic
1080284991 11:30600450-30600472 CACTGCCAAATGTACCCTTGGGG + Intergenic
1080451840 11:32384450-32384472 AATTGCCAAATATCCCCTGGGGG + Intergenic
1080635149 11:34117313-34117335 CATTGCCAAATGTCCCCAGGGGG - Intronic
1080702936 11:34659952-34659974 CATCACCAAATGTTCCCTGGGGG + Intronic
1080714431 11:34785043-34785065 CATTGCCAAAGGTCAGCAGGGGG + Intergenic
1080719766 11:34837614-34837636 CATTGCCAGATGTCCCCTGCAGG - Intergenic
1080750686 11:35147522-35147544 CTGAGCCAGATGTTCCCAGGGGG - Intronic
1080846633 11:36032690-36032712 CAGTGCCATATGTTCCCAGGGGG + Intronic
1080948599 11:37002997-37003019 CATTGCCAAATGGACCCTGGGGG - Intergenic
1081178307 11:39955890-39955912 CATTGCCAAGTGTCCCCTGAGGG + Intergenic
1081193305 11:40130646-40130668 CACTGCCAAATGTCCCCTGGGGG + Intronic
1081222239 11:40476055-40476077 CATTGCAAAATGTTCCCTGCAGG + Intronic
1081436076 11:43028725-43028747 CATTTCCAAATGTTCCCTGGAGG + Intergenic
1081531957 11:43968034-43968056 CATTGCCAAATATCCTCAGAGGG - Intergenic
1081546178 11:44073546-44073568 CATTGCCACACATCCCCAGGGGG - Intronic
1081551660 11:44119102-44119124 AATAGCCAAATGTCCCCTGGGGG - Intronic
1081632457 11:44699163-44699185 CATTTCCAAATCATCCCTGGGGG + Intergenic
1081936185 11:46905452-46905474 CATTGCTAAATGTCCTCCGGGGG - Intronic
1082085893 11:48049263-48049285 CATTGCCAGATGTCCCCTGGGGG + Intronic
1082654497 11:55836850-55836872 CACTGCCAAATGTTCCCATCAGG - Intergenic
1082808906 11:57466796-57466818 CATTGCCAAATGTCCCCTGGGGG - Intronic
1082989022 11:59191514-59191536 CATGGCCAAATGTTCCCTCAGGG - Intronic
1083074001 11:60018301-60018323 CATTGCCAAATGTCCCCTGGAGG - Intergenic
1083235608 11:61348959-61348981 CATTGCCAGATGTTGGCAGAAGG - Exonic
1083486617 11:62986988-62987010 CATTGCCAAGTGTCCCCTGGGGG - Intergenic
1084246283 11:67859566-67859588 CATGGCCACATGTTCTCTGGGGG - Intergenic
1084254454 11:67930173-67930195 TATTGCCTAATGTCCCCAGGAGG - Intergenic
1084336925 11:68463826-68463848 CACTGCCAAATGTTTCCTGGGGG - Intronic
1084414961 11:69026591-69026613 CATTGCTAAGTGTCCCCATGGGG - Intergenic
1084435537 11:69137157-69137179 CATTGCCAAATGTCCCTCTGTGG + Intergenic
1084572331 11:69967091-69967113 CATTGCCCAATGTCCCCTGAGGG + Intergenic
1084751267 11:71205641-71205663 CACTTCCAAATTTTACCAGGAGG + Intronic
1084789687 11:71465650-71465672 CATTACCAGATGTCCCCTGGGGG + Intronic
1084818414 11:71665710-71665732 TATTGCCTAATGTCCCCAGGGGG + Intergenic
1085601925 11:77862974-77862996 GGTTGCCAAATGTTACCGGGGGG + Intronic
1085786149 11:79452035-79452057 CATTGCCAAATGTCCCCTCTGGG + Intergenic
1085829559 11:79884982-79885004 AATTGCCAAATGTCCCCAGGGGG - Intergenic
1085844706 11:80051738-80051760 CATTGCCAAATGTCCCCTGGGGG - Intergenic
1085900880 11:80698852-80698874 CATTGCCAAATGTGCCCTGGGGG + Intergenic
1086202358 11:84218729-84218751 CATTGCCAAATGTTTCCTGAGGG - Intronic
1086407466 11:86510718-86510740 CGTTGGCAAATGTCCCCTGGAGG + Intronic
1086898391 11:92339285-92339307 GATTGCCAAATGTCCCATGGGGG + Intergenic
1086934623 11:92731264-92731286 CATTTCTAAATGTCCCCTGGAGG - Intronic
1086971258 11:93083560-93083582 CATTGCCAAATTATCCCCTGGGG + Intergenic
1087140635 11:94762352-94762374 CATTGCCAAATGTCCCCTAGGGG - Intronic
1087283680 11:96241425-96241447 CATTGCCAAATGTCTCCTGGGGG - Intronic
1087297703 11:96396866-96396888 CATTGCCAGATGTCCCCTGGGGG + Intronic
1087511872 11:99104930-99104952 CATTACTAAATGTTCCCTGTTGG + Intronic
1087542803 11:99542644-99542666 TATTGCTAAATGTTCCCTGGAGG + Intronic
1087779889 11:102290829-102290851 CATTGCCAAATGTCCCCCGGGGG - Intergenic
1088136619 11:106563226-106563248 CATTGCCAATTGTCTCCTGGGGG - Intergenic
1088148487 11:106714696-106714718 CATTGCCAAATGTCCACTGAGGG - Intronic
1088416296 11:109592700-109592722 CATTGCTAAATGTCCTCTGGGGG - Intergenic
1088477684 11:110260357-110260379 CACTGCCAAATGGTACCAAGAGG - Intronic
1088600742 11:111472383-111472405 TATTGCCAAATATCCCCTGGGGG - Intronic
1088902801 11:114131148-114131170 CACTGCCAAATGTGCCCTGGAGG - Intronic
1088941992 11:114468559-114468581 CACTTCCAAATGTCCCCTGGGGG - Intergenic
1088979914 11:114852935-114852957 CATTGCCAAGTGTCCCCTGGGGG + Intergenic
1089477650 11:118778442-118778464 AATTGCTAAATGTCCCCTGGGGG + Intronic
1089618996 11:119711857-119711879 CATTGCCGAATATTCCCTGGAGG - Intronic
1089758398 11:120704428-120704450 CACTCCCAAATGTTCCCTGTTGG - Intronic
1089879243 11:121757723-121757745 CATTGCTAAATGTCCCCCAGGGG + Intergenic
1090305736 11:125689466-125689488 CATTGCCAAATGTGCCCTGGAGG - Intergenic
1090829635 11:130411948-130411970 CATTGCCAAATGTCCCCTGGAGG - Intronic
1090879029 11:130817042-130817064 CATTGCCAAATGTCCCCTCAGGG + Intergenic
1091030516 11:132183295-132183317 CACTGCCAAATGTGGCCAGTGGG - Intronic
1091031036 11:132188041-132188063 CATTGCCAAATGTTCCCTGGAGG - Intronic
1091139043 11:133219747-133219769 CATTGCCAAATGTCCTCCAGGGG - Intronic
1091331784 11:134736459-134736481 CATTGCCAAATGTCCCTTGAGGG + Intergenic
1091610297 12:2001883-2001905 CACTGCCAAATGTCACCTGGGGG + Intronic
1091657422 12:2355711-2355733 CACTGCCAAATGTCCCCAGGTGG - Intronic
1091798843 12:3312092-3312114 CATTGCCAAATGTCCCCTGAGGG - Intergenic
1091875972 12:3933112-3933134 CATTTCCAAATGTTCCCTAGAGG + Intergenic
1091953780 12:4618707-4618729 CATTGCCAAATGTCCCCTGGGGG + Intronic
1092041739 12:5391045-5391067 CATTGCCAAATATCCCCTGCAGG + Intergenic
1092131404 12:6115836-6115858 CACTGCAAAATGTCCTCAGGGGG + Intronic
1092416849 12:8296690-8296712 CATGGCCACATGTTCTCTGGGGG - Intergenic
1092424519 12:8363645-8363667 TATTGCCTAATGTCCCCAGGGGG - Intergenic
1092861223 12:12720774-12720796 CATTGCCAAATGTTCCCTGTGGG + Intronic
1093930960 12:24954841-24954863 CATTGCCAAATCTCCCCAGGGGG - Intergenic
1093957821 12:25241817-25241839 TGTTGCCAAATGTCCCCTGGAGG + Intronic
1094680127 12:32660358-32660380 CTTTGCCACATGTCCCCAGGTGG - Intergenic
1095559153 12:43545029-43545051 CATTGCCAAATGTCTTCTGGGGG + Intronic
1095669132 12:44837387-44837409 CAATGCCAAACATTCCCTGGGGG + Intronic
1095734325 12:45539980-45540002 CATTGCCAAATGCCCCCTGTGGG + Intergenic
1095905942 12:47378093-47378115 CATTGTCAAATGTCCCCTGGGGG - Intergenic
1096317451 12:50580687-50580709 CCTTGCCAAATGTACCCTGACGG - Intronic
1096348551 12:50873649-50873671 TGTTACCAAATGTTCCCTGGGGG - Intronic
1096439610 12:51629451-51629473 CATTGCCAGATGTTCCCTGAAGG + Intronic
1096453564 12:51766536-51766558 CATTGCCAGATGTCCCTGGGGGG + Intronic
1096458486 12:51807200-51807222 CCTTGCCAAATGTCCCCGGTAGG - Exonic
1096725485 12:53558189-53558211 CATTGTCAAATGTCCCATGGGGG - Intronic
1098910217 12:76201466-76201488 CATTGCCACATGTCCCCTGGGGG + Intergenic
1098915825 12:76255860-76255882 CATTGCGAAATGTTCTCTGGGGG - Intergenic
1099019235 12:77382460-77382482 ATTTGCCAAATGTTCCCTGGGGG + Intergenic
1099023160 12:77431966-77431988 CATTGCCAAATGTCACCTGAAGG - Intergenic
1099070012 12:78034268-78034290 TATTGCCAAATGTCCCTTGGGGG + Intronic
1099297726 12:80850536-80850558 CATTGCCAAATGTCTCCTGAAGG - Intronic
1099673480 12:85726239-85726261 CACTGCCAAATGTTCTCTGGAGG + Intergenic
1099839844 12:87951764-87951786 CATTGCCAAATATTCCCTAGGGG + Intergenic
1099849966 12:88081206-88081228 CATCGCCAAATGTCCCCAAGAGG + Intronic
1099975064 12:89537933-89537955 CATTGCCAAATGTCCCATGTGGG - Intergenic
1100077102 12:90798754-90798776 CATTGCCAAGTGTCCTCTGGAGG - Intergenic
1100483048 12:94997908-94997930 CATTGCCAAATGTCCCCTTGGGG - Intronic
1100494766 12:95114223-95114245 CATTGCCAGATGTACCCTAGGGG - Intronic
1100527564 12:95433801-95433823 CATTGCCAAATGTCCCTTGTGGG + Intergenic
1100584087 12:95963268-95963290 CATTGCCAAATGTCCCCTGAGGG - Intronic
1100603068 12:96128886-96128908 CATTGCCATATGTCCCCTGGGGG + Intergenic
1100845991 12:98658676-98658698 CATTGTCAAATGTCACCTGGGGG - Intronic
1100971652 12:100077608-100077630 TATTGCCAAATGTCCCCTGGGGG + Intronic
1101063312 12:100994109-100994131 CACTGCCAAATTTCCCCTGGTGG + Intronic
1101099243 12:101375349-101375371 CATTGCCAAATGTCACCTGGGGG - Intronic
1101203935 12:102466366-102466388 CATTGCCAAATGTACCCCTGGGG - Intronic
1101649244 12:106660018-106660040 CTTTCCCAAATCTTCCCAGCTGG + Intronic
1101723751 12:107373077-107373099 CATTGCTAAATGTCCCCTGAGGG + Intronic
1101895138 12:108750835-108750857 CACTGCCAAATGTCCCCTGGGGG - Intergenic
1101941465 12:109102273-109102295 CATTGCCAAAAGTCCCTTGGGGG + Intronic
1102039093 12:109789178-109789200 CATTGTCAAATGTCCCCTGGTGG - Intronic
1102068832 12:110000555-110000577 CATTGCCAAATGTCCCCGGGGGG - Intronic
1102137312 12:110586140-110586162 TATTGCCAAATGTCCCCTGGGGG + Intergenic
1102218230 12:111177032-111177054 CATAGCCAAATGTCCCCCAGAGG + Intronic
1102279443 12:111607429-111607451 CATTGCCAAATGTCTCCTGAGGG - Intergenic
1102545274 12:113649870-113649892 CATTGCCAAAAGTCCCCTGGGGG - Intergenic
1102546633 12:113662013-113662035 TAGTGCCAAATGTTGCCTGGGGG - Intergenic
1102654693 12:114471993-114472015 CATTGTCAAATGTCCCCTGGGGG + Intergenic
1102791749 12:115652199-115652221 CATTGCCAAATGTCCCTTGCGGG - Intergenic
1102841622 12:116131110-116131132 CATTGCCAAATGTCCTCTGGGGG + Intronic
1102908670 12:116696400-116696422 CATTTCGAGATGTTCCCTGGGGG - Intergenic
1102910115 12:116707280-116707302 CATTGCCAAATATCCCCTGGGGG + Intergenic
1102910912 12:116713179-116713201 CATTGCCAAATGTTCCCTGGGGG + Exonic
1102976293 12:117209225-117209247 CATTGCCCAATGTCCCCAGGGGG - Exonic
1102978794 12:117225550-117225572 CATTGTCAAATGTCCCTGGGTGG + Intronic
1103003539 12:117404471-117404493 CATTGCTAAATATTCCTTGGGGG + Intronic
1103025407 12:117569973-117569995 CATTGCCAAATGTTCCCTGGGGG - Intronic
1103044741 12:117726610-117726632 CATTGCCAAATGTTGTCTAGGGG + Intronic
1103141484 12:118552545-118552567 CATTGCCATATGTCTCCCGGGGG + Intergenic
1103173266 12:118840539-118840561 CATTGCCAAATGCACCCTGGTGG - Intergenic
1103232578 12:119344236-119344258 TATTGCCAAATGTCCTCAGGGGG + Intronic
1103413180 12:120726913-120726935 CATTGCCAGATGTCCCTTGGAGG + Intronic
1103790746 12:123469103-123469125 GACTGCCAAATGTCCCCTGGGGG + Intronic
1103809952 12:123605358-123605380 CATTGTCAAATGTTCCCTCAGGG + Intronic
1104055004 12:125222821-125222843 CATTGACAAATGTCCCTGGGGGG + Intronic
1104089180 12:125500437-125500459 CATTGCTAACTGTTCCCTGGGGG + Intronic
1104208036 12:126659660-126659682 CATTGCCCATAGTTGCCAGGTGG - Intergenic
1104282886 12:127393920-127393942 TATTGTCCAATGTTCCCTGGGGG - Intergenic
1104303900 12:127592065-127592087 CATTGCTAAATGTCCCCTGGGGG + Intergenic
1104426010 12:128678649-128678671 CATTGCTAGATGTTCTCAGGGGG - Intronic
1104647014 12:130504888-130504910 CATTGCCAAATATCCCCTGGAGG + Intronic
1105044944 12:132994962-132994984 CATTGTCAAATGCCCCCGGGGGG + Intronic
1105374354 13:19830097-19830119 CATTGCCAAATGTCCCCATGGGG + Intronic
1105717675 13:23083251-23083273 CATTGCTAAATGTCCTCTGGAGG + Intergenic
1105940449 13:25142737-25142759 CATTGCCAAATGTCTCCTGGGGG - Intergenic
1105953584 13:25257119-25257141 CATTGCCAAATGTCCTCTGGAGG + Intronic
1106274536 13:28191408-28191430 TATTACCAAATGTTCTCTGGGGG - Intronic
1106443238 13:29799258-29799280 CATTGCCAAATGTCTCCTAGGGG + Intronic
1106536268 13:30646540-30646562 TGTTGCCAAATGTCCCAAGGGGG - Intronic
1106739978 13:32630330-32630352 CATTGCCAAGTGTCCCCTGCAGG - Intronic
1106801768 13:33263284-33263306 TATTACCAAATGTTCCCTGGAGG + Intronic
1107035733 13:35900779-35900801 CACTGCCAAATGTACCTTGGGGG + Intronic
1107066251 13:36216708-36216730 CATTGCCAAATGTCCCTTGGAGG - Intronic
1107131857 13:36905055-36905077 CATTGCCAGATGTCCCGTGGGGG - Intronic
1107164702 13:37270819-37270841 CATTGTCAAATGTCCCCAGTGGG - Intergenic
1107595186 13:41956270-41956292 CATTGCTAAATGTCCCCTGAGGG + Intronic
1107597360 13:41976764-41976786 CATTGCCAGCTGCTCCCTGGGGG - Intergenic
1107715973 13:43199764-43199786 CATTTCCAAAAGTCCCCTGGGGG - Intergenic
1107813964 13:44227651-44227673 CATTGCCAAATGTGCCCCAGGGG - Intergenic
1107866453 13:44707901-44707923 GATTGCCAAATATCCCCTGGGGG - Intergenic
1107978907 13:45715612-45715634 CATTGCTGAATGTCCCCTGGGGG + Intergenic
1108524359 13:51273199-51273221 CATTGCCAAATGTCCCCTGGTGG - Intronic
1109077615 13:57857908-57857930 CATTGTCAAATATTCCCTGGAGG - Intergenic
1109412306 13:61986954-61986976 CATTACCAAATGTTCCCTGGTGG + Intergenic
1109864013 13:68238274-68238296 CATTGCCAAAAATCCCCTGGAGG + Intergenic
1110033195 13:70644275-70644297 CACTGCCAAATGTCTCCTGGAGG + Intergenic
1110241391 13:73271089-73271111 CATTGCCACATGTCTCCTGGGGG + Intergenic
1110466830 13:75812049-75812071 CATTGCCAAATGTCTCCTGGGGG - Intronic
1110547359 13:76770375-76770397 TATTGCCAAATGATTCCTGGAGG - Intergenic
1111654826 13:91139380-91139402 TATTGCTAAATGTTTCCAGGAGG + Intergenic
1111782898 13:92752292-92752314 CATTGACAAATGATCCCTGGGGG + Intronic
1111892903 13:94105804-94105826 CATTGCTGAATGTTCCTAGGGGG - Intronic
1111948234 13:94687920-94687942 CATTGCCAAATGTTCTCCTGGGG + Intergenic
1112017284 13:95341713-95341735 CATTGCCGAATGTCCCCTGGGGG - Intergenic
1112181397 13:97084806-97084828 CATTGTCAGATGTCCCCTGGGGG - Intergenic
1112241751 13:97688538-97688560 CATTGTCAAATGTCCCCTGGGGG - Intergenic
1112514363 13:100039209-100039231 CATTGCCAAATGTTCACTGAGGG - Intergenic
1112525760 13:100145402-100145424 CATTGCCAACTGTGTCCTGGGGG + Intronic
1112695090 13:101938910-101938932 TATTATCAAATGTTCCCTGGAGG - Intronic
1112747075 13:102538515-102538537 CATTGCCAAATGTCCGCAGAAGG + Intergenic
1112928030 13:104701515-104701537 CATTGCCACATCTTCCCTTGCGG + Intergenic
1113083675 13:106545081-106545103 CATTGCCTAATGTCCCCTTGGGG - Intronic
1113094376 13:106648274-106648296 CGTTGCCAAACGTTCCCTGGAGG + Intergenic
1113314095 13:109160168-109160190 CATTGCTGAATGTCCCCTGGGGG + Intronic
1113315906 13:109178704-109178726 CATTGCCAAAAGTTCCTTGGAGG - Intronic
1113317954 13:109204013-109204035 AATTGGCAAATGTCCCCGGGAGG + Intronic
1113382256 13:109814464-109814486 TATTGCCAAATGTCCCCTGGGGG - Intergenic
1113641293 13:111959120-111959142 CATTTCCAAATGTCCCCTGGGGG + Intergenic
1114032439 14:18588616-18588638 CATTGACACCTGGTCCCAGGTGG + Intergenic
1114140463 14:19903891-19903913 CATTGTCAAATTTTCTAAGGAGG + Intergenic
1114251845 14:20968596-20968618 CATTCCCAGATCATCCCAGGTGG + Intergenic
1114572440 14:23681941-23681963 CATTGCTAAATGTGCCTTGGGGG - Intergenic
1114637122 14:24194097-24194119 CATTGCTAAATGTCCCTTGGGGG + Intronic
1115322947 14:32104897-32104919 CATTGCCATATGCTTCCTGGAGG - Intronic
1115417370 14:33152036-33152058 TATTGACAAATGTCCTCAGGAGG - Intronic
1115439062 14:33411145-33411167 CATTGCCAAATGTCTCCTGGAGG - Intronic
1116283353 14:42939408-42939430 TATTGCCAAATGTCCCCTGGGGG - Intergenic
1116468120 14:45256150-45256172 CATTGCCAATTGTCCCAAGGGGG - Intergenic
1116769511 14:49110932-49110954 CATTGCCAAATGTCCCCTGGGGG + Intergenic
1117028067 14:51641898-51641920 CATTGCCAAATGTTCTCGTAGGG + Intronic
1117239995 14:53821418-53821440 TATTGTCAGATGTTCCAAGGGGG - Intergenic
1117245870 14:53886180-53886202 CATTGCCAAATGTGCCCTGGTGG + Intergenic
1117252355 14:53950427-53950449 CATGGCCAAAGGTGACCAGGAGG + Exonic
1117295375 14:54374403-54374425 CATTGCCAAAAGTCCCCAGGAGG - Intergenic
1117549710 14:56822407-56822429 CATTGCCAAATGTCCCCTGGGGG - Intergenic
1117654053 14:57936517-57936539 CATTGTCAAAAGTTCCCTGGGGG - Intronic
1117673936 14:58137296-58137318 CATTGCTAAATGTCCCCTGGGGG + Intronic
1117777752 14:59199892-59199914 CATTGCCAAATGTCCCCTGGGGG + Intronic
1117959953 14:61153079-61153101 CATTGCCAAATGTCCCCCGAGGG + Intergenic
1118389787 14:65286638-65286660 TATTGCCAAATGTCCCCTAGGGG + Intergenic
1118717395 14:68570004-68570026 TATTGCCAAGTGTTCTCAGAGGG - Intronic
1119008311 14:70956001-70956023 CATTGCTACATGTGCCCTGGGGG - Intronic
1119224313 14:72933184-72933206 CATTGCCAGATGTCCCCTGGTGG + Intronic
1119266741 14:73267204-73267226 CACTGCCAAATGTCCCCTGGTGG + Intronic
1119393116 14:74304661-74304683 CATTGCCAAATGTCCCTTAGGGG + Intronic
1119591493 14:75892497-75892519 TATTGCCAAATGTCTCCTGGGGG - Intronic
1119669115 14:76505488-76505510 CATTGCAAAATGTCCCCTGGGGG - Intergenic
1119677832 14:76569190-76569212 CATTGCCGAATGTCCCCTGTGGG - Intergenic
1119840441 14:77788747-77788769 CATTGCCAAAGATCCCCTGGGGG + Intergenic
1120108612 14:80526080-80526102 CATTGTCAAATGTCCCCTGGAGG - Intronic
1120415544 14:84214717-84214739 CATCACCAAATGCCCCCAGGGGG + Intergenic
1120757526 14:88258014-88258036 CATTGCCAAATGCCCCCTAGAGG + Intronic
1120771440 14:88384800-88384822 CATTGTGAAATATTCCCTGGGGG - Intergenic
1121489188 14:94345862-94345884 CATCGCCAGATGTTCCCTGGGGG - Intergenic
1121788216 14:96679150-96679172 CATTGCCAAATGTCTCCTGGGGG - Intergenic
1121951112 14:98171860-98171882 CATTGTCAAATGTCCCCTGGGGG + Intergenic
1122109526 14:99487455-99487477 CATTGCCAAATGTCCCCTGGGGG + Intronic
1122139948 14:99657111-99657133 CATTTCCAAATGTCCCAAAGGGG - Exonic
1122295336 14:100702294-100702316 CATTGCTAAATGTCCCCTGGAGG + Intergenic
1122302981 14:100742163-100742185 CATTGCCAAATGTCTCCTGGGGG - Intergenic
1122307430 14:100774502-100774524 CATTGCCTACTGTCCCCCGGGGG - Intergenic
1122447440 14:101780427-101780449 CATTGCCAAATGTCCCTTGGGGG - Intronic
1122925495 14:104897674-104897696 CATCGCCAGATGTTCCTGGGTGG + Intergenic
1124337831 15:28870300-28870322 CATGGCCAAATGTCCCTATGGGG + Intergenic
1124370323 15:29101014-29101036 CATTGCTAAATGTCCCCTGAGGG - Intronic
1124445998 15:29733009-29733031 CATTACCAAAATTTCCCAGTGGG + Intronic
1124446730 15:29740828-29740850 CATTGCCAGATGTTTCCTTGGGG - Intronic
1124882932 15:33659037-33659059 CATTGCCAAATGTTCTGTGAAGG - Intronic
1125292472 15:38165131-38165153 CATTGCCAAATGTTCCCTGGGGG - Intergenic
1125455361 15:39853655-39853677 CATTGCCAAATGTTCCCAGGGGG - Intronic
1125805905 15:42493475-42493497 CATTGCCAAATATCCCCCGGAGG + Intronic
1125900943 15:43346523-43346545 CATTGCCAAGTGTCCCCTGGGGG + Intronic
1125994915 15:44149864-44149886 CATTGCAAAATGTTCATATGGGG - Intronic
1126006827 15:44265960-44265982 CATTGCCAAAAGTCCCCTGAGGG + Intergenic
1126056572 15:44735526-44735548 CATTGCCAAATGTCTCCTGGGGG - Intronic
1126468692 15:48984092-48984114 CGTTGCCGAATGTCCCCTGGAGG + Intergenic
1126523588 15:49623955-49623977 ACTTGCCAAATGTACCCAAGGGG - Intronic
1126724295 15:51615572-51615594 CACTGCCAAATGTCTCCTGGTGG + Intronic
1126918087 15:53488236-53488258 TATTGCCATATGTTACCGGGTGG + Intergenic
1127135045 15:55911161-55911183 CATTGCCAGATGTCCCCTAGGGG - Intronic
1127376647 15:58391302-58391324 CATTGCCAAATGTCCCCCCGAGG - Intronic
1127381445 15:58434035-58434057 CATTGCCAAGTGTCCCCTGGAGG - Intronic
1127532670 15:59860053-59860075 CATTGCCAAGTGTTCTTTGGGGG - Intergenic
1127604020 15:60568075-60568097 CACTGATAAATGTTCCCTGGGGG + Intronic
1127637185 15:60882254-60882276 CATTGCCAAATATACCCTAGGGG - Intronic
1127710459 15:61592115-61592137 CATTGCCAAATGTCCCCTGTGGG + Intergenic
1127799614 15:62466511-62466533 CATTGCCAAATGTTCCCTGTGGG + Intronic
1128035359 15:64520339-64520361 CACTGCCAAATATCCCCTGGAGG + Intronic
1128386597 15:67153591-67153613 CATTGCCAAATGTCCCCTGGGGG - Intronic
1128394883 15:67214533-67214555 GACTGCCAAATGTCCCCTGGGGG + Intronic
1128636388 15:69305238-69305260 CATTGCCAAATGTCCTCTCGGGG + Intronic
1128762083 15:70223981-70224003 CATTGCAAAATGTCCCTGGGGGG + Intergenic
1128766939 15:70256964-70256986 CATCGCCAAATGTCACCTGGGGG + Intergenic
1128795095 15:70460761-70460783 CATTGCCAAATGTCCCCTAGAGG + Intergenic
1128925697 15:71653432-71653454 CATTGCCAAATGTTCCCCATGGG - Intronic
1129623001 15:77166548-77166570 CATTGTCAAATGTGCCCCGGGGG + Intronic
1129799573 15:78403849-78403871 CACTGCCAAATGTCCCCTGTGGG - Intergenic
1129817823 15:78570937-78570959 CATTGTCAGATGTGCCCTGGGGG + Intronic
1129876678 15:78979896-78979918 CATTGCCAAATGTCCACTAGGGG - Intronic
1129929817 15:79401455-79401477 CATTGCCAAATGTCCCCTGGGGG - Intronic
1129971098 15:79778794-79778816 CATTGCCAAATGTCCCATAGAGG + Intergenic
1130001886 15:80054932-80054954 CATTGCCAAATGTCCTGTGGGGG + Intergenic
1130132070 15:81152197-81152219 CATTGCTAAATGTCCCTGGGAGG + Intergenic
1130192931 15:81753573-81753595 CATTGCCAGATGTTTCCTGGAGG - Intergenic
1130221440 15:82022780-82022802 CATTGCCAAATGTTCCCGAGGGG - Intergenic
1130366967 15:83249428-83249450 CATTGTCAAATATTCCCTGATGG - Intergenic
1130421685 15:83754188-83754210 CATCTCAAAATGTTCCCTGGGGG + Intronic
1130631224 15:85570714-85570736 TATTGTCAAATGTCCCCTGGGGG + Intronic
1130693482 15:86106494-86106516 CATTGCCAAACATCCCCTGGGGG - Intergenic
1130717370 15:86348426-86348448 CATTGCCAAAAGTCTCCTGGAGG - Intronic
1130774033 15:86958340-86958362 CATTGCCAAATGCCCTCTGGAGG + Intronic
1131280662 15:91018602-91018624 CATTGCCAAATGTCCCTCGGAGG - Intronic
1131305287 15:91237391-91237413 TATTGCTAAATGTCCCCTGGGGG + Intronic
1131370391 15:91876212-91876234 CATTGCCCAACCTTCCCAGTTGG + Intronic
1131393586 15:92069121-92069143 TATTGGCAAATGTCCCCTGGGGG - Intronic
1131402072 15:92133188-92133210 CATTGCCACATGTCCCTCGGGGG + Intronic
1131421731 15:92312015-92312037 CATTGCCAAATGTCTCCTGGGGG - Intergenic
1131521697 15:93121095-93121117 TAGTGCCAAATGTCCCCCGGGGG + Intergenic
1132277443 15:100581386-100581408 CATTGTCAAATGTCCCCTGGGGG + Intronic
1132394903 15:101465223-101465245 CATGGCCACTTGTTGCCAGGCGG + Intronic
1133140880 16:3743111-3743133 CATTGCCAGATGTCCCCTGGAGG - Intronic
1133355931 16:5136870-5136892 CATGGCCACATGTTCTCTGGGGG - Intergenic
1133373727 16:5266350-5266372 TATTGCCTAATGTCCCCCGGGGG + Intergenic
1133443073 16:5836791-5836813 CATTGCCAAAAGTTGCCTGAAGG + Intergenic
1133457317 16:5953963-5953985 CATTTCCAAATGTCCCCTGGGGG - Intergenic
1133518041 16:6528867-6528889 CATTCCCAAATGTCTCCTGGTGG + Intronic
1133583534 16:7169506-7169528 CATGGCCTAATGTCCCCAGGAGG + Intronic
1133603705 16:7365494-7365516 CATTTCCGAATGTTCCCTGTGGG - Intronic
1133755380 16:8758697-8758719 CATGGCCAGATGTCCCCTGGTGG + Intronic
1133826241 16:9280689-9280711 TATGGCCAAATGTCCCCTGGAGG - Intergenic
1133882690 16:9797896-9797918 CATTGCCAAATGTCACCTGAGGG + Intronic
1134187288 16:12094612-12094634 CATGGCTAAATGTCCCCTGGGGG - Intronic
1134234128 16:12452236-12452258 CATTGCCAAATGTCCCCGTAGGG - Intronic
1134289988 16:12896708-12896730 CGTTGCCAAATGTCCCCTGAGGG - Intergenic
1134298241 16:12966131-12966153 CATTGCCAGATGTCCCCTAGAGG + Intronic
1134331173 16:13252302-13252324 TATTGCCAAATGTCCCCTGGAGG - Intergenic
1134363324 16:13553076-13553098 CATTGCCAAATGACCCCTGGGGG + Intergenic
1134394198 16:13848113-13848135 CATGGCCAAAAGTTCCCAGGAGG + Intergenic
1134568805 16:15274125-15274147 CATTGCCAAATGTCCCCTGAGGG - Intergenic
1134669946 16:16047528-16047550 TATTGCCAAACGTGCCCTGGTGG - Intronic
1134733630 16:16482237-16482259 CATTGCCAAATGTCCCCTGAGGG + Intergenic
1134837744 16:17376165-17376187 CAGTGTCAAATGTTCCCTGGGGG - Intronic
1134933871 16:18230045-18230067 CATTGCCAAATGTCCCCTGAGGG - Intergenic
1135028113 16:19014325-19014347 CATTGCCTGATGTTCCTTGGGGG + Intronic
1135029299 16:19025199-19025221 GATTGCCAAATGTTTCCTAGTGG + Intronic
1135134288 16:19876218-19876240 CATTGCCAAATGTCCCCTTGGGG - Intronic
1135285255 16:21187643-21187665 CATTGCCAAATGTCCCCTGGGGG - Intergenic
1135392722 16:22107217-22107239 CATTGCTAAATGTTCCCGTGGGG - Intronic
1135408202 16:22213477-22213499 CATTGCCAAATGTCCCTTGAGGG + Intronic
1135911804 16:26567984-26568006 CATTGCCAAATGTCCCCTGAAGG - Intergenic
1136685141 16:31989595-31989617 CATTGTCAAATGTCCTCTGGGGG + Intergenic
1136785754 16:32933130-32933152 CATTGTCAAATGTCCTCTGGGGG + Intergenic
1136884017 16:33920674-33920696 CATTGTCAAATGTCCTCTGGGGG - Intergenic
1137339980 16:47591958-47591980 CATTGTCAAATGTCTCCTGGAGG - Intronic
1137648091 16:50093446-50093468 CGTTGCCAAATGTCCCCAGGTGG - Intronic
1138140809 16:54566990-54567012 CATTGCCAAATGTCCTCTGGGGG + Intergenic
1138153339 16:54679662-54679684 CATTGCCAAATGTCCCCTGGGGG - Intergenic
1138219169 16:55236491-55236513 CATTGCCAAATGTCCCCTGGGGG + Intergenic
1138297519 16:55899672-55899694 CATTGCCAAATGTCCCCTGGGGG - Intronic
1138378060 16:56580531-56580553 CATTGCCAAATGACCCCTGGGGG + Intergenic
1138484256 16:57326670-57326692 CATGGACAAATGTTCCCAGGAGG + Intergenic
1138628791 16:58276574-58276596 CATTGCCAAATGTCCCCTTGGGG + Intronic
1138921931 16:61541284-61541306 AGCTGCCAAATGTTCCCTGGGGG + Intergenic
1139028867 16:62854562-62854584 CATTGCCAAATATTATCTGGGGG + Intergenic
1139286828 16:65822777-65822799 CACTGCCAAATGTCCCCTTGTGG + Intergenic
1139487826 16:67268792-67268814 CATTGCCAAATGTCCCCTGGGGG - Intronic
1139802322 16:69533251-69533273 CATTGCCAAATGTCCCCTGCGGG + Intergenic
1139974620 16:70799541-70799563 CATTGCTAAATGTCCCCTGAAGG - Intronic
1140058026 16:71542880-71542902 CATTGTCAAGTGTTCCCTGTGGG - Intronic
1140267825 16:73435620-73435642 CATTGTCAAATGTTCCCTGAAGG + Intergenic
1140503406 16:75454248-75454270 CATTGTCAAATGTCCCCAAGGGG + Intronic
1140686404 16:77437633-77437655 GATTTCCAAATGTTTCCTGGTGG + Intergenic
1140698027 16:77554330-77554352 CATTGCCAGATGTTCCCTGGTGG - Intergenic
1140700195 16:77574554-77574576 CATGGCCAAATTTCCCCTGGGGG + Intergenic
1140824540 16:78693606-78693628 CATTGCCAAATGTTCCCGACAGG - Intronic
1140899251 16:79352844-79352866 CATTGCAAAATGTTGCAGGGAGG + Intergenic
1140932345 16:79639542-79639564 CATTGCCCACTGTCCCCCGGAGG - Intergenic
1140939223 16:79705766-79705788 CATTGTCAACTGTCCCCTGGGGG - Intergenic
1141022502 16:80510711-80510733 TATTGCCAAATGTCCCCGGGAGG + Intergenic
1141029354 16:80574189-80574211 CATTGCCAAACTTACCCTGGGGG - Intergenic
1141101130 16:81198307-81198329 CATTGCCAAATGTCCCCTGGGGG - Intergenic
1141148566 16:81548884-81548906 CATTGCCAAATGCCCCCCGTTGG + Intronic
1141219389 16:82055086-82055108 CATTGTCAAATGTTCCCTGGGGG + Intronic
1141219847 16:82059344-82059366 CATTGCCAGATATTCCCCAGGGG + Intronic
1141320041 16:82999897-82999919 CACTGCCAAATGCCCTCAGGGGG - Intronic
1141353081 16:83317011-83317033 CATTGCCAAATAATCCCAGGGGG - Intronic
1141369789 16:83476295-83476317 CATTGCCAAATGTTCCCTAGAGG + Intronic
1141440013 16:84024142-84024164 CATGGTCAAATGTTCCCTGGGGG + Intronic
1141516129 16:84546351-84546373 CATTGCCGAGTGTTCCCTGGGGG + Intronic
1141742776 16:85905103-85905125 CATTGCCAAATATCTCCTGGTGG + Intronic
1141743014 16:85906759-85906781 CATGGCCAAGTATTCCCTGGAGG - Intronic
1141982600 16:87559792-87559814 CATCACCAAATGTTCCCTGGGGG + Intergenic
1203087985 16_KI270728v1_random:1194792-1194814 CATTGTCAAATGTCCTCTGGGGG + Intergenic
1143028064 17:3952561-3952583 CATTGCCAAATGCCCCTGGGGGG - Intronic
1143078067 17:4362350-4362372 CATTGCCAAATGTCTCCTGAGGG - Intronic
1143238198 17:5420901-5420923 CATTGCCAAATGTTCCTTGGGGG + Intronic
1143488512 17:7269445-7269467 CGTTGCCAAATGTCCCAGGGAGG + Intergenic
1143885319 17:10060869-10060891 GCTTGCCAAATGTCCTCAGGGGG - Intronic
1143946071 17:10593560-10593582 CATTGCAGAATGTCCCCTGGAGG + Intergenic
1143988101 17:10932951-10932973 CATTGCCAAATGTCCCCTGGGGG + Intergenic
1144197214 17:12906091-12906113 TGTTGCCAAATGACCCCAGGAGG + Intronic
1144319561 17:14101012-14101034 CAATGCTAAATGTCCCCTGGGGG + Intronic
1144487128 17:15676228-15676250 CGTTGCCAAATGTCCCCCGGGGG + Intronic
1144913903 17:18706087-18706109 CATTGCCAAATGTCCCCTGGGGG - Intronic
1146209527 17:30931277-30931299 CATTGCCAAATGTCCTCTGGGGG - Intronic
1146539410 17:33681414-33681436 CATTTCCAAATGTCCCCTAGAGG + Intronic
1146640583 17:34537808-34537830 CATTGCCAAATGTCCCTTGGGGG - Intergenic
1146739598 17:35270833-35270855 CATCGCCAAATGTCCCTTGGGGG + Exonic
1147640651 17:41996864-41996886 CATTGCTAAATGTCCCCTGGAGG - Intronic
1148955495 17:51350537-51350559 CATTGCCAAATGTCCCCAGGAGG - Intergenic
1149051366 17:52309477-52309499 TATTGCCAGATGTTCCCTGAGGG - Intergenic
1149250703 17:54765788-54765810 CATTGCCAAATGTCCTCTGTGGG - Intergenic
1149269864 17:54966613-54966635 CATCGCTAAATGTTCCCTGAGGG + Intronic
1149439473 17:56662757-56662779 TATTTCCAAATGTCTCCAGGTGG + Intergenic
1149854999 17:60074722-60074744 CATTGCCAAATGTTCCTTGGGGG - Intronic
1149963338 17:61136528-61136550 TATTGCCAAATGTCCCCTTGTGG + Intronic
1150015209 17:61550034-61550056 CATTGCCAAATGTCCTCTGATGG + Intergenic
1150186668 17:63189123-63189145 CATGGCCAAATGTTCCCTAATGG + Intronic
1150261685 17:63797607-63797629 CATTGCCAGATGTTGCCTAGGGG + Intronic
1150481182 17:65512517-65512539 CATTTCCAAATGTCCCTCGGAGG - Intergenic
1150658078 17:67053590-67053612 CATCGCCAAGTGTCCCCTGGGGG + Intronic
1150837485 17:68577453-68577475 CATTGCCAAATGTCCCCTGAGGG - Intronic
1150966874 17:69980717-69980739 CATTGTCAAATGGCCCCTGGGGG + Intergenic
1150985743 17:70195326-70195348 CATTGTGAAATGTTCCCAGGGGG - Intergenic
1151124705 17:71832259-71832281 CATTGTCAAATGTCCTCTGGGGG - Intergenic
1151146097 17:72042894-72042916 CATTTCCAAGTGTTCCCTGGAGG + Intergenic
1151233600 17:72702359-72702381 CATTGCCCACTGTTCCCTAGGGG - Intronic
1151275639 17:73032009-73032031 CATTGCCAAATGTCCTGTGGAGG - Intronic
1151420353 17:73993103-73993125 CATTGCCAAATGTCGTCTGGGGG - Intergenic
1151461388 17:74256257-74256279 CATTGCCAAATGTCCCCAGGGGG - Intronic
1151545964 17:74793333-74793355 CATTGTCACATGTTCCCAGCAGG + Intronic
1151621097 17:75245472-75245494 CACTGCCAAATGTTCCCTGGAGG + Intronic
1151648320 17:75449348-75449370 CATTGCCAAATGTCCCTAGGAGG + Intronic
1151692506 17:75695311-75695333 CATTGCCAAATGTCCCCTTGGGG + Intronic
1152080561 17:78184828-78184850 CATTGTCAAATGGACCCTGGCGG + Intronic
1152306725 17:79525268-79525290 CATTGCCAAATGTCCCCCCGGGG + Intergenic
1152393023 17:80013876-80013898 CTTTGCCAAATGTGCCCTGGAGG + Intronic
1152427891 17:80228546-80228568 CATTGCCACGTGTCACCAGGGGG - Intronic
1152980961 18:275876-275898 CATTGACAAATTCTCCCTGGTGG - Intergenic
1153423369 18:4934102-4934124 CAGTGCCAAATGTCCTCTGGGGG + Intergenic
1153512463 18:5870381-5870403 CATTGCCAAGTGTTCCCTGGGGG + Intergenic
1153675680 18:7454219-7454241 CATTGCCAAATGTCCCTTGGAGG + Intergenic
1154369508 18:13746736-13746758 CATTGCCAAATGTCCCCTGGTGG + Intronic
1155001146 18:21687965-21687987 CATTGCCAAATGTTCCCTGGGGG + Intronic
1155007888 18:21745429-21745451 CATTGCCAGATGTCCCCTAGTGG + Intronic
1155128867 18:22909946-22909968 CATTGCCAAATGTCCCCTGTGGG + Intronic
1155190279 18:23423387-23423409 CACTGCCAAATGCCCCCTGGAGG - Intronic
1155931991 18:31718198-31718220 CATTGCCAAATGTCCCCTGGGGG - Intergenic
1155951492 18:31918444-31918466 CGTTGCCAGATGTTTCCTGGGGG - Intronic
1156020889 18:32598054-32598076 CTTAGGCCAATGTTCCCAGGGGG - Intergenic
1156093464 18:33499865-33499887 TATTGCCAAATGTCTCCAGAAGG + Intergenic
1156109556 18:33708708-33708730 AATTGCCAAATGGTTCCAGGAGG + Intronic
1156187037 18:34675271-34675293 CATTGTCATATGTCCCCTGGGGG + Intronic
1157130610 18:45003934-45003956 CATTGCCAAAAGTCTCCTGGTGG - Intronic
1157157211 18:45280027-45280049 CATTGCCAAATGTCCCCTGGTGG + Intronic
1157176367 18:45456175-45456197 CATAGCCAAATGCCCCCTGGGGG + Intronic
1157198236 18:45637671-45637693 CATTGCCTAATGTCTCCAAGGGG - Intronic
1157271352 18:46278773-46278795 CATTGCCAAATATTTACTGGGGG - Intergenic
1157601549 18:48896251-48896273 CATTGCCAAGTGTCCCCTGGGGG - Intergenic
1157644253 18:49251094-49251116 TATTGTCAAATGTCCCCTGGGGG + Intronic
1157722173 18:49933565-49933587 CATTGCCAAATGTTCTCTTGGGG - Intronic
1157735990 18:50049725-50049747 CATTGCCAAATGTTCGGGGCAGG + Intronic
1157741750 18:50099642-50099664 CCTTGCCATATGTTTCCTGGGGG - Intronic
1157882249 18:51331588-51331610 TATTGCCAAATGTCCCATGGTGG + Intergenic
1157882883 18:51338496-51338518 CATTGCCAAATGCCCTCTGGGGG + Intergenic
1158101993 18:53840260-53840282 CATTGCCAAGTGTCCCCCGGGGG + Intergenic
1158507664 18:58060736-58060758 CATTGCCAAATGTCCCCTAGGGG - Intronic
1158571713 18:58602031-58602053 CATTACCAAATGTCCCCTGGGGG + Intronic
1158590129 18:58772151-58772173 CATTGCCAAACGCTCCCTGGGGG + Intergenic
1158730621 18:60018507-60018529 CATCGCCAAATGGCCCCAGGAGG + Intergenic
1158891683 18:61878205-61878227 CATTGCCAAATGTCCTCTAGGGG - Intronic
1158902203 18:61974424-61974446 CATTGCCAAATGTCCCCATGGGG - Intergenic
1159019393 18:63130971-63130993 CATTGCCAAATGTCCCCTGGGGG - Intronic
1159888978 18:73936765-73936787 CGTTGCCAAATGTCCCCTGGGGG - Intergenic
1160059293 18:75514952-75514974 TATTGCTAGATGTTCCCTGGGGG - Intergenic
1160107052 18:75987906-75987928 TATTGCCAAATGTTCACTGCGGG + Intergenic
1160695518 19:482400-482422 CATAGCCAAGTGTCCCCTGGGGG - Intergenic
1161134852 19:2613664-2613686 CATTGCCCAGTGTCCCCTGGGGG - Intronic
1161156534 19:2734709-2734731 CATCGCCCAGTGTTCCCTGGGGG + Intronic
1161262118 19:3343873-3343895 CATTGCCAAGTGTCCCCTGGGGG + Intergenic
1161518947 19:4713026-4713048 CATCGCCAAGTGTTCCTTGGGGG - Intronic
1161751390 19:6099855-6099877 CATTGCCAGATGTCCTGAGGTGG - Intronic
1161956966 19:7501481-7501503 CATTGCCAAATGTTCCCTGGGGG - Intronic
1161999351 19:7733237-7733259 CATAGCCAAATGTCCCCTGGTGG - Intronic
1162140728 19:8584267-8584289 CATTGCCCAATGTCCCCTGGGGG - Intronic
1162201123 19:9020977-9020999 TATTGCCAACTGTCCCCTGGGGG + Intergenic
1162563709 19:11433380-11433402 CATTGCCAAATGGCCCCTGTGGG + Intronic
1162786430 19:13037758-13037780 CATTGCCAAATGTTCCCTGCGGG - Intronic
1162822469 19:13231376-13231398 CATTGCCAGGTGCCCCCAGGGGG - Intronic
1162840937 19:13355936-13355958 CACTGCCAAGTGTCCCCTGGGGG + Intronic
1162859284 19:13493471-13493493 CATTGCCAAAAGTCCCCTTGGGG + Intronic
1163054743 19:14709889-14709911 CATTGCCAAATGTCCCCTGGGGG + Intronic
1163071488 19:14845830-14845852 CATTGCTCAATGTCCCCTGGGGG + Intergenic
1163298779 19:16430010-16430032 CATTGCCCAATGTCCCCTGGGGG + Intronic
1163349199 19:16764759-16764781 CATTGTCAAGTGTCCCCTGGGGG - Intronic
1163381093 19:16969288-16969310 CATTGCCCAATGTTCCCTGGGGG - Intronic
1163477319 19:17533889-17533911 CATTGCCAAGTGTCTCCCGGGGG + Intronic
1164474515 19:28564914-28564936 CATTGCCAAATGTCCCCTAGGGG + Intergenic
1164631590 19:29765436-29765458 CATTGTCACATGTGCCCTGGGGG - Intergenic
1164692304 19:30220419-30220441 CATGGCCACAGGGTCCCAGGTGG - Intergenic
1165874829 19:38998873-38998895 TACTGCCAAATATCCCCAGGGGG - Intronic
1166251080 19:41571139-41571161 CTTTGCCAAATGTCCCCTAGAGG + Intronic
1166417428 19:42606516-42606538 CATTGCCAGATGCCCCCTGGAGG - Intronic
1166476569 19:43130995-43131017 TATTACCAAATGTTCACAGGTGG - Intronic
1167092799 19:47356173-47356195 CATTGCCATATGTTCCCTCTGGG + Intronic
1167092974 19:47357475-47357497 CATTGCCATATGTTCCCTCTGGG - Intronic
1167789547 19:51665003-51665025 CCTTGCCAAATGTCCCCTGGGGG + Intergenic
1167811891 19:51840499-51840521 CACACCCAAATGTACCCAGGTGG - Intergenic
1168070702 19:53949668-53949690 CATTGCCAAATGCAACCTGGGGG - Intergenic
1168146529 19:54422461-54422483 CATTGCCAACTGTCCCCCCGGGG - Intronic
1168243868 19:55100285-55100307 CGTGGCCAAATGTCCCCTGGGGG - Intronic
1168281919 19:55310550-55310572 CATTACTAAATGTCCCTAGGGGG - Intronic
1168374127 19:55861175-55861197 CATCCCCAAATGTCCCCTGGGGG + Intronic
1168379177 19:55905846-55905868 CATTGCCAAATGTCCCCTGGGGG + Intronic
1168411412 19:56142437-56142459 CATTGCCACATGTCCCCTGGGGG - Intronic
1168435466 19:56313953-56313975 CATTGCCAAATGTCCCCTGGGGG - Intronic
1168484195 19:56747193-56747215 CATGGCAAAATCTTCCCTGGTGG + Intergenic
1168490560 19:56805236-56805258 CATTGCCACATGTCCCCTGGAGG + Intronic
1168529578 19:57117143-57117165 CATTGCCAATTGTCCCCTGGGGG + Intergenic
925005190 2:437900-437922 CCTTGCCAAATGTTCCCTGGGGG - Intergenic
925248711 2:2410228-2410250 TATTGCCAAATATACCCTGGGGG - Intergenic
925528414 2:4831532-4831554 AATTGCCAAATGTCCCCTGGGGG - Intergenic
925623836 2:5821837-5821859 TATTGCTAAATGTCCCCAGGAGG + Intergenic
925925817 2:8669465-8669487 CATTGCTAGATGTCCCCGGGAGG - Intergenic
926052080 2:9751784-9751806 CATTGCCAAATGTGCCCTGGGGG - Intergenic
926492611 2:13543527-13543549 TATTGCCACATGGTCCCTGGAGG - Intergenic
926513816 2:13815780-13815802 CATTGTCACATGTCCCCAGGGGG + Intergenic
926751185 2:16199930-16199952 CATTGATAAATGTTTCCAGGGGG - Intergenic
926900168 2:17742116-17742138 CATTGCTAAATGTCCCTGGGGGG + Intronic
927153883 2:20210885-20210907 CAATGGCAAATGTCCTCAGGAGG + Intronic
927247540 2:20969645-20969667 CATTGCCAAATGGTTCTTGGGGG - Intergenic
927366472 2:22302748-22302770 CTTTGCCAACTGTCCCCTGGAGG + Intergenic
927507036 2:23621386-23621408 CATTGCCAAACGTGCTCAGGAGG - Intronic
928057680 2:28074401-28074423 TGTTGCCAAATGTCCCCGGGAGG + Intronic
928445167 2:31327633-31327655 CATTGCCTAATGTTCCCTAAAGG + Intergenic
928715189 2:34051965-34051987 CATTGCCAAATGTCCCATAGGGG + Intergenic
928976656 2:37094381-37094403 CATTGCTAAATGTCCCCGAGGGG + Intronic
928997361 2:37307150-37307172 CATTGCCAAATGTTCCCAGGGGG + Intronic
929178272 2:39003997-39004019 CATTGCTAAATGCTCCCTAGGGG + Intronic
929210343 2:39349993-39350015 CTTTGCCAAATGTTCCTTGGGGG - Intronic
929274248 2:40008232-40008254 CATTGCCAAATGTCCCCTAGCGG - Intergenic
929866054 2:45718227-45718249 CATTACCAAATGTCCCCTGCAGG + Intronic
929914184 2:46120271-46120293 CATTGCCAAATCTTCCCTGGAGG - Intronic
930330472 2:49977283-49977305 CATTGTCAAATGTTCCCTGGGGG - Intronic
930574680 2:53131914-53131936 CATTGCCAAATGACCCCTGTAGG - Intergenic
930586773 2:53276551-53276573 CATTGCCAAATGTACCCCTAGGG + Intergenic
930625482 2:53692138-53692160 CATTGCCAAATGTCTACAGGGGG + Intronic
930693244 2:54386027-54386049 CATTGCCAAATGTCCTCTGGGGG - Intergenic
930862030 2:56084455-56084477 CTTTGCCAAATGTTCCTAGGAGG - Intergenic
931037438 2:58259166-58259188 CATTGCCAAATGTCCCCTGGGGG - Intergenic
931225958 2:60332547-60332569 TACTGCCAGATGTTCCCTGGGGG - Intergenic
931258642 2:60597572-60597594 TGTTGCCAAATATTCCCTGGAGG - Intergenic
931410940 2:62030527-62030549 CATTGCCAAGTGTCTCCTGGGGG + Intronic
931412776 2:62049420-62049442 CATTGCCAAATGTCCCCTGGGGG - Intronic
931495482 2:62802239-62802261 CATTGCCAAATATTCCCCCGGGG - Intronic
931525709 2:63150319-63150341 CATTGCCAAATGTCTCCTGGGGG - Intronic
931635392 2:64336848-64336870 TGTTGCCAAATGTACCCTGGGGG + Intergenic
931939730 2:67238935-67238957 CATTGCCAAATGTCCCTGGCAGG - Intergenic
931968521 2:67560306-67560328 CATTGTCAAATGTCCCTTGGGGG + Intergenic
931980098 2:67685473-67685495 CATAGCCAAATGTCCCCTGGGGG - Intergenic
932056644 2:68452248-68452270 CATTGCCAAATGTCTCCTGGGGG - Intergenic
932433538 2:71689618-71689640 CATTGCCAAACGTGCCCTGGAGG - Intergenic
932710220 2:74057604-74057626 TATTGCCAAATGTCCCCTGGGGG - Intronic
932855297 2:75227460-75227482 CATTGCCAAATGTCCCCTAAGGG - Intergenic
932860508 2:75286585-75286607 CATTGCCAAATGTCCTTTGGAGG - Intergenic
933038888 2:77435138-77435160 CATTGCAAAATTTTCTCTGGGGG + Intronic
933227732 2:79770056-79770078 CATTGTCAAATGTCCCCTGGAGG - Intronic
933393576 2:81703667-81703689 CATGGGCTAATTTTCCCAGGTGG + Intergenic
933798323 2:85939215-85939237 CATTACCAAATGTCCCCTGGAGG + Intergenic
934064445 2:88327618-88327640 CATTGCCAACTATTCCCTGGGGG + Intergenic
934104939 2:88686911-88686933 CATTGTCAAATATCCCCATGAGG + Intergenic
935044422 2:99467533-99467555 GATTGCCAAATGTTCTCAGAGGG - Intronic
935050216 2:99518839-99518861 CATTGCCAAATGTCTCCTGAGGG - Intergenic
935186624 2:100740045-100740067 CCTTGCCAGATGTTGCCTGGTGG - Intergenic
935374962 2:102386644-102386666 CATTCCCAAATGGCCTCAGGAGG + Intronic
935679244 2:105621731-105621753 CATTTCCACAAGTTCCCAGCTGG - Intergenic
935720055 2:105972054-105972076 CAATGCAAAACGTTACCAGGAGG + Intergenic
935948055 2:108303827-108303849 CATTGCCAAATGTCCCCTAGTGG + Intronic
936088873 2:109488338-109488360 CATTGCCACCTGTCCCCTGGAGG + Intronic
936411178 2:112259668-112259690 CATTGCCAAATGTCCTCTGCGGG + Intergenic
936523697 2:113228578-113228600 CATTGCCATATGTCCTCAGCAGG + Intronic
936864933 2:117066618-117066640 CCTGGCCAAATGTCCCCTGGAGG - Intergenic
936918400 2:117663194-117663216 CATTACCAAATGAACCCTGGTGG - Intergenic
937132020 2:119520945-119520967 CATTGCCAAATTTTTTCTGGGGG - Intronic
937163163 2:119785177-119785199 CATTGCCAAGTGTTCCGTGGAGG + Intronic
937291134 2:120782813-120782835 TATTGCCAAATGTCCCTTGGTGG + Intronic
937330247 2:121022161-121022183 CATGGCCAAATCTCCCCTGGGGG - Intergenic
937524787 2:122754973-122754995 CATGGTCAAATGTGCCCTGGGGG + Intergenic
937791497 2:125967397-125967419 AATTGGCAAATGTTCCCACAAGG + Intergenic
937880845 2:126863428-126863450 CATTGCCAAATGTCTCCTGCAGG + Intergenic
938702368 2:133891023-133891045 CATTGGCAAATGTTCTCTGGAGG - Intergenic
938786119 2:134631479-134631501 CATTGCCAGACGTCCCCTGGGGG + Intronic
938925073 2:136031740-136031762 CATTGCCAAATGTCCTCCGAAGG + Intergenic
938933864 2:136111715-136111737 CCTTACCAAATGTTCCCTGTTGG + Intergenic
938985422 2:136570756-136570778 CATTGCCAAATGTTCCTTGGGGG + Intergenic
939059554 2:137403783-137403805 CATTGCCAAATGTTCCCTTGGGG - Intronic
939635404 2:144576032-144576054 CAGTGCCAAATGTCCCCTGGGGG - Intergenic
939678150 2:145097562-145097584 CATTGCCAAATGTCCCCAGTGGG - Intergenic
939699432 2:145371804-145371826 CATTGCCAAATATCCCCCAGAGG + Intergenic
939919810 2:148096258-148096280 CATTGCCAAATGTGCCTGGAGGG - Intronic
940287621 2:152048240-152048262 CATTACCAAAAGTTCCCTGGGGG + Intronic
940467397 2:154048358-154048380 CATTGCCAAATGTACTCTGGGGG + Intronic
941351797 2:164447236-164447258 CATTGCCGAATATCCCCAGTGGG - Intergenic
941495080 2:166190287-166190309 CTTTGCTAAATGTTCTCAGGGGG - Intergenic
941620917 2:167777866-167777888 CATTGCCATATGTCCCCTGAGGG - Intergenic
941666786 2:168250275-168250297 CATTGCCAAATGTCCCCTGGAGG + Intergenic
941744645 2:169073916-169073938 TAATGCCAAATGTCCCCTGGAGG - Intronic
942219987 2:173759612-173759634 CATTTCCAAATGTCCCCTAGGGG - Intergenic
942238703 2:173938902-173938924 CATTGCCAGATGTCCCCTGGAGG - Intronic
942414690 2:175746423-175746445 CACTGTCAAATGTCCCCTGGGGG - Intergenic
942721678 2:178959994-178960016 CATTGCCAAATGTCCCCTGGGGG - Intronic
942757626 2:179360987-179361009 CATTGCCAAATGCACCTTGGAGG + Intergenic
942797774 2:179841687-179841709 CATTACCAAATGTCTCCTGGGGG + Intronic
943553143 2:189366353-189366375 CATTGCCAATTGTCCCCTGAGGG - Intergenic
943576167 2:189633511-189633533 CTTTGCCAAATGTCCCCTAGGGG - Intergenic
943614413 2:190076346-190076368 CATTGCCAAAAGTTTTCTGGGGG + Intronic
944151424 2:196562688-196562710 CATTCACAGAGGTTCCCAGGAGG + Intronic
944195804 2:197051771-197051793 CACTGCCAAATGTCCCCTAGGGG - Intronic
944269655 2:197767625-197767647 CATTGCCAGATGTTCCCTATAGG - Intronic
944310881 2:198232671-198232693 CACTGCCAAATGTTCCCTGGGGG - Intronic
944370773 2:198980971-198980993 CTTTGCCAAATGTCCCCTGGGGG - Intergenic
944390645 2:199215551-199215573 TATTTCCAAAGGTTCCCCGGGGG + Intergenic
944816013 2:203376197-203376219 CATTGCCAAATGTCCCCTTGGGG - Intronic
945053944 2:205851464-205851486 CGTTGCCACATATTCCCAGAAGG + Intergenic
945183010 2:207111080-207111102 CATTGCTAAATGTTCCCTGAGGG + Intronic
945432499 2:209780676-209780698 TGTTGCCAAATGTTCACAGGTGG + Intronic
945439959 2:209866381-209866403 CATTGTCAAATGTTCCCTGATGG - Intronic
945878670 2:215304663-215304685 CATTGCCAAATGTCTCCTGTGGG - Intergenic
946101263 2:217326485-217326507 CATTGCCAAATGTCCCCTGAGGG + Intronic
946102399 2:217337252-217337274 GATTGCCAAATGTCCCCTGATGG - Intronic
946344659 2:219099366-219099388 CCTTGCCAAATGTTCTCTGTGGG + Intronic
946352270 2:219162896-219162918 CATTGCCAAATGTCCCCATGGGG + Intronic
946628886 2:221644954-221644976 CATTGCCAAATGTCCCTCTGTGG + Intergenic
946646689 2:221845050-221845072 CATTGCCAAATATTCCCCAGGGG - Intergenic
947025668 2:225735013-225735035 CATTGCCAGAGGTCCCCTGGGGG - Intergenic
947113795 2:226747818-226747840 CATTGCCAGATGTTCCCTGTGGG - Intronic
947150892 2:227114195-227114217 CATTACCAAATGTCCCCTGGGGG - Intronic
947173380 2:227335548-227335570 CATTGCCAAATGTTCTCTACAGG + Intronic
947185308 2:227449728-227449750 TATTGCTAAATATCCCCAGGGGG + Intergenic
947239611 2:227979595-227979617 CCTTGCCAAATGTCCCCTGGAGG - Intergenic
947314609 2:228842232-228842254 CATTGCCTATTGCTCCTAGGCGG + Intergenic
947831191 2:233142979-233143001 CATTGCCAAATGTCCCCTGGAGG + Intronic
948055570 2:235007395-235007417 CATTGCCAAGTGTCCCTGGGGGG - Intronic
948192941 2:236074001-236074023 CATTTCCAAATGTCCCCAGGGGG - Intronic
948258598 2:236586341-236586363 CATTGACAAATGTCTCCTGGGGG - Intergenic
948413330 2:237781851-237781873 CATTGCCAAATGTCCACTGCGGG + Intronic
948642055 2:239381820-239381842 CACTGACAAATGTCCCCTGGGGG + Intronic
948796305 2:240403939-240403961 CTTTGCCAGATGTTCCCTGGGGG - Intergenic
1169161257 20:3380576-3380598 CATTGCCAAATGTCCCCTGCAGG + Intronic
1169359238 20:4934231-4934253 CATTGCCAGATGTCCCCTGCAGG - Intronic
1169524801 20:6412768-6412790 CATTTCCAAATGTCCCAAGTGGG + Intergenic
1169708571 20:8535586-8535608 CTTTGCCAAATGTCCACTGGGGG - Intronic
1169749819 20:8980593-8980615 CATGGCCAAATGTCCCCTGGAGG - Intergenic
1169989735 20:11488022-11488044 CATTATCAAATGTCCCCTGGGGG + Intergenic
1170116084 20:12861193-12861215 CATTGTCAAGTGATCCCTGGGGG + Intergenic
1170164599 20:13348007-13348029 TATTGCCAAATGTCTCCTGGGGG - Intergenic
1170349946 20:15427868-15427890 CATTGTCAAATGTTCCCAGGGGG - Intronic
1170472606 20:16683288-16683310 CATTGCCAAATGTCAACTGGAGG - Intergenic
1170504698 20:17013046-17013068 CACTGCCAAATGTCCCCTGGTGG - Intergenic
1170555993 20:17515038-17515060 CACTGCCAAATGTCCCCTTGGGG - Intronic
1170585994 20:17734613-17734635 CATTGCCAAATGTCCCTTGGGGG - Intronic
1170849484 20:19991536-19991558 CAGTGCCAAATGTCCCCTGGGGG + Intronic
1170910486 20:20561956-20561978 CATTGCCAAATGTTCCCTGGAGG + Intronic
1171021478 20:21588161-21588183 CATTCCCAAATGTCTCCTGGGGG - Intergenic
1171418547 20:25000510-25000532 CATTGACAAATGTCCCCTGGTGG - Intergenic
1172288785 20:33760010-33760032 AAATGCCAAATGTTCCCTGGAGG + Intronic
1172415724 20:34765613-34765635 CATTACCAAATGTCCCCCAGGGG - Intronic
1172470967 20:35195395-35195417 CATTACCCAGTATTCCCAGGTGG - Intergenic
1172681302 20:36717809-36717831 CATTGCCAGATGTCCCTGGGAGG - Intronic
1173467935 20:43298887-43298909 AAATGCAAAATTTTCCCAGGTGG + Intergenic
1173477702 20:43373573-43373595 CATTGCCAAATGTACGCAGGCGG - Intergenic
1173572294 20:44085286-44085308 GATTGCCCAATGTCCCCTGGAGG + Intergenic
1173591354 20:44227559-44227581 CATTGCCAAATGTCCCCTCAGGG - Intergenic
1173659158 20:44720979-44721001 CAGTGCCAAATTTCCCCAGGGGG + Intronic
1173764255 20:45592788-45592810 CATTGCCAAATGTCCCCTAGTGG + Intergenic
1173820855 20:46019416-46019438 TATTGCCAAACATTCCCTGGTGG + Intergenic
1173862291 20:46291978-46292000 CAATGCCAAATGTTCCCTGGAGG + Intronic
1173865742 20:46311677-46311699 CATTGCCAAATGTCTCCTGAAGG + Intergenic
1173998914 20:47360210-47360232 CATTGCCAAATGCCCCCTGAAGG - Intergenic
1173999115 20:47361368-47361390 CATTGCTAAATGTCCCCTTGCGG - Intergenic
1174036157 20:47669501-47669523 CATTGCCAAGTGTCCCCTGGGGG + Intronic
1174082011 20:47977192-47977214 CATTGCCAAATGTCCTCTGGGGG + Intergenic
1174083761 20:47990045-47990067 CATTAGCAAGTGTTCCCCGGAGG + Intergenic
1174134469 20:48369611-48369633 CATTGCCAAATGTCCTCTGGGGG - Intergenic
1174191554 20:48744223-48744245 CATTGCCCATTGTCCCCTGGGGG + Intronic
1174276384 20:49407608-49407630 CATTGCCAAATGTCCCCTGGGGG - Intronic
1174422607 20:50409492-50409514 CATTGCTGAATGTCCCCTGGAGG + Intergenic
1174425584 20:50429844-50429866 CCTGCCCAAATGATCCCAGGGGG + Intergenic
1174429942 20:50460503-50460525 CATTGCCAAATGTCCCCTGGGGG - Intergenic
1174433025 20:50484574-50484596 CATTGTCAAATGGCCCCTGGGGG + Intergenic
1174433929 20:50491806-50491828 CGTTGTCAAATGTCCCCTGGGGG + Intergenic
1174481353 20:50833544-50833566 TGTTGCCAAATGTCCCCTGGGGG + Intronic
1174563951 20:51451377-51451399 CCTTGCCAAATTTGCCCTGGGGG - Intronic
1174588945 20:51630015-51630037 CATTGCCACATGTCTCCTGGAGG - Intronic
1174603767 20:51745510-51745532 CATTGCCAAATGTCTGCAGGGGG - Intronic
1174605284 20:51757015-51757037 CATTGCCAAGTGTCCTCTGGGGG - Intronic
1174612580 20:51810339-51810361 CATTGCCAAATGTCCCCTGGTGG - Intergenic
1174633606 20:51979755-51979777 CATTGCCAAATGTTTTCTGGAGG - Intergenic
1174640577 20:52040465-52040487 CAGTGCCAACTGTCCCCTGGAGG - Intergenic
1174706199 20:52658728-52658750 CATTGCCAAATGTTTTCTGGAGG - Intergenic
1174725047 20:52852511-52852533 CACTGCCAAATATTCCCTGGGGG - Intergenic
1174733158 20:52937993-52938015 CATTGCCAAATGTCCCCTAGTGG - Intergenic
1174781119 20:53389722-53389744 CATTGCCAAATGTCCCCTGGGGG - Intronic
1174854441 20:54029507-54029529 CATTGCTAAATGTCCCCTGGAGG + Intronic
1174866490 20:54141508-54141530 CATTGTCAGATGTCCCCTGGGGG - Intergenic
1174904246 20:54533276-54533298 CATTGTCAAATGTCCACTGGGGG + Intronic
1174941937 20:54938898-54938920 CATTGCCAAATATTCCCTTGGGG + Intergenic
1174978561 20:55363697-55363719 CAATGCCAAATGTGCCAAGCAGG + Intergenic
1175019127 20:55825865-55825887 CATTGCCAAATGTTGCAAGAGGG - Intergenic
1175062428 20:56255864-56255886 CATTGCCAAATGTTCTCAGGGGG + Intergenic
1175139962 20:56853719-56853741 CATTGGCAAATGTCCCCTGGGGG + Intergenic
1175158424 20:56990089-56990111 CATTGCCAAGTGTCCACTGGGGG + Intergenic
1175182819 20:57160570-57160592 CATTGCCACGTGTCCCCTGGGGG - Intergenic
1175197260 20:57252865-57252887 CATTGCTAACTGTACCCTGGGGG - Intronic
1175413430 20:58786123-58786145 ACTTGCCAAATGTCCCCGGGGGG - Intergenic
1175417229 20:58809937-58809959 CATTGCCAAATGCTCCCCTGGGG + Intergenic
1175454908 20:59105158-59105180 CATTGCCAGATGTGCCCTGGAGG - Intergenic
1175459864 20:59144507-59144529 CATTACCCAATGTCCCCAGAGGG + Intergenic
1175663572 20:60838710-60838732 CATTGCCACATGTTCCCAGGAGG + Intergenic
1175792641 20:61751312-61751334 CACTGCCAAATGTTCCCTGGGGG + Intronic
1177151291 21:17457828-17457850 CATGGCCAAATGTCCTCTGGGGG + Intergenic
1177424331 21:20903099-20903121 CATTGCAAAATGTCCCCTGGAGG - Intergenic
1177817538 21:25993769-25993791 CATTGCTAAATGTGCCCAGGGGG - Intronic
1178083935 21:29094119-29094141 CATTGCCAAATATCCCCTGGGGG - Intronic
1178132176 21:29586038-29586060 CATTTCCAAATGTTCCCTGGGGG + Intronic
1178221142 21:30661512-30661534 CATTGTCAAATGCCCCCGGGGGG - Intergenic
1178288492 21:31346030-31346052 TATTGCCAAATGTTCCCCGGAGG - Intronic
1178301557 21:31457804-31457826 CATTGCTAAATGACCCCTGGAGG - Intronic
1178528151 21:33350292-33350314 TATTGTCAAATGTCCCCTGGTGG + Intronic
1178679202 21:34658208-34658230 CATTGCCAGATGATCCATGGAGG + Intergenic
1178701000 21:34834248-34834270 CATTTCCAACAGCTCCCAGGTGG + Intronic
1178847148 21:36183291-36183313 CATTGCCAAATGTCCCCTGGGGG + Intronic
1178902382 21:36607599-36607621 TGTTGCCAAATGTCCCCTGGAGG - Intergenic
1178955273 21:37016318-37016340 CATTGCCAAATGTCCCCTCGAGG + Intronic
1179071040 21:38071246-38071268 CAGTGCCAAATGTCCCCTGGGGG + Intronic
1179076994 21:38131784-38131806 CACTGCCAGATGTGCCCTGGAGG - Intronic
1179146016 21:38768467-38768489 CATTGTCAAATGTCCCCCGGGGG - Intergenic
1179397600 21:41056011-41056033 CACTGCCAAATGTGCCCTCGGGG + Intergenic
1179448976 21:41454841-41454863 CATTTCCACAAGATCCCAGGAGG - Intronic
1179503809 21:41826342-41826364 GAGTGCTAAATGTTCCTAGGTGG + Intronic
1180456550 22:15515673-15515695 CATTGACACCTGGTCCCAGGTGG + Intergenic
1181349694 22:22245950-22245972 CATTGCCAAATGTCCCCAGGTGG + Intergenic
1181715627 22:24725355-24725377 CATTACCAAGTGTCCCCTGGAGG + Intronic
1181741484 22:24924924-24924946 CATTGCGAAATGTTCCCTGCAGG + Exonic
1181759074 22:25045297-25045319 CACTGCCAAATGTGCCCCAGGGG - Intronic
1181763568 22:25075147-25075169 CATTGCCAAATGTCCCTTGCAGG - Intronic
1181880539 22:25976053-25976075 TATTTCCTAATGTTCCCTGGGGG - Intronic
1181882402 22:25991453-25991475 CATGACCAAATGTCCCCTGGGGG + Intronic
1181914507 22:26268788-26268810 CATTGCCAAATGTCCTCTGGAGG + Intronic
1181924386 22:26346684-26346706 CAATGCCAACTGTTGACAGGAGG + Intronic
1182120181 22:27781440-27781462 CATTGCCAAGTATGCCCTGGGGG + Intronic
1182168220 22:28198314-28198336 CATTGCCAAATGTGCCCCAGAGG + Intronic
1182220625 22:28755908-28755930 CATTGCCAGATGTCCCCATGGGG + Intronic
1182227343 22:28809183-28809205 CATTGCAGAATGTCCCCTGGGGG + Intergenic
1182262095 22:29080731-29080753 TATTGCAAAATGTCCCCTGGGGG - Intronic
1182338145 22:29598892-29598914 CATTGCCAAATGTCCCCTGTAGG + Intergenic
1182417720 22:30232230-30232252 CATCGCAAAATGTCCCCTGGAGG + Intergenic
1182540326 22:31036735-31036757 CACTGCCAAATGCCCCCTGGGGG - Intergenic
1182656482 22:31894536-31894558 TATTGCCAAATGATCCCGGGTGG - Intronic
1182792076 22:32961207-32961229 CATTGCCAAATGTCTCCTGTTGG + Intronic
1182919398 22:34065504-34065526 CATTGCCAAATGTTCCCTGGGGG - Intergenic
1183020513 22:35022692-35022714 TATTGCCAAGTGTTTCCTGGGGG + Intergenic
1183258913 22:36781598-36781620 CATTGCCAAATGTCCCCTGGGGG + Intergenic
1183337408 22:37257933-37257955 TACAGCCATATGTTCCCAGGTGG + Intergenic
1183355116 22:37354586-37354608 CATTGCCAAATGTCCCCTGGGGG + Intergenic
1183355164 22:37354874-37354896 CATTGCCAAATGTCCCCTGGGGG + Intergenic
1183386123 22:37515767-37515789 CATGGCCAGATGTTTCTAGGGGG + Intronic
1183430036 22:37759778-37759800 CACAGCCAAATGTCCCCAAGGGG - Intronic
1183441079 22:37823490-37823512 CATTGCCCACTGTGCCCAGCAGG - Exonic
1183763681 22:39849297-39849319 CATTGCCAAATGTCCCCTGGGGG - Intronic
1183769572 22:39912480-39912502 CATTGCCAAATGTCCCTGGTGGG - Intronic
1184257687 22:43296450-43296472 CACAGCTAAATGTTCCCAGAAGG + Intronic
1184616961 22:45644988-45645010 CATTGCCAAATGTCCCCTGCAGG + Intergenic
1185176342 22:49329245-49329267 CATTGCCAAGTGTCTCCTGGGGG - Intergenic
949629159 3:5903763-5903785 CATTTCCAAATGTCCCCGTGGGG - Intergenic
949753108 3:7376960-7376982 CAATGCCAAACGTCCCCTGGGGG + Intronic
949902403 3:8827780-8827802 AATTGCCAAATGTTCCCTTATGG - Intronic
949932317 3:9088599-9088621 CATTGCCAGGTGTTCCCTGGGGG + Intronic
949952034 3:9237250-9237272 CATAGCCAAATGTCCCCTGGGGG - Intronic
950288824 3:11766976-11766998 CATTGCAAAATGTTACCAGTGGG - Intergenic
950468324 3:13168885-13168907 GATTGTCACATGTTCACAGGAGG - Intergenic
950506183 3:13396111-13396133 CATGGCCAAATGTCCCTGGGGGG - Intronic
950671941 3:14532556-14532578 CATTGCCAAACGTGCCCTAGGGG + Intronic
950752077 3:15137538-15137560 TATTGCCTAATGTCCCCAGGGGG + Intergenic
950760090 3:15214858-15214880 AATTGCCAAATGTCCCCTGGGGG - Intronic
951011722 3:17689740-17689762 CATTGCCAAATGTCCCCTGGGGG - Intronic
951013930 3:17708632-17708654 CATTGCCAAATGTCCCTTGAGGG + Intronic
951437846 3:22685728-22685750 TATTGCCAAATGTCCCTGGGTGG - Intergenic
951629532 3:24704303-24704325 CATTGCCAGATGTCCTCTGGGGG + Intergenic
951802263 3:26608995-26609017 CATTGCTCAGTGTTCCCTGGGGG + Intergenic
952031874 3:29152659-29152681 CATTGCCAAATGTGCCCTGGAGG + Intergenic
952359490 3:32615524-32615546 AATTGCCAAATGTTCCCTAGGGG + Intergenic
952714039 3:36460512-36460534 AATTGCCAAATGTCCCCTGGGGG - Intronic
953144333 3:40260575-40260597 CATTGTCAAATATTCCCTGAGGG - Intergenic
953253609 3:41268026-41268048 CATTGCCAAATGTCTCCTGGGGG - Intronic
953471240 3:43168689-43168711 CATTACCAAAGGTTCCCAGAGGG - Intergenic
953479435 3:43237576-43237598 CATTGCCAAATATTCCCTGAGGG - Intergenic
954703093 3:52462388-52462410 CATTGCCAAATGTCCCACTGGGG + Intronic
954762975 3:52890430-52890452 CATTGCCAACTGCCCCCTGGGGG - Intronic
954789326 3:53119554-53119576 CGTTGCCAAATGTCCCCTGGGGG - Intronic
955047689 3:55375431-55375453 CATTGTCAAATGTTCTCTGGAGG - Intergenic
955254052 3:57311558-57311580 CATTGCCAAATGTAACCTGGGGG - Intronic
955376858 3:58404496-58404518 CATTGCTAAATGTCTCCTGGGGG + Intronic
955525123 3:59812048-59812070 CATTGCCAAGTATCCCCTGGGGG - Intronic
955531073 3:59873702-59873724 CAATGCCAAATGTGCCCCGGGGG + Intronic
955533125 3:59895030-59895052 CATTGTCAAATGTCCCCTGTGGG - Intronic
955577619 3:60383401-60383423 CATTGCCAAATATTTCTGGGTGG - Intronic
955703409 3:61704541-61704563 TATTGCCAGATGTCCCCTGGAGG + Intronic
955761779 3:62292652-62292674 CATGGCCAAATGTCCCCTGGGGG - Intronic
955801178 3:62688274-62688296 CATTGGCAAATGTCCCCTAGGGG + Intronic
955986958 3:64583640-64583662 CATTGCCAAATGTCCACCGCAGG + Intronic
956004638 3:64765275-64765297 CATTGTCAAAGGGTCACAGGAGG + Intergenic
956102064 3:65778882-65778904 CATCCCCAAATGTCCCCTGGGGG - Intronic
956137942 3:66117402-66117424 AGTTGCCAAATGTTCCATGGAGG + Intergenic
956174822 3:66462979-66463001 CATTGCCAAGTGTCCTCTGGGGG - Intronic
956191292 3:66610783-66610805 CATGACCAAATGTTCCTTGGGGG + Intergenic
956195504 3:66650082-66650104 CATTGCCCAATGTCCCCTGTGGG - Intergenic
956202305 3:66719150-66719172 CATTGCCAAATGTCCCCTGAAGG - Intergenic
956217397 3:66862734-66862756 CATTGCAAAATGTCCCCTGGAGG + Intergenic
956297994 3:67735745-67735767 CATCCCCAAATGTCCCCAGGAGG - Intergenic
956383936 3:68696919-68696941 TATTGCCAAATGTTCCCTGGAGG - Intergenic
956407600 3:68944311-68944333 CATTGCCAAACATTCACTGGGGG + Intergenic
956469559 3:69552198-69552220 TATTGTCAAATGTTCCCTGGGGG - Intergenic
956560633 3:70570361-70570383 CATTGCCAAATGTGCTGTGGAGG + Intergenic
956620464 3:71216838-71216860 CATTGCCAAATGTCCCCTGGTGG - Intronic
956624164 3:71250229-71250251 CGTTGCCAAATGTCCCCTGCTGG + Intronic
956660647 3:71593713-71593735 CCTTGCCAAATGTGCCCTAGGGG + Intergenic
956661075 3:71598508-71598530 CATTACCAAATGTCCCCTGGGGG - Intergenic
956683315 3:71802136-71802158 CATTGCCAAATGTCCCCTGGGGG - Intergenic
956700656 3:71955982-71956004 CATTGCCAAATGTCCCCTGTGGG - Intergenic
956732278 3:72207473-72207495 TATTGCCAAATGTTCCCTGCTGG + Intergenic
956745716 3:72309564-72309586 CATTGCTAAATGTTCCCCTAAGG + Intergenic
956914172 3:73853190-73853212 CATTGCCTAATGCCCCCTGGGGG + Intergenic
957000439 3:74877571-74877593 GGTCGCCAAATGTTACCAGGGGG + Intergenic
957817474 3:85320095-85320117 CATTGCCAAATGTTCCCCTGGGG - Intronic
957818849 3:85343048-85343070 CATTGCCAAAAGTTTCCTGAAGG - Intronic
958462062 3:94411103-94411125 CATTGCCAAATATGCCCTGTGGG - Intergenic
958674868 3:97255353-97255375 CTTTGCTGAATGTTCCCTGGAGG - Intronic
958795888 3:98705823-98705845 CATTGCTAAATATCCCCTGGAGG - Intergenic
958898257 3:99854667-99854689 CATTGCCAAATGTCTCCTGGGGG + Intronic
959005931 3:101019845-101019867 CATTACCAAATGTCCCTTGGGGG - Intergenic
959136021 3:102422287-102422309 CATTGCCAAATGTCTCCTAGGGG - Intronic
959245822 3:103866262-103866284 CATTGTCATATGTTCCCTGGGGG + Intergenic
959399705 3:105884861-105884883 CATTGCCAAACGTTCCCTTGGGG - Intergenic
959500135 3:107097657-107097679 CATTGCCAAATGTCCACTGGTGG - Intergenic
959527516 3:107394199-107394221 CATTGCCAAATGTACCAGGGTGG + Intergenic
960030947 3:113054356-113054378 CATTGTCAAATGTACCCTGGGGG + Intergenic
960321139 3:116238073-116238095 TATTGCCAAATATTTCCTGGGGG + Intronic
960466197 3:117998653-117998675 CATTGCCAAATGCCCCCTGGAGG + Intergenic
961284881 3:125793537-125793559 TATTGCCTAATGTCCCCAGGGGG + Intergenic
961733585 3:128985860-128985882 CATTGCCAGATGTTCCCTGGGGG - Intronic
961903816 3:130241713-130241735 CATTGTCAAATGTCCCCTGGAGG - Intergenic
961965843 3:130901862-130901884 CATTGCCAAATGTCCCCCGGGGG - Intronic
961975731 3:131023039-131023061 CATTGCCAGATGTCCTCTGGGGG + Intronic
962015794 3:131439193-131439215 CACTGCCATATGCTCCCAGATGG + Intergenic
962243169 3:133768415-133768437 CATTGCCAAATGTCCCGTGGGGG - Intronic
962250126 3:133830956-133830978 CATTGCCAAATGTCCCCTGTGGG + Intronic
962515039 3:136142349-136142371 CATGCCCAAATGTCCCCTGGCGG + Intronic
962565366 3:136652930-136652952 CATTGCCAAATGTCCCACGGAGG + Intronic
962634923 3:137320759-137320781 CGTTGCCAAATGTCCCTGGGAGG + Intergenic
962896836 3:139723186-139723208 CAATGCCAAATTTCCCCAGCTGG + Intergenic
962964658 3:140342323-140342345 GATTGCCAAATGTCCCTTGGGGG + Intronic
963099110 3:141581588-141581610 TATTGCCAAATGTTCCTTGAGGG + Intronic
963102539 3:141620855-141620877 TACTGCCAAATGTCCCCTGGGGG - Intergenic
963151660 3:142051547-142051569 TATTGCCAAATGTCCCCTAGGGG + Intronic
963215182 3:142738556-142738578 CATTGCCAAATGTCCCCTTATGG - Intronic
963716549 3:148810626-148810648 CATTGCCAAATGTTCCCTCAGGG - Intronic
963720105 3:148852296-148852318 CATTGCCAAATGTCATCTGGGGG - Intronic
963733941 3:148998325-148998347 CATTGCCAAATGTCCTTTGGGGG - Intronic
963842120 3:150118462-150118484 CATTGCAAAATGTCCCCTGAGGG + Intergenic
963897406 3:150702239-150702261 CATTGCCATGTGTTCCTGGGGGG - Intronic
964840166 3:160984846-160984868 CATTGCCAAATGTCCCATGGGGG - Intronic
965249007 3:166317887-166317909 TATTGCCAAATGTTCTCTGGAGG - Intergenic
965563550 3:170085833-170085855 CATTGCCAAATCTCCCCCGGTGG + Intergenic
965620320 3:170636674-170636696 CATTGGCAAATGTCCCCTGGAGG - Intronic
965698629 3:171436917-171436939 CCTCGCCAAATGATCCAAGGGGG - Intronic
965711665 3:171561813-171561835 CATTGCCAAATGTCCCCTCAGGG + Intergenic
965882390 3:173401265-173401287 CATTGCCAAATGTCTCTAAGAGG + Intronic
966043640 3:175523174-175523196 AATCGCCAAATGTTTCCAGGCGG - Intronic
966323764 3:178731436-178731458 CACTGCCAAATGTCCCCCGTGGG + Intronic
966326913 3:178766983-178767005 CATTTCCAAATGTCCCCTGGAGG - Intronic
966490709 3:180525547-180525569 TATTGTCAAATGCTCCCTGGAGG - Intergenic
967232771 3:187356329-187356351 CATTGCCAAATGTTCTGTGGAGG - Intergenic
967828271 3:193896348-193896370 CACCGCCAAATAGTCCCAGGAGG + Intergenic
968135944 3:196219691-196219713 CACTGCCAAATATTCCCTGGGGG - Intronic
968562624 4:1292653-1292675 CATTGCTAGATGTGCCCTGGGGG + Intronic
968685420 4:1954805-1954827 CATTGCCAAATGTCCCCTGGAGG - Intronic
969004491 4:4008370-4008392 CATGGCCACATGTTCTCTGGGGG - Intergenic
969012874 4:4081298-4081320 TATTGCCTAATGTCCCCTGGGGG - Intergenic
969182321 4:5451777-5451799 CATTGCCACATATCCCCTGGGGG + Intronic
969249722 4:5959054-5959076 CATGGCCAGATTTTCCCTGGGGG + Exonic
969501857 4:7558386-7558408 CATTGCCAAGTGTCCCTTGGGGG + Intronic
969740984 4:9026469-9026491 TATTGCCTAATGTCCCCAGGGGG + Intergenic
969748377 4:9091778-9091800 CATGGCCACATGTTCTCTGGGGG + Intergenic
969800322 4:9559338-9559360 TATTGCCTAATGTCCCCAGGGGG + Intergenic
969809408 4:9636337-9636359 CATGGCCACATGTTCTCTGGGGG + Intergenic
969838779 4:9865160-9865182 CATTGCCAAATGTTCCCTGGGGG - Intronic
969863409 4:10055483-10055505 CATTGCCAAATGTCCCCTGGGGG + Intergenic
969966312 4:11000430-11000452 TATTGCCAAATGTCTCCTGGGGG + Intergenic
969995775 4:11311308-11311330 CATTGCCAAATGTCCCCTGGTGG + Intergenic
970228260 4:13882061-13882083 CTTCGACAAATGTTCCCTGGGGG + Intergenic
970375465 4:15452568-15452590 CATTGCCAAATGTCTCCTGGGGG + Intergenic
970550125 4:17171803-17171825 TATTGCCAAATGTCCCCTGCAGG - Intergenic
970569163 4:17362732-17362754 CATTGCCAGATGTTCCCTAGGGG + Intergenic
970604618 4:17667529-17667551 CACTGCCCACTGTGCCCAGGAGG + Intronic
970613944 4:17750633-17750655 CATTGCCAAATGTCCCCAGGGGG + Intronic
970627042 4:17897727-17897749 CAATGTTAAAGGTTCCCAGGTGG - Intronic
970716997 4:18937947-18937969 CATTGCCCAATATTCCCAGTGGG + Intergenic
971219803 4:24694423-24694445 CATTGCCAAATGTCCCTTGGAGG + Intergenic
971354068 4:25878753-25878775 CATTGCCAAATGTCTCCTGGGGG - Intronic
971431932 4:26577471-26577493 CATTTCCAATTTTCCCCAGGAGG - Intronic
971502482 4:27332027-27332049 CATTGTGAAATGTCCCCAAGGGG - Intergenic
971529484 4:27667195-27667217 CATTGCCAAATGTCCTGAAGGGG + Intergenic
971934366 4:33128524-33128546 CATTGCCAAATCTTCCCCAGAGG - Intergenic
972689394 4:41381986-41382008 CATTGCCAGATGCCCCCAAGGGG + Intronic
972999834 4:44932865-44932887 CATTGCCAAATGTGCCCTAGAGG - Intergenic
973189270 4:47368379-47368401 CATTGCCAAATGTCACCAGGTGG - Intronic
973221804 4:47734876-47734898 CATTGCCAAATGTTCCCAAATGG + Intronic
973250854 4:48058464-48058486 CATTGCCAAATGTCCCCTGGGGG - Intergenic
973257086 4:48124328-48124350 CATTGCCAAATGTTCCCTGGGGG + Intronic
973888174 4:55344054-55344076 CATTTACAAATACTCCCAGGAGG + Intergenic
973988773 4:56382197-56382219 CATTGCCAATTGTCCCCCAGAGG - Intronic
974061414 4:57039410-57039432 CATTGCCAAATGTCCCCTAAGGG - Intronic
974086308 4:57264686-57264708 GCTTGTCAAATGTTCCCTGGGGG + Intergenic
974394272 4:61314691-61314713 CATTGCCAAATGTCTCCAGAAGG - Intronic
974415592 4:61602387-61602409 CATTGCCAAGTATTCCATGGAGG - Intronic
974529828 4:63093416-63093438 CATTGCTAAATGTTACTTGGGGG - Intergenic
974578982 4:63769968-63769990 CATTGCCAAATATCTCCTGGGGG + Intergenic
974582956 4:63830552-63830574 CATCGTCAAATGTTCCCTGAAGG + Intergenic
975087105 4:70355372-70355394 CATTACCAAATGTCCCCTGGGGG - Intergenic
975235374 4:71989493-71989515 CATTGCTAAATGTCCCCTGGGGG - Intergenic
975283250 4:72587623-72587645 CATTGCCAAATGTCCCCTGAAGG + Intergenic
975575784 4:75861124-75861146 CATTGCCAAATGTCCCCTGGAGG - Intronic
975776464 4:77792883-77792905 CATTGCCAAATGTCTCCTGAGGG - Intronic
976080773 4:81352404-81352426 AATTGCCAAATGTTATAAGGAGG + Intergenic
976125207 4:81827121-81827143 CATTGCTAAATGTTCTCTAGCGG + Intronic
976173730 4:82331597-82331619 CCTTGCCAAATGTCTCCTGGAGG + Intergenic
976305107 4:83552321-83552343 CATTGCCAGTTGTCCCCTGGGGG + Intronic
976466130 4:85370563-85370585 CATTGCCAAATGTCCCCTGGGGG - Intergenic
976657645 4:87506109-87506131 CATTGCCAAATGTTCCATGGGGG + Intronic
976705108 4:88011921-88011943 GATTGCCAAATGTCCCCTGAGGG - Intronic
976950163 4:90818746-90818768 CATTGCCAAATGTCCCATGGGGG + Intronic
977007640 4:91591038-91591060 CATTGCCAAATGTCCCCAAGGGG - Intronic
977336706 4:95708795-95708817 CATTGCCAGATGTCCCCTGGGGG - Intergenic
977346734 4:95825232-95825254 CATTACCAAATGTCCCTTGGGGG + Intergenic
977674835 4:99735530-99735552 CATTGTCAAATATTCCCTGAAGG + Intergenic
977842524 4:101725853-101725875 CATTGTCAAATGTTCCCTTGGGG - Intronic
977909780 4:102520140-102520162 CGTTGCCAAATGACCCCTGGGGG + Intronic
977911384 4:102541190-102541212 CATTGACAAATGTCCCCTGGGGG + Intronic
977922237 4:102658366-102658388 CACTGCCAAATGTTCCATGGGGG + Intronic
978594420 4:110361347-110361369 CATTGCCAAATGTCCCCTGATGG - Intergenic
979438132 4:120719224-120719246 CATTGCCAAACGTCCCCTGGGGG + Intronic
979511100 4:121554631-121554653 AATTGCCAAATGTTTCCATCTGG + Intergenic
979843843 4:125482936-125482958 TATTGCCAAATGTCCCATGGGGG - Intronic
980719791 4:136680334-136680356 TATTGCTAAATGGCCCCAGGAGG + Intergenic
980873664 4:138638736-138638758 CTTTTCCAAATGCTCCCTGGGGG + Intergenic
981016164 4:139976837-139976859 CATTGCCAGATGTGCCCTGGAGG - Intronic
981319583 4:143375904-143375926 CATTGCCAAGTGTGCCCTGGAGG + Intronic
981342319 4:143635571-143635593 CATTGCCAAATGTCCCCTGGGGG + Intronic
981350420 4:143722986-143723008 CATTGCCCAATGTTCCCTGGGGG + Intergenic
981435069 4:144710654-144710676 CATAGCCAAATGTCCCCTGGGGG - Intronic
981516562 4:145616476-145616498 CATTGCCAAATGTTCCCTGGGGG + Intergenic
981536038 4:145800808-145800830 CACTGCCAAATGTCCCCTTGGGG + Intronic
981570543 4:146146375-146146397 CATTGCCCAATGTCCCTAAGAGG + Intergenic
981579259 4:146235991-146236013 CATTGACAAAGGTCCCCTGGAGG + Intergenic
981652870 4:147078952-147078974 CATTGCCAAACGTTCCCTGGAGG + Intergenic
981799145 4:148635805-148635827 TATTGCCAAATGTTCCCTGGAGG + Intergenic
982011898 4:151113624-151113646 CATTGCCAAATGTCCCCTGGAGG + Intronic
982119779 4:152131781-152131803 CATTGCCAAATATTCGCTGGGGG - Intergenic
982228345 4:153186002-153186024 CATTGCCAAATTTTCCCTTGGGG - Intronic
982793944 4:159623571-159623593 CATTGCCAAATATTCGATGGGGG + Intergenic
983069449 4:163251885-163251907 AATTGCCAAATGCTCCCATGGGG - Intergenic
983111433 4:163755014-163755036 CATTGCCGAATGTCCCCTTGGGG - Intronic
984169074 4:176339554-176339576 AATTGCCAAATTTGGCCAGGCGG + Intergenic
984386978 4:179073236-179073258 CATCTCCAAATGTTGCCAGGTGG + Intergenic
984960766 4:185095272-185095294 CATTGCCAAATGTGCCCTGTGGG + Intergenic
985010952 4:185581451-185581473 TATTGCCAAATGTCCCCTGGAGG + Intergenic
985236768 4:187883849-187883871 TATTGCCAAATGTCCCCCGAAGG + Intergenic
986038707 5:3965280-3965302 CATTGCCAAGTGTTCCCACAGGG + Intergenic
986180584 5:5389617-5389639 CATTGCCAAATGTCCCCTGGAGG - Intergenic
986430918 5:7680159-7680181 CATTGACAACTGTTTCCTGGGGG - Intronic
986585361 5:9311261-9311283 TATTGCCAAATATTCCCAGAAGG + Intronic
986601818 5:9480179-9480201 CATTGCCAGATGTCCCCTGAGGG + Intronic
986617271 5:9631109-9631131 CATTGCCAAATGTTCAAGAGTGG + Intronic
986736500 5:10672101-10672123 CAGTGTCAAATGTTCCCTGGGGG + Intergenic
987006501 5:13715809-13715831 AATTGCCAAATGTCCTCTGGGGG - Intronic
987026599 5:13933089-13933111 CATTGCCAAATGGCCCCTGTGGG + Intronic
987110225 5:14679053-14679075 CATTCCCAAATGGCCCCAAGAGG - Intronic
987337088 5:16906453-16906475 TATTGCCAAATGTCCCCTGGAGG + Intronic
987707545 5:21474918-21474940 CATTGCCAAATGTCCCCTGGAGG + Intergenic
987909899 5:24127952-24127974 CATAGCCAAATGTCCCCTGAGGG - Intronic
987994248 5:25254212-25254234 CATTGCCAAATGTCCCTGAGGGG - Intergenic
988456565 5:31392264-31392286 TATTGCCAAATATCCCCTGGGGG - Intergenic
988468577 5:31514770-31514792 TATTGCCAAATGTCCCCTGGGGG - Intronic
988508495 5:31845138-31845160 CATTGCCAAATGTCCCTGCGGGG + Intronic
988522993 5:31963023-31963045 CATTACCAAGTGTTCTCAGCAGG - Intronic
988557797 5:32253076-32253098 TATTGCCAAATGTCCCCTCGTGG - Intronic
988639399 5:33024778-33024800 CATTGCCAAATGTTCTCTGGAGG - Intergenic
988658536 5:33238858-33238880 CATTGCCAAATGTCCCTGGGAGG + Intergenic
988675883 5:33432701-33432723 CATTGCCAAATGTCCTATGGGGG - Intergenic
988812814 5:34802112-34802134 CATTGCCAAATGTCCCCTGGGGG - Intronic
989115583 5:37949240-37949262 CATTGTCAAATGTCCCCTGGGGG + Intergenic
989240782 5:39201385-39201407 CATTGCCAAATGTCCCCTGGGGG + Intronic
989321260 5:40136919-40136941 CATTGCCAAATGTCCTCTGCAGG - Intergenic
989480937 5:41929326-41929348 CATTGCCAAATGTTCCAGGGGGG + Intronic
989544594 5:42658652-42658674 CATTGCCAAATGTCCCCTGGGGG - Intronic
989591491 5:43117307-43117329 CAGTGCCAAATGCTGCCAAGTGG - Intronic
989962534 5:50433609-50433631 CATTGCCAAATGTCTCCTGCGGG - Intronic
990012148 5:51012540-51012562 CATTGCCAAATGTCCCAGGGTGG + Intergenic
990026821 5:51202329-51202351 CATTATCAATTGTTCCCTGGGGG - Intergenic
990078231 5:51878496-51878518 CATTGTCAAATGTCTCCTGGGGG - Intergenic
990113259 5:52354541-52354563 CATTGCCAAATACTCCCTGTAGG + Intergenic
990450388 5:55927710-55927732 CATTGCCGGGTGGTCCCAGGTGG + Intergenic
990615121 5:57500014-57500036 TATTGCCAAATATTTCCCGGGGG + Intergenic
990976745 5:61567522-61567544 CATTGCCAAATGTCTCCTGGGGG + Intergenic
991618481 5:68520639-68520661 CATCCCCAAATCCTCCCAGGAGG + Intergenic
992515682 5:77490394-77490416 CATTGCCAAATGTCTCCTGCGGG + Intronic
992647062 5:78820824-78820846 AATTGCCAAATCTCCCCTGGGGG + Intronic
993005117 5:82421334-82421356 CATTGCTTCATGTTCCTAGGAGG + Intergenic
993542784 5:89173031-89173053 CATTGCCATATGTCCCCTGTGGG - Intergenic
993620984 5:90167562-90167584 CCTTGGCAAATGTCCCCTGGGGG - Intergenic
993784959 5:92119042-92119064 CATTACCAAATATTACCAGGAGG + Intergenic
994038664 5:95232096-95232118 CATTGCCAAATGATCCCTGGAGG + Intronic
994269888 5:97764280-97764302 CATTGCCAAATATCCCCCAGGGG - Intergenic
994296890 5:98100947-98100969 CATTGTCAAATGTCTCCTGGGGG + Intergenic
994407360 5:99361570-99361592 CATTGCCAAATGTTCTCCTCGGG - Intergenic
995132211 5:108642531-108642553 CATGGACAAATGTCCCCAGGAGG + Intergenic
995139530 5:108719819-108719841 CATTGCCAAATGTCCCCTGGAGG - Intergenic
995139955 5:108724842-108724864 CGTTGCCAAATGTCTCCTGGAGG - Intergenic
995262100 5:110116159-110116181 TGCTGCCAAATGTTCCCTGGGGG - Intergenic
995530160 5:113084508-113084530 CATTGCCAAATGTCCCCTGGAGG + Intronic
995634868 5:114176240-114176262 CTTTGCCAAATGTCCCCTGGAGG + Intergenic
995744377 5:115388460-115388482 CATTGACAAATGTTCTCACAGGG + Intergenic
995837979 5:116416886-116416908 CATTGCCAATTGTCCCATGGGGG - Intergenic
996304305 5:122029076-122029098 TGTTGCCAAATGTTCCCTGGGGG - Intronic
996354630 5:122582012-122582034 CATTGCCAAATATCCCCTCGGGG - Intergenic
996526040 5:124480776-124480798 CATTGCCAAATGTCCTCTTGGGG + Intergenic
996947976 5:129093547-129093569 CATTGCCAAATATTCCCCAGAGG - Intergenic
997224628 5:132199743-132199765 AATAGCCAACTGTTCCCAGATGG - Intronic
997259254 5:132453532-132453554 CATTGCCAAATGTCCCCTGGGGG + Intronic
997270450 5:132532314-132532336 AATTGCCAAATGTTCCCTTGGGG + Intergenic
997561695 5:134851443-134851465 CATTGCCAAATGTTCCCTGGGGG - Intronic
997689556 5:135817128-135817150 CTTTGCCAGATGTTCCCTGGGGG - Intergenic
997727027 5:136130271-136130293 CATTGCCAAATGTTTCCTGGGGG + Intergenic
997816026 5:137018060-137018082 CATTACCAAATGTCCCCTCGGGG - Intronic
997852390 5:137344504-137344526 CATTGGCAAATGTCCCCTAGGGG - Intronic
997994417 5:138574466-138574488 CATTGCCAGATGTCCCCTGGGGG + Intronic
998212460 5:140210430-140210452 CATTACCAAATGTCCCCTAGGGG + Intronic
998300373 5:141012984-141013006 CGTTGCCAAATGTCCCCAGGAGG - Intergenic
998394990 5:141812501-141812523 CATTGCCAAATGTCCCTTGGGGG + Intergenic
998828065 5:146125856-146125878 CATTGCCAAATGTCCGCTGGGGG - Intronic
998855462 5:146390691-146390713 CATTGCCCCATGTCCCCTGGGGG + Intergenic
998876518 5:146605653-146605675 TATTGCCAAATGTTCCCCAGGGG + Intronic
999057593 5:148596655-148596677 CATTGCCAAATGTCCCCTGGTGG + Intronic
999122389 5:149219254-149219276 TATTGCCACATGTCCCTAGGGGG + Intronic
999255495 5:150207884-150207906 CATTGCCAAATGTCCCCCAAGGG - Intronic
999423836 5:151468673-151468695 CATTGCCAAACCTTCCTGGGGGG + Intronic
999482533 5:151961870-151961892 CATTGTCAAATGTCTCCTGGGGG - Intergenic
999522988 5:152371702-152371724 CATTGCCAAATATCCCCCTGGGG + Intergenic
999736272 5:154515668-154515690 CATTGCCAAATGTTCTCTGAGGG - Intergenic
999821444 5:155232985-155233007 CATTGCCAAATGTCTCTGGGAGG - Intergenic
999880177 5:155854289-155854311 CTTTGCCAAATGTCCCCCAGGGG + Intergenic
1000155016 5:158541603-158541625 TATTGCCAAATGTTACTGGGGGG + Intergenic
1000161310 5:158600319-158600341 CATTGCCAAATGTCTCCTGAGGG + Intergenic
1000183577 5:158837135-158837157 CATTATCAAATGTCCCCTGGTGG - Intronic
1000336713 5:160246732-160246754 CATTGCCAAATGTCCCCTGGGGG + Intergenic
1000353869 5:160374478-160374500 CTTTGCCAAATCTTTCCAGAGGG + Intergenic
1000398663 5:160802409-160802431 CATTGCCAAATGTCCTCTGGGGG - Intronic
1000724728 5:164755104-164755126 CATTGCCAAATGTTCCCTAAAGG + Intergenic
1001005838 5:168049097-168049119 CATTGCCAAATGTCCTCTAGGGG - Intronic
1001157078 5:169281878-169281900 CATTGCCAAATGTCCCCTGGGGG - Intronic
1001251668 5:170151706-170151728 CATTGCCAAATGTCCCCTGGAGG - Intergenic
1001606136 5:172961035-172961057 TATTGCCAAATGCTCCCTGGGGG + Intronic
1001925173 5:175630951-175630973 CATTGCCAAAAGTTTCCACCTGG + Intergenic
1002629843 5:180564971-180564993 CATTGCCAAATGTCCTCTGGGGG - Intronic
1002901243 6:1411230-1411252 CATTGCCAAATGTCCCCTGGTGG - Intergenic
1002970252 6:2009490-2009512 CATTGTGAAAAGTTCCCAGCTGG - Intronic
1002992195 6:2248110-2248132 CATTGTCAAATGTCCCCTGGGGG - Intergenic
1003235711 6:4293838-4293860 CATTGCTAAATGACCCCTGGGGG + Intergenic
1003243281 6:4362858-4362880 CATTGCCAAATGTCCCCTGGGGG - Intergenic
1003295126 6:4819724-4819746 CATTGCCAAATGTCCCTTGAGGG - Intronic
1003372543 6:5542628-5542650 CCTTACCAAATGTCCCCTGGTGG + Intronic
1003501622 6:6707969-6707991 CATTGCCAATTGTCCCCTGAGGG + Intergenic
1003552860 6:7114418-7114440 CAGTGCCAAAAGTCCCCTGGGGG - Intronic
1003779263 6:9404894-9404916 CATTGCCAAATGTTCCCTGGAGG - Intergenic
1003974501 6:11329705-11329727 CATTGCTAAATGTCCCCTAGGGG - Intronic
1004017606 6:11746535-11746557 CATTGCCAAATGTCCCCTGCAGG + Intronic
1004162036 6:13222699-13222721 CATTGCCAAATGTCCTCTGGGGG - Intronic
1004187512 6:13433545-13433567 CATTGCCAAATATTCCCTGGAGG + Intronic
1004355169 6:14924204-14924226 CATTGCCAAACATCCCCTGGTGG - Intergenic
1004367213 6:15022375-15022397 CATTGCCAAATGTCCCCTGGGGG - Intergenic
1004429154 6:15528420-15528442 CATTGCCAAATGTCCCCTTGGGG + Intronic
1004501654 6:16215457-16215479 CATTACTAAATGTTCCCTGGAGG + Intergenic
1004553618 6:16673917-16673939 CATTGCCAAATGTCCTGAGAGGG + Intronic
1004867624 6:19869637-19869659 TATTACCAAATGTCCCTAGGGGG - Intergenic
1005173049 6:23010277-23010299 CATTGCAAAATATGCCCAAGAGG - Intergenic
1005282840 6:24292895-24292917 CACTGCCAAATGTCCCCAAGGGG + Intronic
1005393105 6:25353911-25353933 CACTGCCAAATGTCCCCTGCAGG - Intronic
1006219924 6:32480236-32480258 CATTGCCACATGTTCCCCAAGGG + Intergenic
1006229209 6:32567983-32568005 CATTGCCACATGTTCCCCAAGGG + Intronic
1006381268 6:33698780-33698802 CATTGCCACATGTCCCCTGGGGG + Intronic
1006432341 6:34005288-34005310 CTTTGCCAAATGTCTCCTGGGGG - Intergenic
1006597120 6:35201647-35201669 CATTGACACATGTCCCCTGGGGG - Intergenic
1006619938 6:35356723-35356745 CATTGCCAAATGTCTCCTAGGGG + Intronic
1006655897 6:35592741-35592763 CATTGCCAAAGGTTTCCTGGAGG - Intronic
1006705046 6:36012649-36012671 CATCGCCACATGTTCCCTGGGGG + Intronic
1006751209 6:36378812-36378834 CACGGCCAAATGTCCCCGGGGGG + Intronic
1007048818 6:38804846-38804868 CCTTGCCAAATATTCCCTTGGGG - Intronic
1007237069 6:40398258-40398280 CATTGCCCAATGTCCTCTGGGGG + Intronic
1007302927 6:40882023-40882045 CATTGTCAAATGTCCCCCTGGGG - Intergenic
1007422028 6:41725288-41725310 CATTGGCAAATGTCCCCTAGGGG + Intronic
1007512769 6:42387018-42387040 CATTGCCAAATGTCCCCTGAAGG + Intronic
1007766262 6:44162092-44162114 CGTTGCCACCTGTTCCCTGGGGG + Intronic
1008008196 6:46434767-46434789 CATTGCCAGATGTCCCCTGGGGG - Intronic
1008045062 6:46843256-46843278 CATTGACAAATGTCCCCCTGAGG + Intergenic
1008145238 6:47883813-47883835 CATTGTCAAATGTTGCCTGTGGG + Intronic
1008418228 6:51267835-51267857 CATTGCTAAATGTCCCTTGGGGG + Intergenic
1008454858 6:51697629-51697651 CATTGCCAAATGTCCCCGAAGGG + Intronic
1008487861 6:52054789-52054811 CATTGCCAACTCTTCCCTGGGGG + Intronic
1008618260 6:53246838-53246860 CCTTGTCAAATGTCCCCAGGGGG + Intergenic
1008700288 6:54091130-54091152 CATTGCCAAAGGTACCCTGGGGG + Intronic
1009020673 6:57945600-57945622 CATTGCCAAATGTCCCCTGGAGG - Intergenic
1009815175 6:68723839-68723861 CATTGACAAATGTCCGCTGGGGG - Intronic
1009892275 6:69700547-69700569 TATTGCCAAATGTTTCCGGGGGG + Intronic
1009918021 6:70020643-70020665 CATTGCCAAATGTTCCTAGAGGG - Intronic
1010179854 6:73073504-73073526 CATTGCTAAATGTCCCAGGGAGG + Intronic
1010392763 6:75356034-75356056 CATTGCCAAATGTTCCCTGGAGG + Intronic
1010766755 6:79783878-79783900 CATTGCGAAGTGTCCCCTGGAGG - Intergenic
1011058076 6:83228497-83228519 CATTGCCAAATGTTTCCTGCAGG + Intronic
1011497302 6:87949388-87949410 CATTGCTAAATGTCCCCCTGGGG - Intergenic
1011574511 6:88780919-88780941 CATTGCCAAATATCCCTTGGAGG - Intronic
1011585475 6:88920020-88920042 CATTACAAAATGTCCCCTGGGGG - Intronic
1011800048 6:91002703-91002725 CTTTGCCAAATGTTCCCTGGGGG - Intergenic
1012468876 6:99547707-99547729 CATTGCCAAATGTCCCCTCGGGG + Intronic
1012591563 6:100987723-100987745 CATTGCCAAATGTGCCCCAGAGG + Intergenic
1012841157 6:104330713-104330735 CATTGCCAAATGTCCCTTGGAGG - Intergenic
1012919825 6:105209870-105209892 TATTTCCAAATGTCCCCTGGAGG - Intergenic
1012967955 6:105695825-105695847 CATTGTCAAAAGTTTCCTGGAGG + Intergenic
1013143010 6:107358857-107358879 TATTGGCAAATGTCCCCAGGAGG + Intronic
1013158533 6:107519194-107519216 TATTACCAAATGTCCCCTGGGGG - Intronic
1013158749 6:107521096-107521118 TATTACCAAATGTCCCCTGGGGG + Intronic
1013237489 6:108210169-108210191 CATTGCCAAACGTCCCCTGGGGG + Intergenic
1013343247 6:109236066-109236088 CATGGCCAAATGTCCTCTGGAGG + Intergenic
1013642326 6:112097948-112097970 CATTGTCAAATGTCCCCTGGTGG - Intronic
1013956122 6:115842993-115843015 CATTGCCAAATTTCCCCTAGTGG + Intergenic
1013986390 6:116199094-116199116 AATTGCCAAATGTCCCTGGGGGG + Intronic
1014102073 6:117522344-117522366 CATTGCCAAATGTCTCATGGTGG + Intronic
1014740736 6:125145221-125145243 CATTGCCACATGTCTCCTGGAGG - Intronic
1014908617 6:127061715-127061737 CATTGCCAAATGTTTCCCGTGGG + Intergenic
1015794571 6:136998099-136998121 CATTGCCACATATCCCCTGGGGG + Intergenic
1016323062 6:142869033-142869055 CATTGCCAAATATCCCCTAGGGG - Intronic
1016656522 6:146524609-146524631 CATTGCCAAATATCTCCTGGGGG - Intergenic
1016767349 6:147809871-147809893 CAGTGCCAAATGTCCCCTGGGGG + Intergenic
1016791109 6:148067830-148067852 TATTGCCAAATGTCCCCTGGGGG + Intergenic
1017088984 6:150741974-150741996 CATTGCCAAGTGCCCCCTGGAGG + Intronic
1017529877 6:155278946-155278968 CATTGCCGAATGTCCCCTGCAGG - Intronic
1017605312 6:156127081-156127103 CATTGCTAAGTGTCCCCTGGGGG - Intergenic
1018033176 6:159860048-159860070 CATTGCCAAATGTCCCTAGGTGG - Intergenic
1018083858 6:160284320-160284342 CATTGCCAAATGTCCCCTGAGGG - Intergenic
1018123780 6:160662142-160662164 CATTGCCATATGAGCCCTGGAGG - Intronic
1018135692 6:160776709-160776731 CATTGCCATATGAGCCCTGGAGG + Intergenic
1018192792 6:161325330-161325352 CATTACCAAATGTCCCCTGGGGG - Intergenic
1018259487 6:161955297-161955319 CATTGCCAAAGGTCCCCATTGGG + Intronic
1018392462 6:163350912-163350934 CATTGCCACATGTCTCCTGGGGG - Intergenic
1018427024 6:163692342-163692364 CATCGCCAAATGTCCCCTAGGGG - Intergenic
1018787957 6:167122775-167122797 CGTTCCCAAATCTTCCCAGTCGG + Exonic
1019117931 6:169780309-169780331 CATTGCCAGATATCCCCTGGGGG + Intronic
1019120001 6:169794680-169794702 CATTGCCATCTTTTCCCAGGCGG - Intergenic
1019480318 7:1263730-1263752 CCAGGCCACATGTTCCCAGGCGG - Intergenic
1020021511 7:4872214-4872236 CATGGCCAGATGTTCCCTGGAGG - Intronic
1020324627 7:6964869-6964891 CATGGCCACATGTTCTCTGGGGG - Intergenic
1020352779 7:7240146-7240168 CCTTGCCAAATGTCCTCTGGGGG - Intronic
1021096948 7:16546462-16546484 TATTGTCAAATGCTCCCTGGGGG + Intronic
1021462866 7:20908980-20909002 CATTGCCAAATGTACCCTGGGGG + Intergenic
1021470063 7:20991769-20991791 CTTTGCCAAATGTCTCCTGGGGG + Intergenic
1021523667 7:21562320-21562342 CATGGCCAAATGTCCCCTGGGGG + Intronic
1021695937 7:23276526-23276548 CATTGCCAAATGTCCTCTAGGGG - Intergenic
1021857255 7:24869504-24869526 CATTGCCAGGTGTTCCCTAGAGG - Intronic
1021952183 7:25785863-25785885 CATTGCCAAATGTTCCCTGGAGG - Intergenic
1022109076 7:27216954-27216976 CACTGCCAAATGTCCCCTGGGGG + Intergenic
1022209538 7:28195075-28195097 CATCTCCAAATGTGCTCAGGGGG + Intergenic
1022238987 7:28490728-28490750 CATTGCCAAATGTCCCCTGTGGG + Intronic
1022271491 7:28812095-28812117 CATTGCCAAATGTCCCCTGGTGG + Intronic
1022343354 7:29488701-29488723 CATTGACAAATGTCCCCCAGGGG - Intronic
1022578686 7:31525435-31525457 CATTGCCAAAGGTCCCCTTGGGG + Intronic
1022661902 7:32375450-32375472 CATTGCCAAATGTCCCCTGGGGG - Intergenic
1022788538 7:33663540-33663562 CATTGCCAAATATGCCCTGGGGG - Intergenic
1023000846 7:35806087-35806109 CATTGCCAAATGTCACGTGGGGG + Intronic
1023054842 7:36283244-36283266 CATTGGGAAAGGCTCCCAGGAGG + Intronic
1023064142 7:36359198-36359220 CATTGCCAAATGTTCCCTGGAGG - Intronic
1023144080 7:37132044-37132066 CATTGCCAAATGCTCTCTAGGGG + Intronic
1023323196 7:39023407-39023429 CATTGCCACATGTTCACTGAGGG - Intronic
1024281214 7:47721364-47721386 CATTGCCAAATGTCCCTTTGTGG + Intronic
1024924557 7:54599364-54599386 CATTGCCAAAAGTCTCCTGGAGG - Intergenic
1025000373 7:55310912-55310934 CATTGCCAAATGTCCCTCGTTGG + Intergenic
1025218420 7:57081312-57081334 CATTGACAAATGTCCCCTGGGGG + Intergenic
1025244857 7:57309208-57309230 CATTGCTAAATGTCCACTGGGGG + Intergenic
1025248219 7:57333980-57334002 CATTGCTGAATGTACCCTGGAGG - Intergenic
1025652928 7:63489149-63489171 CATTGACAAATGTCCCCTGGGGG - Intergenic
1025871239 7:65436157-65436179 CATTGCAAGATGTTCCCTAGGGG - Intergenic
1025983060 7:66423786-66423808 CATTCCCAAATCTTCCAACGTGG + Intergenic
1026348433 7:69494998-69495020 CATTGCCAAATGTCCCCTAAGGG + Intergenic
1026614900 7:71893159-71893181 CATTGCTAAATGTCCCCTGAGGG - Intronic
1026962115 7:74415466-74415488 CATTGCTAAATGTCCCCGAGGGG - Intergenic
1027883657 7:83874700-83874722 CATTGCCAAATGTACCTTGAGGG - Intergenic
1028030408 7:85905045-85905067 CATTGCTAAATGTACCCTGCGGG - Intergenic
1028217054 7:88146591-88146613 CACTGCCAAATGTTCCCTTGTGG + Intronic
1028248917 7:88516320-88516342 AATTGCCAAATGTCCTCTGGAGG + Intergenic
1028512860 7:91644279-91644301 CTTTGCCAAATGTCCCCTGGGGG + Intergenic
1028961203 7:96751372-96751394 CATTGCCAAATGTTCTCTGAGGG + Intergenic
1029071523 7:97902925-97902947 TATTGCCTAATGTCCCCAGGGGG - Intergenic
1031137137 7:117897078-117897100 CATTGCTAAATCTTCCCTGGGGG + Intergenic
1031341272 7:120605106-120605128 CATTGCCAAATGTAGCATGGGGG - Intronic
1031505691 7:122579218-122579240 CATTGCTAAATGTCTCCTGGAGG - Intronic
1031632247 7:124057996-124058018 CGTTGTCAAATGTTCCCTGGGGG - Intergenic
1032118008 7:129133657-129133679 CATTGCCAAATGTCTCTAGGAGG + Intergenic
1032800365 7:135312917-135312939 CATTGTCAAATATCCCCTGGGGG + Intergenic
1032856509 7:135838102-135838124 CATTGCCAAATGTTCCCTGGAGG - Intergenic
1032920709 7:136543346-136543368 CATTGCCAAATGTCCCCCAGAGG + Intergenic
1033049666 7:137992804-137992826 TATTGCCAAATAGTCCCATGAGG + Intronic
1033064621 7:138142532-138142554 CATTGCCAAACGTCCCCTGAGGG - Intergenic
1033639348 7:143246238-143246260 AATTGCCAAGTGTTTCCTGGTGG - Intronic
1033648432 7:143322217-143322239 CATTGCCATATGGACCCTGGAGG + Intronic
1033979365 7:147145285-147145307 TATTGCCAAATATCCCCTGGGGG - Intronic
1034011513 7:147534133-147534155 CATTGCCAAATGTCACCTGGGGG - Intronic
1034282489 7:149863880-149863902 CATTGGCAAATGGCCCCTGGGGG + Intronic
1034513356 7:151553792-151553814 CATTGCCAAATGCCCCCCTGGGG + Intergenic
1035899554 8:3444506-3444528 CATTGCCAAATGTCCCAATGAGG - Intronic
1036410390 8:8494440-8494462 CATTGCCAAGTGTCCTCTGGGGG + Intergenic
1036617760 8:10402214-10402236 CATAGCCAAATGTTTAGAGGTGG - Intronic
1036888083 8:12574954-12574976 TATTCCCTAATGTCCCCAGGGGG - Intergenic
1036920099 8:12844203-12844225 CATTGCCAAATGTTTTCTAGGGG + Intergenic
1037536158 8:19826725-19826747 CATTGCCAAATGTCCCCTGAGGG - Intronic
1037718888 8:21424214-21424236 CATTGCCAAATCTCCCATGGGGG + Intergenic
1037812528 8:22095449-22095471 CATTGCCTCATGTTCCCTGGGGG + Intronic
1038104880 8:24422033-24422055 CATTGTCAAAAGTTCCCTAGGGG + Intergenic
1038507644 8:28099334-28099356 CATTGCCAAATGTCCTGAGGAGG - Intronic
1039249218 8:35643244-35643266 CATTGCCAGATGTTCCCTGGAGG + Intronic
1039355989 8:36816238-36816260 CACAGCCATGTGTTCCCAGGAGG + Intronic
1039586790 8:38713683-38713705 CATTGCCAAATGTTTGGGGGAGG - Intergenic
1040436292 8:47394471-47394493 AGTTGCCAAATGTCCCCTGGGGG - Intronic
1040563981 8:48549582-48549604 CATTGCTAAATGTCTCCTGGGGG + Intergenic
1041534780 8:58914009-58914031 AACTGCCAAATGATGCCAGGTGG - Intronic
1042192171 8:66198093-66198115 CATTGACAAATGTCCCCTGAGGG - Intergenic
1042206678 8:66336580-66336602 CATTGCCAAGTGTCCCTCGGGGG - Intergenic
1042404374 8:68386912-68386934 CATTGCCAAAAGTGCCCTGAAGG + Intronic
1042477418 8:69264549-69264571 CATTACCAAATGTCCCCGGGGGG + Intergenic
1042518445 8:69684236-69684258 CGTTGCCAAAGGTCCCCTGGGGG - Intronic
1042599721 8:70487039-70487061 TATTGCCAAATGTCCCCTGGAGG + Intergenic
1042826427 8:72984765-72984787 TATTGCCAAATGTTCCTTGGGGG - Intergenic
1042852104 8:73226589-73226611 CATGGCTAAGTGTTCCCAGGTGG - Intergenic
1043526338 8:81100560-81100582 CATTGCCAAATGTCCTCTAGGGG + Intronic
1044289241 8:90448172-90448194 TATTGCCACATGTTCCCTGGTGG - Intergenic
1044459241 8:92425864-92425886 CTTTGGAAAATGTTCCCTGGAGG - Intergenic
1044619622 8:94176192-94176214 CATTGCCAAATATCCTCTGGTGG - Intronic
1044681848 8:94786948-94786970 CACTGCCAAATGTCCCCTCGGGG - Intronic
1044895598 8:96888195-96888217 CATTGCCAAATGTCCCTTGGGGG + Intronic
1044902803 8:96966641-96966663 CATTGCCAGATGTCCCCTGGGGG + Intronic
1045052340 8:98338564-98338586 CATTGCCAAATATCCCCTGGGGG + Intergenic
1045272647 8:100674997-100675019 CTTTGCCTAATGTCCCCTGGGGG + Intergenic
1045336477 8:101207965-101207987 CATTGTGAAATGTTCTCAGGGGG + Intergenic
1045571664 8:103373753-103373775 CATAGCCAAGTGTCCCCTGGAGG + Intronic
1045837903 8:106545142-106545164 AATTGCCACATGTACCCTGGGGG + Intronic
1045860874 8:106813925-106813947 TATTGCCAAATGTCCCCTGGGGG - Intergenic
1046238612 8:111461373-111461395 CATTATCAAATATTCCCTGGGGG + Intergenic
1046265656 8:111825885-111825907 CATTGCCAAATGTCTCCTGAAGG - Intergenic
1046375822 8:113378710-113378732 CATTGCCAAATTTCCCATGGTGG - Intronic
1046470499 8:114667522-114667544 TGTTGTCAAATGTTCCCAGTAGG - Intergenic
1046601530 8:116322607-116322629 CATTGTCAAATATTCCTGGGGGG + Intergenic
1046658315 8:116921604-116921626 CATCGTCAAATGTCCCCTGGGGG + Intergenic
1047179671 8:122575101-122575123 CATTGCCAAATATCTCCTGGAGG + Intergenic
1047184003 8:122615519-122615541 CACTGCCAAATGTCCCCTGGTGG + Intergenic
1047372147 8:124265036-124265058 CATTGCCAAATGTTCCCTGGGGG + Intergenic
1047509906 8:125508042-125508064 CAGAGCCAGGTGTTCCCAGGAGG + Intergenic
1047583699 8:126245051-126245073 CATTGCCAAATGTCCCCTGGCGG + Intergenic
1047590688 8:126323798-126323820 CATTGCCAAATATCCCCCGAGGG + Intergenic
1047622271 8:126620185-126620207 GATTGCCAGATGTTCCCTGGAGG + Intergenic
1047797601 8:128273751-128273773 CATTGCCTAATGTCTCCAGGGGG + Intergenic
1048152725 8:131909829-131909851 TATTGCCAAATGTTCTCTGGGGG + Intronic
1048165865 8:132060980-132061002 CATTGCCAAGTGTCCCCTGGGGG + Intronic
1049096752 8:140552910-140552932 CACTGCCAGATGTCCCCTGGGGG + Intronic
1049956891 9:701642-701664 CATTGCCAAATGTCCCTTCGCGG + Intronic
1050686665 9:8178195-8178217 TATTGCCAAATGTTCCCCGGAGG - Intergenic
1050690783 9:8224161-8224183 CAATGCCAAATGTTTCCTGGGGG + Intergenic
1050778467 9:9299303-9299325 CATTGCCAAATGTCCTCTGGGGG - Intronic
1051098639 9:13495740-13495762 CATTGCCAAATGTTTTCTAGGGG - Intergenic
1051112855 9:13659508-13659530 TATTGCCAAATGTCCCTTGGGGG - Intergenic
1051186433 9:14465912-14465934 CAGTGCCAAATGTCCCCTAGGGG + Intergenic
1051333393 9:16045520-16045542 CATTGCCTAGTACTCCCAGGGGG + Intronic
1051492038 9:17677034-17677056 CATCGCCAAATGGTCCCATGAGG - Intronic
1051617073 9:19016528-19016550 CATTGCCACATGTTTCCTTGGGG - Intronic
1051764841 9:20512414-20512436 CACTTCCAAAGGTTCCCAGGTGG - Intronic
1051786882 9:20754661-20754683 CATTGCCAAATATCCCCTGGAGG - Intronic
1052006110 9:23350799-23350821 CATTGCCAAATGTTCTAGGTGGG + Intergenic
1052230303 9:26142702-26142724 CATTGCCAAATGTCCTATGGGGG - Intergenic
1052303888 9:26983414-26983436 AATTGCCAAATGTTCCCTGGGGG - Intronic
1052343756 9:27387946-27387968 CATTGCCAAATGTTGCCTGTGGG - Intronic
1052407542 9:28081228-28081250 CATTGCCAAATGTCCCCAGGGGG + Intronic
1052422332 9:28259406-28259428 AATTGCCAAATCTCTCCAGGAGG - Intronic
1052564550 9:30131520-30131542 AATTGCCAGTTGTTCACAGGAGG - Intergenic
1053519869 9:38766684-38766706 CATTGCCAAATGCTCTCCGGGGG + Intergenic
1053521912 9:38789377-38789399 CATTGCTGAATGTCCCGAGGCGG + Intergenic
1053537036 9:38936351-38936373 CATTGCCAAATGTCCCCTGAGGG + Intergenic
1053902905 9:42812808-42812830 CATTGACAAATGTCCCCTGAGGG - Intergenic
1054194080 9:62013365-62013387 CATTGCTGAATGTCCCGAGGCGG + Intergenic
1054629100 9:67427579-67427601 CATTGCCAAATGTCCCCTGAGGG - Intergenic
1054644327 9:67575326-67575348 CATTGCTGAATGTCCCGAGGCGG - Intergenic
1054743259 9:68829445-68829467 TATTGCCAAATCTTCCTGGGGGG - Intronic
1054882958 9:70164095-70164117 CATTGCCAAATGTCCACTGGGGG - Intronic
1054920234 9:70536231-70536253 CATTGCAATATCCTCCCAGGAGG - Exonic
1054926010 9:70589397-70589419 CATTGTCAAAACTTCCCTGGGGG + Intronic
1054928195 9:70609499-70609521 CATTGCTAAATGTTCCCTTGTGG - Intronic
1054953845 9:70885361-70885383 CATTGCCAAATGTCCCTTGAGGG + Intronic
1055000983 9:71448146-71448168 TATTGCCAGATCTTCCCAGGAGG + Intergenic
1055221435 9:73937103-73937125 CATTGCCAAATGTACCCTTGAGG + Intergenic
1055317844 9:75052104-75052126 CATTGCCAACTGTCCCCTGGAGG - Intergenic
1055628026 9:78194576-78194598 CGTTGACAAATGTCCCCTGGGGG + Intergenic
1055696134 9:78886646-78886668 CATTGCCAAATGTCCCCCAGGGG - Intergenic
1055725585 9:79224719-79224741 CATTGCAAGATGTCCCCAGAGGG - Intergenic
1055792133 9:79934319-79934341 CATTGCTAAATGTCCCCTGAGGG + Intergenic
1055807029 9:80107303-80107325 CATTGCCAAATGTCCTCTGAGGG - Intergenic
1055909823 9:81336195-81336217 CATTACCAAATGTCCCCTGGGGG - Intergenic
1056545183 9:87607008-87607030 CATTGCCACATGTACCCTGGGGG + Intronic
1056724042 9:89096704-89096726 CTTTGCCAAATGTCCGCTGGGGG - Intronic
1057149802 9:92786210-92786232 CATTGCCAAATGTTCTCAGGGGG + Intergenic
1057563812 9:96150578-96150600 CATTGCCTAATGTCACCTGGGGG + Intergenic
1058237036 9:102503030-102503052 CATTGTCAAATGTTCTCCAGGGG - Intergenic
1058606621 9:106730088-106730110 CATTGTCAAATGTCCCCTGGGGG - Intergenic
1058609027 9:106755099-106755121 CATCACCAAATGTTCCCAGAGGG + Intergenic
1058820612 9:108725872-108725894 CATTGCCAAATGTCCCCTGGAGG - Intergenic
1058849612 9:108998153-108998175 CATTGCCAAATGTCCCGTGAGGG - Intronic
1058872266 9:109212781-109212803 CATTGCCAAATGTTCTCAGAAGG - Intronic
1059194466 9:112357837-112357859 AATTGCCAAATGTCCTCTGGAGG - Intergenic
1059241092 9:112806207-112806229 CATTGCCAAATGTTCCCTGGGGG + Intronic
1059280830 9:113132278-113132300 CATTGCCAAGTGTTCCCTGGGGG - Intergenic
1059422188 9:114199198-114199220 CACTGCCAACTGTTCCCTGGGGG - Intronic
1059440488 9:114304115-114304137 TATTGCCAAATATCCCCTGGGGG + Intronic
1059525082 9:114984001-114984023 CATTGCCAAATGTTTTCTTGGGG + Intergenic
1059550543 9:115224854-115224876 CATTGCCAAATGCTCCTTGATGG - Intronic
1059605352 9:115828822-115828844 TATTGCCAAATGTATCCTGGGGG + Intergenic
1059848176 9:118304570-118304592 CAATGCCAAATGTTCCTCAGGGG + Intergenic
1059917859 9:119123782-119123804 CATTGCCATATGTTCTCTTGGGG + Intergenic
1060062574 9:120474344-120474366 CATGGCCAAATGTCCCCTGGCGG - Intronic
1060443173 9:123660873-123660895 CATTGCCAAATATCCCCTGGGGG - Intronic
1060637936 9:125214244-125214266 TATGGCCAAATGTCCCCCGGGGG - Intronic
1060651806 9:125333990-125334012 CATTGCCAAATGCTCTCTTGGGG + Intronic
1060728013 9:126018642-126018664 CATTACCAAGTGTCCCCTGGGGG + Intergenic
1060806576 9:126581413-126581435 CATTGCCAGATGTGCCTTGGGGG - Intergenic
1061026402 9:128052527-128052549 CATTGCCTAATGTCCCCTGGCGG - Intergenic
1061373750 9:130212311-130212333 CATTGCCAAATATCCCCTCGGGG - Intronic
1061718486 9:132536772-132536794 AATGGCCAACTGCTCCCAGGTGG - Intronic
1062086620 9:134652495-134652517 CATTGCCACATGTCCCCAAATGG - Intronic
1062222118 9:135422190-135422212 CATTGCCACCTGTGCCCTGGGGG + Intergenic
1185587478 X:1250414-1250436 CATTGCCAAGTTTCCCCTGGGGG + Intergenic
1185913577 X:4009266-4009288 TATTGCCAAATGTCCCCCAGTGG + Intergenic
1185925055 X:4136681-4136703 CATTGCCAAGTGTCCCCTGCAGG - Intergenic
1185966334 X:4608056-4608078 AATTGCCAAATGTCCCATGGAGG - Intergenic
1186186617 X:7026631-7026653 TATTACCAAATGTTCACAGGTGG - Intergenic
1186238774 X:7544069-7544091 CATAACCAAATGTCCCCTGGGGG - Intergenic
1186260643 X:7775361-7775383 TGTTGCCAAATGTCCCCTGGAGG - Intergenic
1186273437 X:7915258-7915280 CATTGCTAAATGTCCCTAGCGGG - Intronic
1186283037 X:8014623-8014645 CATTGCCTAATGTACCCTGGGGG + Intergenic
1186351949 X:8749089-8749111 CATTGCCAAAGGGACCCCGGTGG + Intergenic
1186368246 X:8918763-8918785 GATTGCCAAATGTCCCCTGCAGG - Intergenic
1186380496 X:9053748-9053770 CATTGCCAAATGTCTTCTGGGGG + Intronic
1186390331 X:9152310-9152332 CTTTGCCAAATGTCTCCAGAGGG - Intronic
1186413006 X:9360312-9360334 TATTGCCAAATGTTCCCAGAGGG + Intergenic
1186414254 X:9369760-9369782 CATTGCTGAATGTTCCCTGGGGG - Intergenic
1186416027 X:9383759-9383781 CATTGCCTTATGTCCCCTGGGGG - Intergenic
1186429256 X:9490347-9490369 CATTGTCAAATGTTCCCCAAGGG - Intronic
1186438696 X:9566284-9566306 CATTGCCCAATGTTTCCTGGGGG + Intronic
1186445877 X:9628352-9628374 CATTGTCCAATGTCCCCTGGGGG + Intronic
1186466677 X:9788889-9788911 CATTGCCAAATGTCCTCTGGGGG + Intronic
1186485870 X:9933925-9933947 CATTGCCTAATGTCCCCTGGGGG - Intronic
1186495487 X:10009699-10009721 CATTGCCAAATGTCCCCTGGGGG + Intergenic
1186509324 X:10118598-10118620 CATTGCCAAGTGTTCCCCAGGGG - Intronic
1186514965 X:10160137-10160159 CATTGCCAAATGTCCCCTGAGGG + Intronic
1186515525 X:10163924-10163946 CATGGCCAAATGTCCCCTGGGGG + Intronic
1186522377 X:10217488-10217510 CATTGCCAAATGTCCCCTGAGGG + Intronic
1186534355 X:10330953-10330975 CATTGCCAATTGTCCCCGCGGGG + Intergenic
1186539221 X:10383136-10383158 CATTGCCAAACGTTTCCTGTTGG - Intergenic
1186545618 X:10446116-10446138 CATTGCCAAATGTCTCCTGGGGG + Exonic
1186584236 X:10854866-10854888 CATTGCCACGTGTCCCCTGGGGG + Intergenic
1186623051 X:11261766-11261788 CATTGCTAAATGCTCACTGGGGG - Intronic
1186628517 X:11322301-11322323 CATTGGCAAATGTGTCCTGGGGG + Intronic
1186635653 X:11401573-11401595 CATTGCCAAATGTCCCTTGGTGG + Intronic
1186649519 X:11543368-11543390 CATTGCCGAATGTCCCCTGTTGG - Intronic
1186666019 X:11718337-11718359 CATTGCCAACTGATCCCCAGGGG + Intergenic
1186722091 X:12315825-12315847 CATTGCCAAATATTCCCTGAGGG - Intronic
1186723049 X:12326511-12326533 TATTGCCAAATGTACACAGGGGG + Intronic
1186734540 X:12447365-12447387 TATTGCCAAGTGTCCCCAGAAGG + Intronic
1186817948 X:13256443-13256465 CATTGCCAAATGTCCCCTGGGGG - Intergenic
1186829495 X:13376539-13376561 TATTGCCAGATGTCCCCTGGAGG + Intergenic
1186830387 X:13384304-13384326 CATTGCCAAATGTCCCCTGGGGG + Intergenic
1186844732 X:13519289-13519311 CATTGCCAAATGTCCTCTGTGGG - Intergenic
1186873156 X:13792173-13792195 TATTGCCAAATGTCCCCTGAGGG - Intronic
1186900109 X:14045387-14045409 CATTGACAAATGTCTCCTGGTGG - Intergenic
1186936288 X:14453258-14453280 CATTGCTAAATGTCCCAAAGAGG - Intergenic
1186958798 X:14712337-14712359 CATTGCCAAATATCCCCTAGGGG + Intronic
1186976851 X:14917011-14917033 CATTGACAAATGTCCCCTGGGGG - Intronic
1187054070 X:15725027-15725049 CATTGCCAAATGTTCTCTGGGGG - Intronic
1187109507 X:16282353-16282375 CATTGCCAAATGTCCCTTCGGGG - Intergenic
1187241062 X:17513706-17513728 CATTGTCAAATGTCCCCTTGTGG - Intronic
1187242703 X:17528116-17528138 CATTGCCACATGTCCCCTGGGGG - Intronic
1187285875 X:17903161-17903183 CATTGCCAAATGTTCTGTGGGGG + Intergenic
1187344076 X:18447073-18447095 CACTGCCAAATGTCTCCTGGAGG - Intronic
1187361477 X:18631911-18631933 CATTGCCAAATGTACCCTTGGGG - Intronic
1187408343 X:19024567-19024589 CATGGCCAAATATCCCCTGGAGG - Intronic
1187470444 X:19564953-19564975 CATTGCCAAATGTCCCCTTGGGG + Intronic
1187560534 X:20398778-20398800 CATTGTCTAATGTCCCCTGGGGG + Intergenic
1187661520 X:21551607-21551629 AATTACCAAATGTCCCCTGGGGG - Intronic
1187753242 X:22490799-22490821 CATTGCTAAATGTCCCCTAGGGG - Intergenic
1187933853 X:24317161-24317183 CATTGTCGAATGTTCCCTGGGGG + Intergenic
1187950820 X:24468416-24468438 CATTGCCAAATGTCCCCTGGGGG + Intronic
1188195768 X:27231101-27231123 CATTGCCAAATGTTCCATGGGGG - Intergenic
1188396920 X:29696218-29696240 CATTGCCAAATATCCCCTGTAGG + Intronic
1189026164 X:37396953-37396975 CATTGCCAAATGCCCCCTCGGGG + Intronic
1189096933 X:38150415-38150437 CATGGCCAAATTTCCCCTGGGGG - Intronic
1189104648 X:38222732-38222754 CATTGCCAAATGTCCCCCAGGGG + Intronic
1189447642 X:41095493-41095515 CATTGCCAGTTGTGCCCTGGGGG + Intronic
1189630215 X:42944387-42944409 CACTGCCAAATGTTCCCTGAGGG + Intergenic
1189795554 X:44642637-44642659 CATTGCCAAATGTTCCCTGAGGG - Intergenic
1189908663 X:45787534-45787556 CATTGCCAAATGCCCTCAGAGGG + Intergenic
1189984212 X:46539633-46539655 CATTGCCAAATATCCCCTAGGGG - Intronic
1190031244 X:46975034-46975056 TATTGCCAAATGTCCCCTGGGGG + Intronic
1190116510 X:47629203-47629225 CATTGCCAAATGTCCCCTGGGGG - Intronic
1190392827 X:49949164-49949186 CATTGCTAAATGTCCCCAGGGGG - Intronic
1190443717 X:50501951-50501973 CATTGCCAAATGTCTCCTGTGGG + Intergenic
1190754778 X:53391982-53392004 CATTGTCATATGTCCCCTGGGGG + Intronic
1192149918 X:68705827-68705849 CATTGCCAAATGTCCCCTGGGGG + Intronic
1192218845 X:69183034-69183056 CATTGTCAAATGTCTCCTGGGGG + Intergenic
1192264224 X:69527940-69527962 CATTGTCAAATGTTCCCCTGGGG - Intronic
1193081991 X:77415300-77415322 CATTGCCAAATGTTCCCTGGGGG - Intergenic
1193115513 X:77771793-77771815 AATTGCCAGATGTTCCCTGTGGG - Intronic
1193586876 X:83333450-83333472 CATTGCCAAATGTCACCTAGAGG + Intergenic
1193812385 X:86067146-86067168 CAGTGCCAAATGTCCACTGGGGG - Intergenic
1194441208 X:93936923-93936945 CCTTGAAAAATCTTCCCAGGAGG - Intergenic
1194902525 X:99530675-99530697 TATTGCCAAATGTCCTCAAGAGG + Intergenic
1195507720 X:105677773-105677795 CATTACCAAATGTACCCTAGGGG + Intronic
1195765979 X:108297529-108297551 CATGGCCAAATGTTCCCTGGGGG + Intronic
1195781852 X:108475604-108475626 CATTGCCAACTGTCCTCTGGTGG - Intronic
1195888475 X:109667242-109667264 CATTGCCAGATATCCCCTGGGGG - Intronic
1196089546 X:111725301-111725323 CATTGCCAAATATTCCCTAGAGG + Intronic
1196471690 X:116035898-116035920 CAATGGAAAATGTTCCAAGGTGG - Intergenic
1196703821 X:118699236-118699258 CATTGCTAAATGTTCCCTAGGGG - Intergenic
1196902667 X:120401275-120401297 CACTACCAAATGTTCCCAGGGGG + Intergenic
1197155142 X:123262333-123262355 CATTGCCAAATGTCCTCTGAGGG - Intronic
1197175062 X:123476892-123476914 CATTGCCAAATGTCCCCTGGAGG + Intronic
1197182985 X:123556604-123556626 CATTGCCAAATGTCCCCTGGGGG + Intergenic
1197199596 X:123736436-123736458 CATTGCTAAATGTCTCCTGGAGG + Intergenic
1197524959 X:127549334-127549356 CATTCCCAAGGTTTCCCAGGCGG - Intergenic
1197647807 X:129036844-129036866 CATTGCCAAATGTCCCAAGGGGG - Intergenic
1197815609 X:130494917-130494939 CATTTTCAAATGTCCCCTGGAGG - Intergenic
1197884094 X:131200171-131200193 TATTGCCAAATGTCCCCTGGTGG + Intergenic
1197957804 X:131971649-131971671 CATTTCCAGATGGTGCCAGGAGG - Intergenic
1198007916 X:132517664-132517686 CATTGCCAAATGTCCCTTTGGGG - Intergenic
1198675105 X:139123033-139123055 TATTGCCAAATGTTCCAGGGTGG + Intronic
1198929765 X:141841711-141841733 CATTGACAAATGTTCCAGAGAGG - Intronic
1199542572 X:148973354-148973376 CATTGCCAAATGTTCCCTGTGGG + Intronic
1199583577 X:149386747-149386769 CATTGCCAAATGTCCCCTTGGGG - Intergenic
1199886508 X:152026554-152026576 CATTTCCACAAGCTCCCAGGTGG + Intergenic
1199898887 X:152153533-152153555 CATTTCCACAAGCTCCCAGGTGG - Intergenic
1199923529 X:152436445-152436467 CATTGCCAAATGTCCCTGGGGGG + Intronic
1199938822 X:152604229-152604251 CATTGACAAATGTTCTCTGGAGG - Intergenic
1200251010 X:154553755-154553777 TATTGCCAAATGACCCCTGGGGG + Intronic
1200283609 X:154800057-154800079 CTTTGCCAACTGCTCCCACGTGG + Intronic
1200849372 Y:7866852-7866874 CATAACCAATTGTTCCCAGAAGG - Intergenic
1201414009 Y:13729652-13729674 CATTGCCAAAGGGACCCTGGGGG - Intergenic
1201440690 Y:14005042-14005064 CGTTGCCTAATGTGCCCTGGGGG + Intergenic
1201443881 Y:14037666-14037688 CGTTGCCTAATGTGCCCTGGGGG - Intergenic
1201562090 Y:15328462-15328484 TATTACCAAATGTTCACAGGTGG - Intergenic
1202305674 Y:23467820-23467842 CATTGTCAAATGTGACCAGCTGG + Intergenic
1202565135 Y:26202769-26202791 CATTGTCAAATGTGACCAGCTGG - Intergenic