ID: 929000264

View in Genome Browser
Species Human (GRCh38)
Location 2:37341533-37341555
Sequence GTGAAAAATACTAAGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929000261_929000264 9 Left 929000261 2:37341501-37341523 CCTCTTCTTTTTTTTTTTCTTTA No data
Right 929000264 2:37341533-37341555 GTGAAAAATACTAAGATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929000264 Original CRISPR GTGAAAAATACTAAGATGGC TGG Intergenic
No off target data available for this crispr