ID: 929000607

View in Genome Browser
Species Human (GRCh38)
Location 2:37344389-37344411
Sequence CCCTTTTCTGTTCCCTGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 445}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929000602_929000607 0 Left 929000602 2:37344366-37344388 CCAGGGTCTGGTGAACCCTTCCT 0: 1
1: 0
2: 0
3: 14
4: 203
Right 929000607 2:37344389-37344411 CCCTTTTCTGTTCCCTGTTTTGG 0: 1
1: 0
2: 2
3: 57
4: 445
929000601_929000607 1 Left 929000601 2:37344365-37344387 CCCAGGGTCTGGTGAACCCTTCC 0: 1
1: 0
2: 0
3: 10
4: 179
Right 929000607 2:37344389-37344411 CCCTTTTCTGTTCCCTGTTTTGG 0: 1
1: 0
2: 2
3: 57
4: 445
929000600_929000607 2 Left 929000600 2:37344364-37344386 CCCCAGGGTCTGGTGAACCCTTC 0: 1
1: 0
2: 0
3: 23
4: 401
Right 929000607 2:37344389-37344411 CCCTTTTCTGTTCCCTGTTTTGG 0: 1
1: 0
2: 2
3: 57
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929000607 Original CRISPR CCCTTTTCTGTTCCCTGTTT TGG Intergenic
900358725 1:2277578-2277600 CCTCTTTTTGTTCCCAGTTTCGG + Intronic
901391327 1:8948195-8948217 CCCACCTCTGTTCCCTGTTCGGG - Intronic
902102434 1:14002555-14002577 CCTCTTTTTGTTCCCGGTTTTGG + Intergenic
902108564 1:14058723-14058745 CCCCTTTCTGTTCTTTATTTTGG - Intergenic
902664914 1:17930754-17930776 ACTATTTCTGTTCCCTGTCTCGG + Intergenic
902815145 1:18912136-18912158 CCCCTTTCTGTCCCCTGTATGGG - Intronic
903480947 1:23652798-23652820 CCCATTTTTGTCCTCTGTTTGGG - Intergenic
903638396 1:24837495-24837517 CTCTTTTCTGTTCCCTGGAAAGG - Intronic
904549522 1:31304040-31304062 CCTTTCTCTGTCCCTTGTTTTGG + Intronic
904914624 1:33960940-33960962 CCTTTTCCTGATCCCTGTGTGGG + Intronic
905541467 1:38763646-38763668 CCCTTCAGTGCTCCCTGTTTTGG + Intergenic
905596757 1:39214262-39214284 GACTTTTCTGTCCCCTGGTTGGG + Intronic
905709694 1:40091005-40091027 ACCTTTTCTGTTCTCTGATTTGG - Intronic
905959003 1:42027671-42027693 CCTCTTTTTGTTCCCAGTTTCGG - Intronic
905989306 1:42319788-42319810 CCCTTTCCTGTTCCAGCTTTGGG - Intronic
906054474 1:42904314-42904336 CGCTTCACTGTTACCTGTTTAGG + Intergenic
906800408 1:48732180-48732202 CTCTTCTATGTTCCCTGTCTTGG - Intronic
907007895 1:50933739-50933761 CCTCTCTTTGTTCCCTGTTTTGG - Intronic
907090958 1:51724883-51724905 CCCTTTCCTGTGCCCTTTTAAGG - Intronic
907698526 1:56758983-56759005 ACCATTTCAGTTTCCTGTTTTGG + Intronic
908453909 1:64283313-64283335 CCCTTTTCTGTGTCCTTCTTGGG + Intergenic
908612604 1:65879217-65879239 CTCTTTTCCCTTCCCTGCTTTGG - Intronic
909204497 1:72738252-72738274 CCTCTTTTTGTTCCCAGTTTTGG - Intergenic
909543461 1:76816890-76816912 CCCTTTTCTCTTTTCTGTGTAGG + Intergenic
909687800 1:78370555-78370577 TACTTTTCTGTTTCCTGTATTGG - Intronic
911738642 1:101363612-101363634 CCTCTTTTTGTTCCCAGTTTTGG + Intergenic
914721681 1:150294441-150294463 CCCTTAACAGTTACCTGTTTAGG - Exonic
915711055 1:157898162-157898184 CCTCTTTTTGTTCCCAGTTTTGG - Intronic
916533510 1:165680865-165680887 CCTCTTTCTGTTCCCAGTTTCGG - Intronic
917540548 1:175909083-175909105 CCTGTTTATGATCCCTGTTTTGG + Intergenic
918335454 1:183506809-183506831 CCATTTTATGTGCCCTGATTTGG + Intronic
918498634 1:185168409-185168431 CCTTTTTCTTTTTACTGTTTTGG + Intronic
919334219 1:196211276-196211298 CCCCTTTCTGTTAACTGTTTTGG - Intergenic
919833084 1:201555771-201555793 CCCTTTTCTGGCCTCTCTTTCGG - Intergenic
920122142 1:203666704-203666726 CCATTTTCTTTGCCCTGTTATGG + Intronic
920649627 1:207827053-207827075 CCCTGTCCTGTTTCCTCTTTAGG + Intergenic
923062877 1:230492092-230492114 ACCTTTTCTATTTTCTGTTTGGG + Intergenic
923329762 1:232911874-232911896 CCATTGCCTGTTCACTGTTTTGG - Intergenic
924458637 1:244238585-244238607 CCCTTTTCGGTTCTCTATGTTGG - Intergenic
1063913255 10:10853876-10853898 CCCTTTTAATTTCCTTGTTTAGG - Intergenic
1067226687 10:44381277-44381299 CCCCTTTCTTTTCCCTGAGTAGG - Intronic
1068540634 10:58290914-58290936 CATTTTTCTGTTCCATGCTTGGG - Intergenic
1068542744 10:58313486-58313508 ACCTTCTCTGCTCCCTGTTGTGG - Intergenic
1068676959 10:59778560-59778582 CCTCTTTTTGTTCCCAGTTTCGG - Intergenic
1068973770 10:62986311-62986333 ACCATTTCTGTGCCCTGATTGGG - Intergenic
1068985048 10:63100269-63100291 CCATTTTCTATTTCCTGTTTGGG + Intergenic
1069058961 10:63873461-63873483 CCTCTTTTTGTTCCCAGTTTTGG - Intergenic
1071219905 10:83453637-83453659 GCCAATTCTGTTCGCTGTTTTGG + Intergenic
1073077069 10:100830796-100830818 CACCTCTCTGTTCTCTGTTTAGG + Intergenic
1074007334 10:109440654-109440676 CCCTTTTTTCTTCCTTCTTTTGG + Intergenic
1074443523 10:113499136-113499158 TCCTTTTCTGTTTTCTGTTCTGG + Intergenic
1076335147 10:129701980-129702002 CACCTTTCTGTGCCCTGGTTTGG + Intronic
1076355520 10:129850106-129850128 GCCTTTTTTGTTCCCTGTTCAGG - Intronic
1079296325 11:19237904-19237926 CCCTTTTCTGATCTCTGTTGCGG + Exonic
1079340143 11:19604999-19605021 CCCATTTTTCTTCCCTGTCTTGG + Intronic
1079925875 11:26490323-26490345 CCTCTTTTTGTTCCCAGTTTTGG + Intronic
1079955935 11:26864571-26864593 CCCATCCCTGTTCCCTCTTTGGG + Intergenic
1080006633 11:27414746-27414768 GCCTTTTCTGACCCCTGTTTTGG - Intronic
1081217850 11:40423707-40423729 CCCTTTTGTCTTGCTTGTTTAGG + Intronic
1082766020 11:57168685-57168707 CCTCTTTTTGTTCCCAGTTTTGG - Intergenic
1083433477 11:62627167-62627189 CACTTTGGTGTTCCCTGTTCTGG - Intronic
1083611735 11:64007652-64007674 CCCTCTTCTGTTCCCTCTTCTGG + Intronic
1084409827 11:69000338-69000360 CCCTGTTTTCATCCCTGTTTTGG - Intergenic
1085191806 11:74632701-74632723 TACTATTCTCTTCCCTGTTTGGG + Intronic
1085559860 11:77461674-77461696 CCCTTTTCTGTTTCCTTTTTTGG - Intronic
1086231596 11:84577187-84577209 CCTCTTTTTGTTCCCAGTTTGGG + Intronic
1087747089 11:101960502-101960524 CTTTGTTTTGTTCCCTGTTTGGG + Intronic
1088042453 11:105403873-105403895 CCCTTGTCTGGTCCTAGTTTTGG + Intergenic
1088151456 11:106750216-106750238 TCTTTTTCTTTTGCCTGTTTTGG - Intronic
1089649406 11:119902764-119902786 CCTCTTTCTCTTCCCAGTTTCGG - Intergenic
1090155323 11:124431560-124431582 ACCTTTTCTGTTTCCTTTTGTGG - Intergenic
1090915337 11:131157905-131157927 CCCTTTTCTGGTCCCAGCTCTGG - Intergenic
1091511566 12:1132428-1132450 CCCTTTTCAGTCACCTTTTTCGG + Intronic
1092571697 12:9731764-9731786 CCTTATTCTTTTCCCAGTTTAGG - Intronic
1093004203 12:14034464-14034486 CAATTGTCTGTTGCCTGTTTGGG - Intergenic
1095525269 12:43117731-43117753 CCATTTTTGGCTCCCTGTTTTGG + Intergenic
1095570412 12:43677679-43677701 ACCTTTTCATTTCCATGTTTAGG - Intergenic
1095605353 12:44061053-44061075 CACTTTTCTGTTCCATAATTTGG - Intronic
1095612512 12:44146611-44146633 CCCATTTCTATTCACTGATTGGG + Intronic
1096796406 12:54080702-54080724 CCCTCTTCTGTCCCTTGTCTGGG + Intergenic
1097757450 12:63422585-63422607 CTCTTTTCTGTGCCCTATTCAGG - Intergenic
1098944132 12:76571806-76571828 CTCTTTTCTCCTCCCTTTTTTGG - Intergenic
1099066941 12:77992766-77992788 CCATTTTCTCTTTCCTTTTTGGG - Intronic
1099099136 12:78415243-78415265 CTCTTTTTTTTTCCCTCTTTTGG + Intergenic
1099496076 12:83347983-83348005 CCCTTTGCTTGTTCCTGTTTGGG + Intergenic
1099503535 12:83445406-83445428 CCTCTTTTTGTTCCCAGTTTCGG + Intergenic
1099503841 12:83447544-83447566 CCTCTTTTTGTTCCCAGTTTTGG + Intergenic
1099601783 12:84748888-84748910 CCCTTTTAAGCTCCCTGTTTTGG + Intergenic
1100288960 12:93195418-93195440 ACCTATTCTGTTCCCGATTTAGG - Intergenic
1100789565 12:98115610-98115632 GACATTTCTGTTCACTGTTTTGG - Intergenic
1100908972 12:99336702-99336724 CTCTATTCTGTTCCATGTGTTGG + Intronic
1102211894 12:111133336-111133358 CCTCTTTTTGTTCCCAGTTTTGG - Intronic
1102545262 12:113649773-113649795 CCCTCTCCTGATCCCTCTTTCGG - Intergenic
1102873394 12:116431482-116431504 CCCTTTTATGTTCCTTCTCTAGG + Intergenic
1103538970 12:121652953-121652975 ACCTTGTCTGTTCCCTGTCTGGG + Intronic
1104481175 12:129109773-129109795 CCTCTTTTTGTTCCCCGTTTTGG + Intronic
1104962209 12:132493648-132493670 CCCTTTTCTGTGCCCTGGATGGG + Intronic
1105341822 13:19533759-19533781 CTTTTTTCTGTTCTCTGCTTTGG - Intronic
1108156015 13:47585203-47585225 CCTGTTTTTGTTCCCAGTTTCGG - Intergenic
1108344004 13:49526292-49526314 CTCTTTCCTTTCCCCTGTTTTGG + Intronic
1108419347 13:50233013-50233035 CCTCTTTTTGTTCCCAGTTTCGG + Intronic
1109805688 13:67439296-67439318 CCTTCTTCTATTCCCTGATTTGG - Intergenic
1109862155 13:68214025-68214047 TCCTTTCCTTTTCCCTTTTTTGG + Intergenic
1109901069 13:68770703-68770725 CCTCTTTTTGTTCCCAGTTTTGG + Intergenic
1110650297 13:77935626-77935648 TCCTCATCTGTTACCTGTTTTGG - Intergenic
1110860671 13:80341766-80341788 CCCTTTTCTGTTCCCCTTTGCGG + Intergenic
1111728863 13:92047112-92047134 ACCTTTTCTTTTGTCTGTTTAGG + Intronic
1111845200 13:93498709-93498731 CCTCTTTTTGTTCCCAGTTTCGG + Intronic
1111972308 13:94929661-94929683 CCTTTTTTTGTTCCCAGTTTCGG - Intergenic
1112067500 13:95809479-95809501 CCCTTTTCTGCTGCCTTTTCTGG + Intronic
1112237021 13:97645726-97645748 TCCTTATCTGTTACCTGTCTCGG + Intergenic
1112718890 13:102219228-102219250 ACATTTTCTGTTTCCTGTGTGGG + Intronic
1112844457 13:103621973-103621995 CCCTCATCTTTTCCATGTTTTGG + Intergenic
1113210311 13:107970537-107970559 ACCTTTTTTGTTCCCAGTTTTGG + Intergenic
1113479651 13:110611126-110611148 CCATTTTCTCTTCCTTATTTTGG - Intergenic
1113863256 13:113504659-113504681 CCCTTTTTTGTTCCTTTTTATGG + Intronic
1114149835 14:20025727-20025749 CATTTTTCTTTTCCTTGTTTTGG + Intergenic
1115835944 14:37402842-37402864 CACTTCTCCCTTCCCTGTTTAGG + Intronic
1115917373 14:38331001-38331023 CCTCTTTTTGTTCCCAGTTTCGG - Intergenic
1116021312 14:39464997-39465019 CCCTTTTCTATTCTGTTTTTTGG + Intergenic
1116165721 14:41332189-41332211 CCTATTTTTGTTCCCAGTTTTGG - Intergenic
1116178856 14:41510189-41510211 CTCCTTTCTGTTCCCGGTTTTGG - Intergenic
1117349524 14:54867881-54867903 TCCTTTTCTGTACTCTGTTAAGG - Intronic
1118555561 14:67015973-67015995 TCCTTTTTTGTTTCTTGTTTCGG + Intronic
1118741027 14:68739315-68739337 CTCTTCTCTGGTCCATGTTTAGG + Intergenic
1119482091 14:74964280-74964302 CCCTTTCCTGCTCCCTCTGTGGG - Intergenic
1120103743 14:80471944-80471966 CCCTTTTCTGTTCTTTGCATCGG - Intergenic
1120166536 14:81207458-81207480 CCTCTTTTTGTTCCCAGTTTTGG + Intronic
1120166801 14:81209400-81209422 CCTTTTTTTGTTTCCAGTTTCGG + Intronic
1120571908 14:86129157-86129179 GCCTTTTCTGTGCCTTTTTTAGG + Intergenic
1121920794 14:97879155-97879177 GCCTTTTCTGAGGCCTGTTTTGG + Intergenic
1123046285 14:105517891-105517913 TCTTTTTTTGTTCCCAGTTTGGG + Intergenic
1123189307 14:106553097-106553119 CCTCTTTTTGTTCCCAGTTTTGG - Intergenic
1125394906 15:39236119-39236141 CCCTTTTTTGTTAACTGTATTGG - Intergenic
1127754987 15:62083504-62083526 CCCTTTTCTTTTCCCCTTTATGG - Intergenic
1128083358 15:64869795-64869817 CCCCTTTCTGATTCCTCTTTTGG + Intronic
1128431439 15:67598617-67598639 CCCTTCTCTTTTCCCTGTAGTGG + Intronic
1128488796 15:68125121-68125143 CCTTTTTATTTTCCCTGTTCTGG + Intronic
1129468332 15:75736789-75736811 TCCGTCTCTGTTCCCTGCTTTGG + Intergenic
1129727242 15:77907711-77907733 TCCGTCTCTGTTCCCTGCTTTGG - Intergenic
1129815109 15:78545423-78545445 CCTTTGTCTGTTCCCTCTTCTGG + Intronic
1129945079 15:79532782-79532804 GCCTTTTCTTCTCCTTGTTTCGG - Intergenic
1132635509 16:943852-943874 CCCTTTTTTGTTTCCTGTATAGG + Intronic
1134331816 16:13258587-13258609 CCTCTTTTTGTTCCCAGTTTCGG - Intergenic
1135137750 16:19897443-19897465 CACTTCTCTCTACCCTGTTTGGG - Intergenic
1138018900 16:53458640-53458662 CCTCTTTTTGTTCCCAGTTTTGG - Intronic
1138024594 16:53512561-53512583 CCTCTTTTTGTTCCCAGTTTTGG - Intergenic
1138531717 16:57638008-57638030 TTCTTTTCTGTGCCCTGTCTGGG + Intronic
1138859817 16:60743275-60743297 CCTCTTTTTGTTCCCAGTTTCGG - Intergenic
1138860093 16:60745190-60745212 CCCCTTTTTGTTCCCAGGTTTGG - Intergenic
1138976799 16:62217512-62217534 CCCTTTGCTGACCCCTTTTTCGG - Intergenic
1139091033 16:63647850-63647872 ACTTTTTTTGTTCCCAGTTTTGG - Intergenic
1139343349 16:66286423-66286445 ACATTTTCTGTTACGTGTTTTGG + Intergenic
1140484952 16:75286431-75286453 CCCTTTTTTCTTCCCAGTCTCGG - Intergenic
1140765608 16:78154077-78154099 TCCCTTTGTGTTCCCTGTCTGGG + Intronic
1141402079 16:83757697-83757719 CCCTTTTTTATTCCCAGTGTTGG - Intronic
1142212993 16:88817182-88817204 AGCTTTTCTGTCCCCTGCTTGGG - Intronic
1142840062 17:2621858-2621880 CCTCTTTTTGTTCCCAGTTTCGG - Intronic
1142840446 17:2624419-2624441 CCTTTTCTTGTTCCCAGTTTCGG - Intronic
1143086150 17:4417542-4417564 CCAATCTCTGTTCCCAGTTTTGG + Intergenic
1144572852 17:16410761-16410783 CACTTTACAGTTCCCTGTTTTGG + Intergenic
1145911634 17:28546697-28546719 TCCTTTTCTGTTCTCTGGTGTGG - Exonic
1146690413 17:34871136-34871158 CCCCTTTGTTTTCTCTGTTTTGG + Intergenic
1147358676 17:39917722-39917744 CCCTTTGCTGACCCCTTTTTTGG + Intronic
1148947412 17:51276246-51276268 CCCTTGCCTGTTCACAGTTTGGG + Intronic
1152278399 17:79371413-79371435 CCCTTTCCTGCTCCCTGTGGGGG + Intronic
1152435921 17:80275975-80275997 CTTTTTTCTTTTCCATGTTTTGG + Intronic
1153149407 18:2073733-2073755 CCCTTTTCAATTCCTAGTTTTGG - Intergenic
1153448518 18:5199472-5199494 CCTTATTTTGTTCCCAGTTTCGG + Intergenic
1153863800 18:9243118-9243140 CATTTTTCTGTTACTTGTTTAGG + Intronic
1154284058 18:13035308-13035330 CCTCTTTTTGTTCCCAGTTTCGG - Intronic
1155143190 18:23062055-23062077 CTTTTTTTTGTTCCCAGTTTCGG - Intergenic
1155675804 18:28426814-28426836 CCTTTTTTTCTTCCCAGTTTCGG + Intergenic
1155880428 18:31141104-31141126 CCTCTTTTTGTTCCCAGTTTCGG + Intronic
1156252483 18:35364532-35364554 CCCTTTTCTGCCACCTGCTTGGG + Intergenic
1156437269 18:37146041-37146063 TCCTTTTCTGCTCCTTTTTTTGG + Intronic
1156493128 18:37508122-37508144 CCCATTTCTTTTCCCTGGCTTGG + Intronic
1157326382 18:46671844-46671866 CCCTGTTCTTTTTCCTGGTTGGG - Intronic
1157761551 18:50268932-50268954 CCCTTTTGTGAACCTTGTTTGGG - Intronic
1158116100 18:53997525-53997547 CCTCTTTTTGTTCCCAGTTTCGG - Intergenic
1158576271 18:58641312-58641334 CCCTTTGCTGATTCCTTTTTCGG - Intergenic
1158577009 18:58646427-58646449 CCCTTTGCTGATTCCTTTTTCGG - Intergenic
1161396233 19:4046150-4046172 CCCCTTTCTGTCCCCTTTTTTGG - Exonic
1161802463 19:6424032-6424054 CCCATTTCTGTCCCCTCTCTAGG - Intronic
1162352704 19:10160418-10160440 CTCTTTTGTTTTCCCTGTGTAGG - Exonic
1163966732 19:20753171-20753193 CCCTTTTCCCTTGCCTCTTTGGG + Intronic
1164210962 19:23096965-23096987 CCCTTTTATTTTCCCGGTTCTGG + Intronic
1164838481 19:31374495-31374517 TCCAGTTCAGTTCCCTGTTTGGG + Intergenic
1165666277 19:37631162-37631184 ACCTTTGCTGTCACCTGTTTTGG + Exonic
1165996060 19:39845045-39845067 TCCCTTTCTCTTCCGTGTTTGGG - Intronic
1166210379 19:41302976-41302998 CCACTTTCTGTTCCCAGGTTGGG + Intronic
1166275140 19:41748288-41748310 CCCTTTTCTGATGCCTGTCACGG - Intronic
1166556016 19:43700301-43700323 CTCTTTTGTTCTCCCTGTTTGGG + Intergenic
1166602655 19:44111721-44111743 CTCTTTTCTATTACCTATTTTGG - Intergenic
1167367378 19:49061880-49061902 CCCTTTTCTGGCCCCTGAGTGGG - Exonic
1167828251 19:51995015-51995037 CCCTTTTCTGACTCCTTTTTCGG - Intronic
925121332 2:1420962-1420984 TCCTCCTCTGTTCCCTGTTGAGG - Intronic
925783388 2:7404561-7404583 CAATTTTCTGTTCCTTGTCTAGG + Intergenic
926172839 2:10564016-10564038 GCTTTTTCTTTTCCCTGTTATGG - Intergenic
927288107 2:21378158-21378180 CCTCTTTTTGTTCCCAGTTTTGG - Intergenic
928681432 2:33706969-33706991 TCTTTTTTTGTTCCCAGTTTTGG + Intergenic
929000607 2:37344389-37344411 CCCTTTTCTGTTCCCTGTTTTGG + Intergenic
929037704 2:37710581-37710603 TCCATTTCTGTTCCATGTTTTGG - Intronic
929061004 2:37924933-37924955 CCTTTTTCTGTGCCCTTTCTAGG - Intronic
929183838 2:39072221-39072243 CCCTTGTCTGTTTCCTTTTTTGG + Intronic
929937582 2:46305164-46305186 CCCTTGTCTGTTCCCACTGTTGG + Intronic
930726466 2:54686640-54686662 CCCGTTTCTGATCCCCGTTTAGG + Intergenic
931035375 2:58236023-58236045 TCCTTTTCTGTCCTCTGTGTTGG - Intronic
931144936 2:59507272-59507294 ACCTTTTTTGTTCCCACTTTCGG + Intergenic
931202797 2:60116531-60116553 CCTTTTTTTGTTCCCAGTTTGGG - Intergenic
932296038 2:70624043-70624065 TCCTTATCTGTTACCTGTCTCGG + Intronic
932860004 2:75281169-75281191 CCTTTTCCTCTTCCCTGTGTTGG + Intergenic
933327580 2:80858253-80858275 CTTTTTTCTCTTCCCTGTCTGGG + Intergenic
933397695 2:81753577-81753599 CCTCTTTTTGTTCCCAGTTTTGG - Intergenic
934602602 2:95669406-95669428 TCCTTTTCTGCTTCCTGCTTGGG + Intergenic
934857989 2:97740808-97740830 CCCATTCCTGTCCCCTGTTGGGG + Intergenic
935603417 2:104945979-104946001 CGCTATTCTGATCCCTGTGTTGG + Intergenic
935805535 2:106744066-106744088 CCCTTCTGTGTTCCTTGTTTGGG + Intergenic
936531735 2:113280838-113280860 CCCTTTCCTATCCCCTTTTTGGG + Intergenic
936535977 2:113311597-113311619 TCCTTTTCTGCTTCCTGCTTGGG + Intergenic
936921514 2:117693786-117693808 TACTGTTCTGTTTCCTGTTTTGG + Intergenic
937882001 2:126875384-126875406 CCCTTTTCCCTCCCTTGTTTAGG + Intergenic
937996848 2:127700859-127700881 CTCTATTCTGTTCTCAGTTTCGG - Intergenic
938868973 2:135453945-135453967 CCTCTTTTTGTTCCCAGTTTCGG - Intronic
941227874 2:162870628-162870650 ACCTTTTCTCTTCCCAGTCTCGG - Intergenic
941535825 2:166721846-166721868 CCTCTTTTTGTTCCCAGTTTCGG - Intergenic
942058721 2:172208269-172208291 CCCTCTCCTGTTCCCTAATTGGG + Intergenic
942301535 2:174567621-174567643 CCCTGATCTGTTCTTTGTTTGGG - Intronic
942363720 2:175199733-175199755 CCCTTTGCTGACCCCTTTTTTGG - Intergenic
942608376 2:177715577-177715599 CTCTTTTCTGTTTCCTATATAGG + Intronic
944568902 2:201022540-201022562 AACTTTTCTGTTTCCTGTTCTGG - Intronic
945100668 2:206259788-206259810 TCCTTTCCTGCTGCCTGTTTTGG + Intergenic
945480196 2:210336433-210336455 ACCTTTTTTGTTCCCAGTTTTGG + Intergenic
947410674 2:229835733-229835755 TCCTTTTCTGTTACCCATTTGGG + Intronic
947464281 2:230327109-230327131 CACTTTTCTTTTCCCCATTTGGG + Intergenic
948505337 2:238424066-238424088 CCCATTTCTGGTCCCTGCCTGGG + Intergenic
1168924520 20:1568162-1568184 TCCTTTTCTGTTTCTTCTTTTGG - Intronic
1169299761 20:4431825-4431847 CCCTTCTCTGTTCTCTGGTCTGG + Intergenic
1169382648 20:5121526-5121548 CCCTTTCCTGTTCCCTTTTAAGG - Intronic
1170395720 20:15923194-15923216 CCTTTTTTTGTTCCCAGTTTCGG - Intronic
1172287386 20:33750383-33750405 GACTTTTTTTTTCCCTGTTTGGG + Intronic
1172303304 20:33864664-33864686 CCCTTTTCTGTTTCATGTCGTGG - Intergenic
1172507168 20:35472028-35472050 CTCTGTTCTATTCCCTGTTCAGG + Exonic
1173263764 20:41459740-41459762 CCTTTTTTTGTTCCCAGTTTTGG + Intronic
1173669343 20:44787106-44787128 TACGTTTCTGTTCCCTGTGTTGG - Intronic
1174212124 20:48888062-48888084 CCTCTTTTTGTTCCCAGTTTCGG - Intergenic
1174897220 20:54462468-54462490 CCTTTTTTTGTTCCCAGTTTTGG + Intergenic
1175010268 20:55727683-55727705 TACTTTTCTGTTCCTTGTTGTGG - Intergenic
1177118265 21:17110979-17111001 CCCCTTTTTGTTCTCAGTTTTGG - Intergenic
1177697298 21:24589993-24590015 CCCTCTTCTGTCCCTTGCTTTGG + Intergenic
1178573365 21:33761901-33761923 CCTTTTCCTGGTTCCTGTTTAGG + Exonic
1179235150 21:39539360-39539382 CCTCTTTTTGTTCCCAGTTTGGG - Intergenic
1179244959 21:39625079-39625101 ACTTTTTCAGTTTCCTGTTTTGG + Intronic
1180621088 22:17162512-17162534 CCCATTTCTGGTTCCTGCTTTGG - Intronic
1180664544 22:17499388-17499410 CCCTTTTCCGTGCTCTGTGTAGG + Exonic
1180676826 22:17592251-17592273 CGCTTTACTGTTACCTGTTTAGG - Exonic
1182529786 22:30946449-30946471 CCCATTTCTGTTTCCTTTTCAGG - Exonic
1182990118 22:34759585-34759607 CCCAGTTCTGTGTCCTGTTTTGG + Intergenic
1183595747 22:38809348-38809370 CCCTTTTTTCTCCCCTTTTTGGG + Intergenic
1183655899 22:39184542-39184564 ACCCTTTCTGTTCCCTTTTTTGG - Intergenic
1184277018 22:43414734-43414756 CCCTTTTTTGTTCCCGGTGAGGG - Intronic
949503606 3:4705456-4705478 CCTTTTTCTGTTCCAGGATTTGG + Intronic
950486609 3:13277767-13277789 CTCTTTTCTGATCTCTGATTTGG - Intergenic
950700523 3:14742690-14742712 CCTTTTTTTGTTCCCAGTTTCGG - Intronic
951147036 3:19239888-19239910 CCCTGCTCCGTTCCCTGCTTTGG - Intronic
951301311 3:21000625-21000647 CTCATTTCTGTTCTCTATTTCGG - Intergenic
951949057 3:28178287-28178309 CTATTTTCTGTTGCATGTTTAGG - Intergenic
952200964 3:31126919-31126941 CCCCTTTCTGTTCATTTTTTTGG + Intergenic
952289568 3:32002355-32002377 TTCTTTTCTTTTCCTTGTTTGGG - Intronic
953794575 3:45974711-45974733 CCCTTCTCTCTTCCCTTTTGAGG + Intronic
954602323 3:51879025-51879047 CCCCTCTCTCTTCCCTCTTTAGG - Intergenic
954914697 3:54138930-54138952 CCCTTTTCTTTTTGTTGTTTGGG + Intronic
955385830 3:58479038-58479060 GTCTTTTTTGTTCCCAGTTTCGG + Intergenic
955664515 3:61336154-61336176 CCCTCTTATGTTCATTGTTTGGG - Intergenic
956219427 3:66886017-66886039 CCAGTTTCTGTGCCCTTTTTGGG - Intergenic
956586617 3:70872012-70872034 CCCTTTTCTCTTTCCTTTTCTGG - Intergenic
956596423 3:70972253-70972275 CTTTTTCCTGTTCCCTGTATTGG - Intronic
957003230 3:74910903-74910925 CCTCTTTTTGTTCCCAGTTTCGG + Intergenic
957253971 3:77812703-77812725 CACTTCTCTGTCCCCTGATTTGG - Intergenic
957662470 3:83178416-83178438 CCTTTTTTTGTTCCCATTTTCGG - Intergenic
958012375 3:87896298-87896320 CCCTTTTCTGAAGCCTGGTTAGG - Intergenic
959727249 3:109558327-109558349 CCTTTTTCTGTTCCCAGTTTCGG + Intergenic
960408925 3:117297608-117297630 CCCTTGTCTGTTTTGTGTTTTGG - Intergenic
962170628 3:133098112-133098134 CCTCTTTTTGTTCCCAGTTTTGG - Intronic
962254197 3:133859407-133859429 CCCTTTTCTATTCCTGGGTTGGG + Intronic
962364130 3:134766323-134766345 CCTTTTTCTGTGCCCAGTTCTGG + Intronic
962524283 3:136223376-136223398 CCCTTTGCTGATTCCTTTTTCGG - Intergenic
962769836 3:138602010-138602032 CCTCTTTTTGTTCCCAGTTTTGG + Intergenic
962995345 3:140622010-140622032 CCATTGTCTGTTGCCTCTTTTGG - Intergenic
964426875 3:156562804-156562826 CCTCTTTTTGTTCCCAGTTTCGG + Intergenic
964554123 3:157917231-157917253 TCCATTTCTGTTGCATGTTTGGG - Intergenic
964589064 3:158340644-158340666 CCTCTTTCTGTTCCCAGTGTCGG + Intronic
964761038 3:160135278-160135300 CACTTTTGTGTTCCCAGTGTTGG + Intergenic
965779735 3:172272309-172272331 ACCTTTTCTGTTCCTGGGTTAGG + Intronic
966132767 3:176662651-176662673 TCCTTTTCTTTTTCCTCTTTTGG - Intergenic
966838799 3:184071220-184071242 CCTCTTTTTGTTCCCAGTTTCGG - Intergenic
967417867 3:189239138-189239160 CCTTTTTGTATTCCCAGTTTGGG - Intronic
967418123 3:189241896-189241918 CCTCTTTTTGTTCCCTGTTTGGG + Intronic
967493633 3:190120387-190120409 CCCTTTTCCGCTCCTTGTTGGGG - Exonic
967714874 3:192750991-192751013 CCCTTTTCTCTTAACTTTTTTGG + Intronic
967786747 3:193505324-193505346 CACTTTGCTTTTCCCTCTTTAGG - Intronic
969870937 4:10104372-10104394 CTCTGTTCTCTTCCGTGTTTAGG + Intronic
970808841 4:20067319-20067341 CCCTTTGCTGTTCCCAGGATGGG + Intergenic
971996163 4:33967335-33967357 CCTCTTTTTGTTCCCAGTTTTGG + Intergenic
972869995 4:43286273-43286295 CCATTTTTTTCTCCCTGTTTTGG + Intergenic
972966239 4:44513868-44513890 CTCTTTTTTGTTCTCTTTTTTGG - Intergenic
973100966 4:46270320-46270342 ACCTTTTCTGTTTACTGCTTTGG + Intronic
973619617 4:52713240-52713262 CCCTTTCCTGTGCCCTTTTAAGG + Intergenic
974331404 4:60483531-60483553 CCTTTTTCTTTTCTCTCTTTTGG + Intergenic
974434615 4:61840760-61840782 CCTTTTTCTCTTCCCAGTTCAGG - Intronic
974449186 4:62029213-62029235 CGCTTTTCTGTTGTTTGTTTGGG + Intronic
975220126 4:71804955-71804977 TCCTTCTCCCTTCCCTGTTTAGG + Intergenic
975369712 4:73570634-73570656 CCATTTTCTAGTCCCTGGTTAGG - Intergenic
975919792 4:79371450-79371472 CCTCTTTTTGTTCCCAGTTTCGG - Intergenic
976134463 4:81920941-81920963 CCCTTTTCTGTTTCATCTTGAGG - Intronic
976286559 4:83376409-83376431 CCTCTTTTTGTTCCCAGTTTCGG - Intergenic
976450557 4:85185745-85185767 CCATTTTCAGTTCTCTGTTGAGG + Intergenic
977910819 4:102533877-102533899 CCCTTTAATCTTACCTGTTTAGG - Exonic
977957242 4:103044032-103044054 CCCTTTACTTTTCCCTGTCCAGG + Intronic
978028440 4:103907631-103907653 TCCTTTTCTGTTTTCTGGTTTGG - Intergenic
978328705 4:107587738-107587760 CCCTTTTCTCTCCCTTGTTGGGG - Intergenic
978579375 4:110217272-110217294 CCTTTTTTTGTTCCCAGTTTTGG - Intergenic
978853698 4:113368905-113368927 GCCTTTTCTGTGCCTTCTTTTGG - Intronic
978854067 4:113373068-113373090 CCCTTTTCTCTCAACTGTTTAGG + Exonic
978976500 4:114881432-114881454 CCCTTTATTGTTCTCTATTTAGG - Intronic
978993810 4:115124052-115124074 CCTTTTTTTTTACCCTGTTTAGG + Intergenic
980099737 4:128529683-128529705 CCCTTTTTTCTCCCCTTTTTTGG + Intergenic
980492212 4:133542806-133542828 CCCCTTTCTGTTGCCTGGTTAGG - Intergenic
980940111 4:139265564-139265586 CCCTTTTCTGTTCCCTTACCTGG + Intergenic
981168613 4:141593621-141593643 ACATTTTCTGCTCCCTGGTTAGG - Intergenic
981460888 4:145012756-145012778 CCCTTTTCTATTCTCTGTGTTGG - Intronic
982350041 4:154405347-154405369 TCCTTTTATTTTCCCTGTTTGGG + Intronic
982679274 4:158409403-158409425 CCTTTTTTTGTTCCCAGTTTCGG + Intronic
982728918 4:158934677-158934699 CCTTCTTGTGTTCCCTATTTTGG + Intronic
983028692 4:162771132-162771154 CCCCTTTCTCTTCCATGTGTTGG - Intergenic
983093607 4:163536773-163536795 CCATTTTCTCTGCCCTTTTTGGG + Intronic
983761361 4:171410617-171410639 CCCTTTTGTTCTCCCAGTTTTGG + Intergenic
983949766 4:173626308-173626330 TCATTTTCTGTTCCCTTTCTGGG + Intergenic
985214059 4:187630291-187630313 CCTTGTTCTGTTCCCTATCTTGG - Intergenic
986681294 5:10235179-10235201 CACTTTCCTGCTCTCTGTTTGGG - Intronic
987859642 5:23467949-23467971 CCCTTTACTGACCCCTTTTTCGG - Intergenic
988286920 5:29230966-29230988 CCCTTTTCTGTTCCACATCTGGG - Intergenic
988338297 5:29935370-29935392 CCCATGACTTTTCCCTGTTTTGG - Intergenic
989028636 5:37093738-37093760 CCCTTTTCTGTTTTCTGCATTGG - Intergenic
990126099 5:52519050-52519072 CCTCTTTTTGTTCCCAGTTTCGG + Intergenic
990510955 5:56488567-56488589 CCTGTTGCTGATCCCTGTTTGGG + Intergenic
990704478 5:58513054-58513076 CCTCTTTTTGTTCCCAGTTTGGG + Intergenic
991340447 5:65602640-65602662 CCTCTTTTTGTTCCCAGTTTCGG - Intronic
991517926 5:67460169-67460191 CCTTTTTCTGTTTGATGTTTGGG - Intergenic
991603818 5:68380295-68380317 CCTTTTTTTGTTTCCTGTTTGGG - Intergenic
992214666 5:74514374-74514396 CCCTTTCCTGGCCCCTGATTGGG - Intergenic
993078079 5:83260738-83260760 TCCTTTTCTTTTCCATGTTTAGG + Intronic
993129980 5:83884074-83884096 CCCTTTTCACTTCCATGATTTGG + Intergenic
993187906 5:84643905-84643927 CCCTTTTCTTTATGCTGTTTTGG + Intergenic
994076674 5:95659672-95659694 CCTTTTGCTGTTACCTCTTTCGG - Intronic
994402635 5:99300543-99300565 CACTTTTTTCTTTCCTGTTTTGG - Intergenic
994597106 5:101853553-101853575 CCCTTGTCTGTTCCTGGTCTTGG - Intergenic
995312807 5:110732418-110732440 CCTCTTTTTGTTCCCAGTTTTGG - Intronic
995357694 5:111258393-111258415 TTCTTTTTTGTTCCCAGTTTTGG - Intronic
995969730 5:117953514-117953536 CCTCTTTCTGTTCTCAGTTTCGG + Intergenic
997091972 5:130869013-130869035 CCTCTTTTTGTTCCCAGTTTTGG - Intergenic
997716533 5:136047062-136047084 CCCATTTCTGTTCCATGTGTGGG + Intronic
998144412 5:139718517-139718539 CCTTTTTTTATTCCCAGTTTCGG + Intergenic
998144923 5:139721983-139722005 CCTGTTTTTGTTCCCAGTTTTGG + Intergenic
998379375 5:141713123-141713145 GCCTTCTCTTTTCCCTGATTGGG + Intergenic
998576773 5:143325174-143325196 CCTCTTTTTGTTCCCAGTTTTGG - Intronic
998842112 5:146265584-146265606 CACTTTTCTTTTCACTTTTTAGG - Intronic
999509466 5:152233352-152233374 TCTTTTTCTTTTCCCTTTTTGGG + Intergenic
1000652945 5:163839697-163839719 CTCTATTCTGTTCCTTGATTTGG + Intergenic
1001523241 5:172410344-172410366 CCCTGTTCTGTTGCCTGGTGAGG + Intronic
1001966934 5:175916669-175916691 CTCTTATCTGTTCTATGTTTTGG - Intergenic
1002250008 5:177922537-177922559 CTCTTATCTGTTCTGTGTTTTGG + Intergenic
1003051395 6:2783795-2783817 CCATTTTCTGTTTCCTCTTCGGG + Intronic
1004212745 6:13667964-13667986 TCCTTTTCTGCTACCTGCTTTGG - Intronic
1004830960 6:19476232-19476254 CCTTTTTTTCTTCCCAGTTTTGG - Intergenic
1005471234 6:26164412-26164434 TCCTTTTTTGTTCCCTGTCCTGG - Intronic
1005561571 6:27046080-27046102 ACCTGTTGGGTTCCCTGTTTAGG + Intergenic
1005690172 6:28297222-28297244 CCCTTTTTTCTTCCCTGTCAAGG + Intronic
1005948213 6:30610806-30610828 GCTTTATCTGTTCCCTTTTTAGG - Intronic
1006274761 6:32994289-32994311 CTCTTTTCTGTTTTCTGATTGGG + Intergenic
1006282423 6:33065436-33065458 CCCATTTCTCTGCCCTGTTCAGG + Intronic
1006287463 6:33107513-33107535 CCTATTTCTCTGCCCTGTTTAGG + Intergenic
1006381289 6:33698981-33699003 CTTTTTTCTGTTACCTTTTTTGG - Intronic
1006852260 6:37107329-37107351 CACTTTTCTCCTCCCTGTTTGGG + Intergenic
1008499713 6:52169123-52169145 CCTCTTTTTGTTCCCAGTTTCGG - Intergenic
1010539564 6:77074402-77074424 TCTTTTTTTGTTCCCAGTTTTGG + Intergenic
1010636206 6:78261630-78261652 CCTCTTTTTGTTCCCAGTTTCGG - Intergenic
1011495973 6:87936953-87936975 CCTCTTTTTGTTCCCTGTCTTGG - Intergenic
1012962912 6:105641574-105641596 CATTTTTCTGTTCACTCTTTAGG + Intergenic
1012987506 6:105890670-105890692 CCCTTTCCTCCTCCCTGCTTGGG + Intergenic
1014020985 6:116589656-116589678 CCCCTTTTTGTTCCCAGTTTTGG - Intronic
1014203309 6:118627725-118627747 CCCTTTTATCTTCCCTTTTCTGG - Intronic
1014472758 6:121836446-121836468 CCCTTTTCCTTTCCCAGTTGTGG + Intergenic
1014576509 6:123081171-123081193 CATTTTTCTGTTCCCAATTTTGG - Intergenic
1015044369 6:128760561-128760583 CCTCTTTTTGTTCCCAGTTTTGG + Intergenic
1015670846 6:135688213-135688235 CCTTTTTTTGTTCCCAGTTTCGG - Intergenic
1016202686 6:141431184-141431206 CCTCTTTTTGTTCCCAGTTTTGG - Intergenic
1016316483 6:142794092-142794114 GCCTATTCTATTCCCTCTTTGGG + Intronic
1016332739 6:142970950-142970972 CCTCTTTTTGTTCCCAGTTTTGG - Intergenic
1016460225 6:144274018-144274040 CCTCTTTTTGTTCCCAGTTTCGG - Intergenic
1016733994 6:147456202-147456224 CCCTGGTCAATTCCCTGTTTGGG - Intergenic
1016800851 6:148167605-148167627 CCCTCTGCCCTTCCCTGTTTTGG + Intergenic
1017551710 6:155516859-155516881 CCATTTTCTTTCCCTTGTTTTGG - Intergenic
1018520825 6:164649354-164649376 TGCTTTTCTGTTGCTTGTTTAGG + Intergenic
1018603286 6:165569746-165569768 CGGTTTACTGTTCCCTGTGTAGG + Intronic
1020539821 7:9447054-9447076 CCTTTTTATGTTTCCTTTTTAGG - Intergenic
1020547739 7:9554733-9554755 CCTCTTTTTGTTCCCGGTTTGGG + Intergenic
1020867177 7:13580944-13580966 TCCTTTCATGTTCCTTGTTTGGG - Intergenic
1021507549 7:21402210-21402232 CCCTTTTTTCTTCCCAGTCTTGG + Intergenic
1021866841 7:24966574-24966596 CCTTTTTCTGAGCCATGTTTAGG + Intronic
1022960594 7:35422688-35422710 CCATTTTCTGTTCAGAGTTTGGG + Intergenic
1023120629 7:36904759-36904781 ACCTTTTCTGTCTCCTCTTTTGG - Intronic
1023404326 7:39815867-39815889 TCCTTTTCTGTTTGCAGTTTAGG + Intergenic
1024011028 7:45266928-45266950 TTCTTTTCTGTTCCCTGTCTGGG - Intergenic
1024199129 7:47088677-47088699 ACTTTTTCTGTGCCCTGTGTTGG - Intergenic
1025259249 7:57406334-57406356 CTCTTGACTGTTCCCTCTTTAGG + Intergenic
1025296067 7:57776087-57776109 CCCATTTCTGATCCCCCTTTCGG + Intergenic
1026375306 7:69744457-69744479 TCCTTTTCTGTTTCCTCTTCAGG + Intronic
1027481762 7:78706421-78706443 CCTCTTTTTGTTCCCAGTTTCGG + Intronic
1027821712 7:83054366-83054388 CCTTTTTCTTTTCCCTTTTTAGG + Intronic
1028266094 7:88727725-88727747 CTCTTTTCTGTTCTCTTTTCTGG + Intergenic
1029264555 7:99327942-99327964 GGCATTTCTGTCCCCTGTTTAGG - Intronic
1030006622 7:105126640-105126662 CCCATTTCTCTGTCCTGTTTGGG - Intronic
1030094146 7:105882814-105882836 CCTCTTTTTGTTCCCAGTTTTGG + Intronic
1031145893 7:117996152-117996174 CCTTTTTTTGTTCCCAGTTTCGG + Intergenic
1031755151 7:125630181-125630203 AAATTGTCTGTTCCCTGTTTGGG - Intergenic
1032101164 7:128979023-128979045 CGCTTTGCTGTTCGCTGTGTAGG - Exonic
1032633689 7:133682519-133682541 CCTCTTTTTGTTCCCAGTTTTGG + Intronic
1032913709 7:136462981-136463003 TCTTTTTTTGTTCCCAGTTTTGG - Intergenic
1033551853 7:142454806-142454828 CCCTTTTGTGTTCTATGTTAGGG + Intergenic
1034970305 7:155414893-155414915 CCCTTTCCTGCTTCCTGTCTTGG - Intergenic
1035000815 7:155610946-155610968 CCCTTTTGTGTTCCCTCCCTGGG + Intergenic
1035017540 7:155779770-155779792 CTCTTTTCTGTGTCATGTTTTGG + Exonic
1035600169 8:892643-892665 CCCTGGTCTGTTCCCTGTGCTGG + Intergenic
1036782312 8:11658216-11658238 ACCTTTTCTCCTCCCTGGTTGGG - Intergenic
1036889852 8:12589376-12589398 CACTTTTCTGTCCTCTGTCTGGG + Intergenic
1037909695 8:22736860-22736882 TCCTTTTCTCTTACCTATTTTGG + Intronic
1037997882 8:23366841-23366863 CCCTTATCTCTTTCCTATTTGGG + Intronic
1039793663 8:40894809-40894831 GCCTATTGTGTTCGCTGTTTTGG - Intronic
1040777979 8:51070655-51070677 CACTTTTCAGTTCTCTGTCTAGG + Intergenic
1041508836 8:58632273-58632295 GCCATTTCTGTTCCCTTTTGTGG + Intronic
1042253180 8:66776272-66776294 CTCTTTTTTGATCCCTGTTTTGG - Intronic
1042412401 8:68480366-68480388 CCTCTTTTTGTTCCCAGTTTTGG + Intronic
1042829117 8:73007905-73007927 CCGTTTTCTGTTCCTTGATGTGG - Intergenic
1043679853 8:83009944-83009966 TCATTTTCTTTTCCCTGTTAAGG + Intergenic
1044264276 8:90164015-90164037 CCCTATTCTGTTAGCTCTTTTGG + Intergenic
1044784533 8:95780479-95780501 CCCCTTTTTGTTCCCAGTCTCGG + Intergenic
1047147699 8:122223344-122223366 CCCTTCTCTCTTCTCTCTTTGGG - Intergenic
1047159982 8:122367359-122367381 TCTCTTTCTGTTCCCAGTTTTGG - Intergenic
1047375610 8:124293265-124293287 CCCTTTGCTTTTGCCTGCTTTGG + Intergenic
1048275857 8:133065440-133065462 CACTTTTCTGTTGCCTTCTTGGG - Intronic
1048562789 8:135559886-135559908 GCATTTTCTGTTCACTTTTTGGG - Intronic
1048649636 8:136460751-136460773 CTCTTTTTTGTTCCTTGCTTTGG - Intergenic
1049614826 8:143571569-143571591 CCCTTTTCAGCTCCCTCTTCTGG + Intronic
1049705243 8:144039217-144039239 CCTTTTTCTGGCCACTGTTTCGG - Intronic
1049960070 9:729826-729848 ACCTCTTCTTTTCTCTGTTTTGG - Intronic
1050014692 9:1221393-1221415 ACCTTTTCTGTAGTCTGTTTTGG + Intergenic
1050366745 9:4879954-4879976 CCCTTTCCTGTTCCCTAGGTTGG + Intronic
1051226434 9:14904190-14904212 CTCTTTTTTGTTCCCTTTTAAGG - Intronic
1051850150 9:21497068-21497090 CCCTTTTCTGTTCATGTTTTTGG - Intergenic
1051866979 9:21694769-21694791 CCCATTTCTGTTCCCTCCCTTGG + Intergenic
1052351892 9:27466583-27466605 CCCTTTTTTCTTCCCAGTTTTGG - Intronic
1052785869 9:32827813-32827835 TCCTTTCCTGTTCCCTTTGTTGG - Intergenic
1054275115 9:63060364-63060386 CAGTTTTCTGTTGGCTGTTTGGG + Intergenic
1056506210 9:87260441-87260463 CCCTTTCCTGTGCCCTTTTAAGG + Intergenic
1059350958 9:113664538-113664560 CCATTTTTTTTTTCCTGTTTTGG - Intergenic
1059552156 9:115239964-115239986 TCCTTTTGTGTTCCTTGTTTTGG - Intronic
1059649260 9:116300011-116300033 CTCTTTTCAGTTCTCTGTATTGG + Intronic
1059989565 9:119852569-119852591 CCTTTCTCTGCCCCCTGTTTTGG + Intergenic
1060797841 9:126524669-126524691 CCCTTTTCTTTACCCTGTGGAGG - Intergenic
1185730970 X:2461394-2461416 AGCCTTTCTTTTCCCTGTTTTGG - Intronic
1185733909 X:2482938-2482960 AGCCTTTCTTTTCCCTGTTTTGG - Intronic
1186335389 X:8581392-8581414 GCCTTTTTTGTTCCCAGTTTTGG + Intronic
1186348423 X:8718380-8718402 CCATTTTCTTTTCCATGTTTTGG - Intronic
1186700174 X:12082459-12082481 CCTGTTTTTGTTCCCAGTTTTGG + Intergenic
1187377909 X:18773598-18773620 TCCTTTTCTTTTTGCTGTTTTGG + Intronic
1188820397 X:34767835-34767857 CTCTTTTGTGTTCACTGTGTGGG - Intergenic
1189118786 X:38371166-38371188 CCCCTTTCAGTTCCCAGTATTGG + Intronic
1189228899 X:39436601-39436623 CCTTTTTTTGTTCCCAGTTTCGG - Intergenic
1189371164 X:40430651-40430673 CCACTTTTTGTTCCCAGTTTCGG + Intergenic
1190583498 X:51913083-51913105 CCTCTTTTTGTTCCCAGTTTTGG - Intergenic
1190691628 X:52917564-52917586 CCTCTTTCTGTGCTCTGTTTGGG + Intergenic
1190694355 X:52938228-52938250 CCTCTTTCTGTGCTCTGTTTGGG - Intronic
1190939489 X:55026744-55026766 CCCCTTTCTCTTCTCTGTCTTGG - Intronic
1191867761 X:65719391-65719413 CCCATTTCTGTTCCTAGTATTGG + Intronic
1192636401 X:72823719-72823741 CCCTGTTCTGTTCCCTCTGGTGG + Intronic
1192645313 X:72897095-72897117 CCCTGTTCTGTTCCCTCTGGTGG - Intronic
1194112907 X:89857252-89857274 ACCTTTTATTTTACCTGTTTTGG - Intergenic
1194347611 X:92785356-92785378 CCCTTTTTTTTTCACTGTCTTGG + Intergenic
1195135418 X:101901887-101901909 ACCTATCCAGTTCCCTGTTTAGG + Intronic
1195209925 X:102645128-102645150 CCTCTTTTTGTTCCCAGTTTCGG - Intergenic
1195227878 X:102817242-102817264 CCTTTTTTTGTTCCTAGTTTTGG - Intergenic
1195421826 X:104684119-104684141 CCCTTTTCTGGTCCATCTCTAGG - Intronic
1196050492 X:111298779-111298801 TCCTTTTCTCTTCACTGTTTTGG - Exonic
1196324687 X:114389327-114389349 CGCTTTGCTGTTCGCTGTGTAGG + Intergenic
1196413008 X:115439809-115439831 CCATTTTTTTTTCCCTCTTTGGG - Intergenic
1197160404 X:123316968-123316990 CCTTTTTTTGTTCCCAGTTTTGG - Intronic
1197547182 X:127839275-127839297 CCTTTTTTTGTTCCCAGTTTCGG - Intergenic
1198475931 X:136998451-136998473 CCTCTTTTTGTTCCCAGTTTTGG - Intergenic
1198556917 X:137804837-137804859 CACTTATCTTTTCCCTGTGTTGG + Intergenic
1198734776 X:139773260-139773282 CCTCTTTTTGTTCCCAGTTTCGG + Intronic
1199362739 X:146942406-146942428 CCTCTTTTTGTTCCCAGTTTCGG - Intergenic
1200610947 Y:5327089-5327111 TCCTTATCTGTTACCTATTTCGG - Intronic
1201334027 Y:12859823-12859845 CTCTTTTATGTTCCCTTTTTTGG - Exonic
1201417400 Y:13761124-13761146 CCATTTCCTTTTCCATGTTTTGG + Intergenic