ID: 929004047

View in Genome Browser
Species Human (GRCh38)
Location 2:37378500-37378522
Sequence GGCCAATGGCAGTCAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929004047_929004051 -8 Left 929004047 2:37378500-37378522 CCTTGGCCTGACTGCCATTGGCC No data
Right 929004051 2:37378515-37378537 CATTGGCCCAAGTGGAGCTCTGG No data
929004047_929004057 17 Left 929004047 2:37378500-37378522 CCTTGGCCTGACTGCCATTGGCC No data
Right 929004057 2:37378540-37378562 CCTTTGCTGATTCAGTCTCTGGG No data
929004047_929004060 28 Left 929004047 2:37378500-37378522 CCTTGGCCTGACTGCCATTGGCC No data
Right 929004060 2:37378551-37378573 TCAGTCTCTGGGCTGGTGGATGG No data
929004047_929004055 16 Left 929004047 2:37378500-37378522 CCTTGGCCTGACTGCCATTGGCC No data
Right 929004055 2:37378539-37378561 ACCTTTGCTGATTCAGTCTCTGG No data
929004047_929004059 24 Left 929004047 2:37378500-37378522 CCTTGGCCTGACTGCCATTGGCC No data
Right 929004059 2:37378547-37378569 TGATTCAGTCTCTGGGCTGGTGG No data
929004047_929004058 21 Left 929004047 2:37378500-37378522 CCTTGGCCTGACTGCCATTGGCC No data
Right 929004058 2:37378544-37378566 TGCTGATTCAGTCTCTGGGCTGG No data
929004047_929004052 -7 Left 929004047 2:37378500-37378522 CCTTGGCCTGACTGCCATTGGCC No data
Right 929004052 2:37378516-37378538 ATTGGCCCAAGTGGAGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929004047 Original CRISPR GGCCAATGGCAGTCAGGCCA AGG (reversed) Intergenic
No off target data available for this crispr