ID: 929005576

View in Genome Browser
Species Human (GRCh38)
Location 2:37390008-37390030
Sequence AGAGATCCAAGCTCACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929005575_929005576 -3 Left 929005575 2:37389988-37390010 CCGAGGGAACAGATGCAGGGAGA No data
Right 929005576 2:37390008-37390030 AGAGATCCAAGCTCACAGCCAGG No data
929005567_929005576 28 Left 929005567 2:37389957-37389979 CCAAATCTACCCACAGGGCTGGA No data
Right 929005576 2:37390008-37390030 AGAGATCCAAGCTCACAGCCAGG No data
929005569_929005576 19 Left 929005569 2:37389966-37389988 CCCACAGGGCTGGAATTAGGCAC No data
Right 929005576 2:37390008-37390030 AGAGATCCAAGCTCACAGCCAGG No data
929005570_929005576 18 Left 929005570 2:37389967-37389989 CCACAGGGCTGGAATTAGGCACC No data
Right 929005576 2:37390008-37390030 AGAGATCCAAGCTCACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929005576 Original CRISPR AGAGATCCAAGCTCACAGCC AGG Intergenic
No off target data available for this crispr