ID: 929007582

View in Genome Browser
Species Human (GRCh38)
Location 2:37410927-37410949
Sequence CTTAAAAACCCAATGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929007578_929007582 28 Left 929007578 2:37410876-37410898 CCAGACAGAGGTGTTAGAACTTT No data
Right 929007582 2:37410927-37410949 CTTAAAAACCCAATGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929007582 Original CRISPR CTTAAAAACCCAATGGAGGC TGG Intergenic
No off target data available for this crispr