ID: 929010812

View in Genome Browser
Species Human (GRCh38)
Location 2:37442283-37442305
Sequence GATGCTGTAGCTGCACATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929010812_929010815 -5 Left 929010812 2:37442283-37442305 CCCAAATGTGCAGCTACAGCATC No data
Right 929010815 2:37442301-37442323 GCATCTAGATGGCTGTTTTTTGG No data
929010812_929010816 17 Left 929010812 2:37442283-37442305 CCCAAATGTGCAGCTACAGCATC No data
Right 929010816 2:37442323-37442345 GTAGACATTCATATTATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929010812 Original CRISPR GATGCTGTAGCTGCACATTT GGG (reversed) Intergenic
No off target data available for this crispr