ID: 929011747

View in Genome Browser
Species Human (GRCh38)
Location 2:37451854-37451876
Sequence CTGAATATACAAAGGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929011747_929011754 10 Left 929011747 2:37451854-37451876 CCATTGTCCCTTTGTATATTCAG No data
Right 929011754 2:37451887-37451909 TTGAGAGGGAGTGAAGGAATAGG No data
929011747_929011760 23 Left 929011747 2:37451854-37451876 CCATTGTCCCTTTGTATATTCAG No data
Right 929011760 2:37451900-37451922 AAGGAATAGGGAGGGGATCTGGG No data
929011747_929011751 -5 Left 929011747 2:37451854-37451876 CCATTGTCCCTTTGTATATTCAG No data
Right 929011751 2:37451872-37451894 TTCAGCTTCTCAGGATTGAGAGG No data
929011747_929011759 22 Left 929011747 2:37451854-37451876 CCATTGTCCCTTTGTATATTCAG No data
Right 929011759 2:37451899-37451921 GAAGGAATAGGGAGGGGATCTGG No data
929011747_929011753 4 Left 929011747 2:37451854-37451876 CCATTGTCCCTTTGTATATTCAG No data
Right 929011753 2:37451881-37451903 TCAGGATTGAGAGGGAGTGAAGG No data
929011747_929011757 15 Left 929011747 2:37451854-37451876 CCATTGTCCCTTTGTATATTCAG No data
Right 929011757 2:37451892-37451914 AGGGAGTGAAGGAATAGGGAGGG No data
929011747_929011756 14 Left 929011747 2:37451854-37451876 CCATTGTCCCTTTGTATATTCAG No data
Right 929011756 2:37451891-37451913 GAGGGAGTGAAGGAATAGGGAGG No data
929011747_929011755 11 Left 929011747 2:37451854-37451876 CCATTGTCCCTTTGTATATTCAG No data
Right 929011755 2:37451888-37451910 TGAGAGGGAGTGAAGGAATAGGG No data
929011747_929011758 16 Left 929011747 2:37451854-37451876 CCATTGTCCCTTTGTATATTCAG No data
Right 929011758 2:37451893-37451915 GGGAGTGAAGGAATAGGGAGGGG No data
929011747_929011752 -4 Left 929011747 2:37451854-37451876 CCATTGTCCCTTTGTATATTCAG No data
Right 929011752 2:37451873-37451895 TCAGCTTCTCAGGATTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929011747 Original CRISPR CTGAATATACAAAGGGACAA TGG (reversed) Intergenic
No off target data available for this crispr