ID: 929022084

View in Genome Browser
Species Human (GRCh38)
Location 2:37563455-37563477
Sequence CATTCTGCACACTTGTAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929022080_929022084 8 Left 929022080 2:37563424-37563446 CCAAATAGTTGAAGACCTCTTTG No data
Right 929022084 2:37563455-37563477 CATTCTGCACACTTGTAGGGCGG No data
929022081_929022084 -7 Left 929022081 2:37563439-37563461 CCTCTTTGAGTATTTTCATTCTG No data
Right 929022084 2:37563455-37563477 CATTCTGCACACTTGTAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929022084 Original CRISPR CATTCTGCACACTTGTAGGG CGG Intergenic
No off target data available for this crispr