ID: 929022084 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:37563455-37563477 |
Sequence | CATTCTGCACACTTGTAGGG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
929022080_929022084 | 8 | Left | 929022080 | 2:37563424-37563446 | CCAAATAGTTGAAGACCTCTTTG | No data | ||
Right | 929022084 | 2:37563455-37563477 | CATTCTGCACACTTGTAGGGCGG | No data | ||||
929022081_929022084 | -7 | Left | 929022081 | 2:37563439-37563461 | CCTCTTTGAGTATTTTCATTCTG | No data | ||
Right | 929022084 | 2:37563455-37563477 | CATTCTGCACACTTGTAGGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
929022084 | Original CRISPR | CATTCTGCACACTTGTAGGG CGG | Intergenic | ||
No off target data available for this crispr |