ID: 929022195

View in Genome Browser
Species Human (GRCh38)
Location 2:37564666-37564688
Sequence CAGTGTGAGCCTCGGGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929022195_929022199 -9 Left 929022195 2:37564666-37564688 CCAGATCCCCGAGGCTCACACTG No data
Right 929022199 2:37564680-37564702 CTCACACTGTCTATAGAATTAGG No data
929022195_929022202 19 Left 929022195 2:37564666-37564688 CCAGATCCCCGAGGCTCACACTG No data
Right 929022202 2:37564708-37564730 ATCAAAACCCACTTGAGAGTAGG No data
929022195_929022200 -8 Left 929022195 2:37564666-37564688 CCAGATCCCCGAGGCTCACACTG No data
Right 929022200 2:37564681-37564703 TCACACTGTCTATAGAATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929022195 Original CRISPR CAGTGTGAGCCTCGGGGATC TGG (reversed) Intergenic
No off target data available for this crispr