ID: 929022412

View in Genome Browser
Species Human (GRCh38)
Location 2:37566589-37566611
Sequence CATGGTAATTTTGAGCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929022409_929022412 11 Left 929022409 2:37566555-37566577 CCTGCTGGGACAACGATAGGATT No data
Right 929022412 2:37566589-37566611 CATGGTAATTTTGAGCAAGAGGG No data
929022408_929022412 12 Left 929022408 2:37566554-37566576 CCCTGCTGGGACAACGATAGGAT No data
Right 929022412 2:37566589-37566611 CATGGTAATTTTGAGCAAGAGGG No data
929022406_929022412 20 Left 929022406 2:37566546-37566568 CCAATGAACCCTGCTGGGACAAC No data
Right 929022412 2:37566589-37566611 CATGGTAATTTTGAGCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929022412 Original CRISPR CATGGTAATTTTGAGCAAGA GGG Intergenic
No off target data available for this crispr