ID: 929028919

View in Genome Browser
Species Human (GRCh38)
Location 2:37632816-37632838
Sequence TCCAAACAAAGTCTTGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929028919_929028924 22 Left 929028919 2:37632816-37632838 CCATTTTCAAGACTTTGTTTGGA No data
Right 929028924 2:37632861-37632883 CCTCATAAGGACCTTTAGTCAGG No data
929028919_929028922 9 Left 929028919 2:37632816-37632838 CCATTTTCAAGACTTTGTTTGGA No data
Right 929028922 2:37632848-37632870 CTAGCTATGGAGACCTCATAAGG No data
929028919_929028925 23 Left 929028919 2:37632816-37632838 CCATTTTCAAGACTTTGTTTGGA No data
Right 929028925 2:37632862-37632884 CTCATAAGGACCTTTAGTCAGGG No data
929028919_929028920 -4 Left 929028919 2:37632816-37632838 CCATTTTCAAGACTTTGTTTGGA No data
Right 929028920 2:37632835-37632857 TGGACTTTGTCTCCTAGCTATGG No data
929028919_929028926 26 Left 929028919 2:37632816-37632838 CCATTTTCAAGACTTTGTTTGGA No data
Right 929028926 2:37632865-37632887 ATAAGGACCTTTAGTCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929028919 Original CRISPR TCCAAACAAAGTCTTGAAAA TGG (reversed) Intergenic
No off target data available for this crispr