ID: 929028921

View in Genome Browser
Species Human (GRCh38)
Location 2:37632847-37632869
Sequence CTTATGAGGTCTCCATAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929028921_929028931 28 Left 929028921 2:37632847-37632869 CCTAGCTATGGAGACCTCATAAG No data
Right 929028931 2:37632898-37632920 GTGGGCACTATTGGAATCAGAGG No data
929028921_929028928 9 Left 929028921 2:37632847-37632869 CCTAGCTATGGAGACCTCATAAG No data
Right 929028928 2:37632879-37632901 TCAGGGTGGTGACTTAAGAGTGG No data
929028921_929028926 -5 Left 929028921 2:37632847-37632869 CCTAGCTATGGAGACCTCATAAG No data
Right 929028926 2:37632865-37632887 ATAAGGACCTTTAGTCAGGGTGG No data
929028921_929028930 19 Left 929028921 2:37632847-37632869 CCTAGCTATGGAGACCTCATAAG No data
Right 929028930 2:37632889-37632911 GACTTAAGAGTGGGCACTATTGG No data
929028921_929028925 -8 Left 929028921 2:37632847-37632869 CCTAGCTATGGAGACCTCATAAG No data
Right 929028925 2:37632862-37632884 CTCATAAGGACCTTTAGTCAGGG No data
929028921_929028929 10 Left 929028921 2:37632847-37632869 CCTAGCTATGGAGACCTCATAAG No data
Right 929028929 2:37632880-37632902 CAGGGTGGTGACTTAAGAGTGGG No data
929028921_929028924 -9 Left 929028921 2:37632847-37632869 CCTAGCTATGGAGACCTCATAAG No data
Right 929028924 2:37632861-37632883 CCTCATAAGGACCTTTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929028921 Original CRISPR CTTATGAGGTCTCCATAGCT AGG (reversed) Intergenic
No off target data available for this crispr