ID: 929028924

View in Genome Browser
Species Human (GRCh38)
Location 2:37632861-37632883
Sequence CCTCATAAGGACCTTTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929028919_929028924 22 Left 929028919 2:37632816-37632838 CCATTTTCAAGACTTTGTTTGGA No data
Right 929028924 2:37632861-37632883 CCTCATAAGGACCTTTAGTCAGG No data
929028921_929028924 -9 Left 929028921 2:37632847-37632869 CCTAGCTATGGAGACCTCATAAG No data
Right 929028924 2:37632861-37632883 CCTCATAAGGACCTTTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929028924 Original CRISPR CCTCATAAGGACCTTTAGTC AGG Intergenic
No off target data available for this crispr