ID: 929030878

View in Genome Browser
Species Human (GRCh38)
Location 2:37649011-37649033
Sequence TGGGGTCAGCTGATGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 416}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929030868_929030878 6 Left 929030868 2:37648982-37649004 CCACAACTCAAGGGCATGCCAGG 0: 1
1: 0
2: 0
3: 20
4: 148
Right 929030878 2:37649011-37649033 TGGGGTCAGCTGATGGAGGCAGG 0: 1
1: 0
2: 2
3: 36
4: 416
929030864_929030878 30 Left 929030864 2:37648958-37648980 CCATGGAAAGATACAGCGTGTCC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 929030878 2:37649011-37649033 TGGGGTCAGCTGATGGAGGCAGG 0: 1
1: 0
2: 2
3: 36
4: 416
929030867_929030878 9 Left 929030867 2:37648979-37649001 CCACCACAACTCAAGGGCATGCC 0: 1
1: 0
2: 0
3: 6
4: 132
Right 929030878 2:37649011-37649033 TGGGGTCAGCTGATGGAGGCAGG 0: 1
1: 0
2: 2
3: 36
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929030878 Original CRISPR TGGGGTCAGCTGATGGAGGC AGG Intronic
900130929 1:1086967-1086989 TGGGGTCAGCTGGTGTGGGTGGG - Intronic
900408866 1:2504010-2504032 TGGGGACAGCCGCTGGTGGCGGG - Exonic
900422110 1:2560151-2560173 GGGGAACAGGTGATGGAGGCAGG + Intronic
900528688 1:3142116-3142138 CGGGGGGAGCCGATGGAGGCTGG - Intronic
900650360 1:3727339-3727361 TGGGGTGTGCTGCTGGAGGAAGG + Intronic
901026072 1:6279353-6279375 TGGGGGCAGATGAGGGAGGAAGG + Intronic
901457443 1:9371322-9371344 TGGGGTCAGGCGCTGGGGGCGGG + Intergenic
901651814 1:10747267-10747289 TGGGGTCTGCAGAGAGAGGCAGG + Intronic
901757601 1:11450848-11450870 TGGGGGCAGGTGAGGGTGGCAGG - Intergenic
901808476 1:11752295-11752317 TGGGGGCAGATGATGCAGCCTGG + Intronic
902369586 1:15997447-15997469 TGGAGGCAGCTGGTGGGGGCAGG - Intergenic
902612159 1:17603624-17603646 TGGGGACAGGGGAGGGAGGCTGG + Intronic
903137591 1:21319525-21319547 TGGGGGCAGCAGAGGGAGTCTGG - Intronic
903696063 1:25207793-25207815 TGGGGTTTGCTGATTCAGGCTGG - Intergenic
904044635 1:27602350-27602372 AGGGGCCAGCTGAGGGAGGAAGG - Intronic
904256914 1:29260041-29260063 AAGGGTCAGCTGGTGGACGCCGG + Exonic
904326539 1:29730280-29730302 TCGGGTCAGCTGCTGGGAGCCGG - Intergenic
904837809 1:33350066-33350088 GGGGCTCAGCTTAGGGAGGCGGG + Intronic
904870936 1:33617684-33617706 TGGGGTGAGATGCTGGTGGCAGG + Intronic
905199861 1:36308046-36308068 TGGGGGCTGCTGATGGATGGGGG + Intronic
905533004 1:38696810-38696832 GGGGGTCATCTGATCCAGGCTGG + Intergenic
905547179 1:38809167-38809189 TGGAGTCAGATGATGTAGGCTGG - Intergenic
905793692 1:40803488-40803510 CAGGCCCAGCTGATGGAGGCAGG - Intronic
905898863 1:41567445-41567467 TGGGCTCATGTGATGGGGGCTGG + Intronic
906273355 1:44498613-44498635 TGGGGTCAGATGAGGGCAGCAGG - Intronic
906274946 1:44508355-44508377 TGGGGTCAGCAGGTGGATGAAGG + Intronic
907461846 1:54609814-54609836 TGTGGCCAGCTGCTGCAGGCAGG + Exonic
908733284 1:67248973-67248995 TGGGTACAGCTCATGGAGGGGGG - Intronic
909169522 1:72277212-72277234 GGGGGTCTGCGGGTGGAGGCTGG - Intronic
909454469 1:75834778-75834800 TGGGGTCAGGGGATGGGGGAGGG + Intronic
909739167 1:79006850-79006872 TGGGGAAAGGGGATGGAGGCCGG - Intergenic
912480865 1:109981308-109981330 TGGGGACAGGTGATGGGGGTGGG - Intergenic
913601887 1:120429133-120429155 TGGGGGCACCCGATGGAGCCTGG + Intergenic
914085156 1:144447470-144447492 TGGGGGCACCCGATGGAGCCTGG - Intronic
914588974 1:149089448-149089470 TGGGGGCACCCGATGGAGCCTGG - Intronic
915001990 1:152601978-152602000 AGGGGTCATGTGCTGGAGGCAGG + Intergenic
916143736 1:161722336-161722358 CGGGGTCATCTGCTGGAGCCTGG + Intronic
919840883 1:201608717-201608739 TGGGGTCAGCTGGGGGAGGAGGG + Intergenic
920118175 1:203636033-203636055 TGGGGCCAGCTGAGGGAACCTGG + Intronic
920227177 1:204447275-204447297 TAGTGTCAGCTGATGGAGAAAGG + Intronic
920373814 1:205495660-205495682 TGGAGCCAGCTGACAGAGGCAGG + Intergenic
921326119 1:213987718-213987740 TGGGGGCCGGGGATGGAGGCCGG + Intronic
922332363 1:224588409-224588431 TGGGCTCAGCTCATGGAGCAAGG + Intronic
922466338 1:225847628-225847650 TGGGGTCAGTGGCTGGAGCCTGG - Intronic
922528575 1:226325544-226325566 TAGGGACAGCAGTTGGAGGCTGG - Intergenic
922796437 1:228341933-228341955 TGGAGTCAGGTGAGTGAGGCAGG - Intronic
923073391 1:230587178-230587200 GGGGGTCAGCTGATGTAGATGGG - Intergenic
923084849 1:230695367-230695389 TGGGGTCTATTGATGAAGGCTGG - Intergenic
923718208 1:236444806-236444828 TGGGGTTGGCTGCTGGGGGCAGG - Intronic
924143544 1:241050390-241050412 TGGGGTTAGGTACTGGAGGCTGG + Intronic
924180924 1:241437960-241437982 TGGGTACAGCTGAAGGAGCCAGG - Intergenic
924941078 1:248812787-248812809 TGGGGGCTGGTGATGGGGGCTGG - Intronic
1062819564 10:523980-524002 TGGGGTCAGCAAAGGGTGGCTGG + Intronic
1063372184 10:5529154-5529176 TGGGGTCTGCTGGTGAGGGCAGG - Intergenic
1065932236 10:30490263-30490285 TGGGTTGAGGGGATGGAGGCAGG - Intergenic
1066043672 10:31578385-31578407 TTGGCTCACCTGCTGGAGGCTGG - Intergenic
1067222637 10:44355180-44355202 CGGTTTCTGCTGATGGAGGCTGG - Intergenic
1067289677 10:44931968-44931990 TGGAGACAGGTGAGGGAGGCTGG - Intronic
1068058121 10:52035696-52035718 TGGGTACAGCTGAAGGAGCCGGG + Intronic
1068713104 10:60155810-60155832 TGGGGTCAGATGTTTGAGGCAGG - Intronic
1068918282 10:62456996-62457018 GGGGGTCAGCTAATTTAGGCTGG + Intronic
1068945466 10:62724704-62724726 TGGGGGCAGCTGATGAGGGAGGG + Intergenic
1069063594 10:63919606-63919628 TGCGGTCAGCAGAAGGAAGCAGG + Intergenic
1069734601 10:70645471-70645493 TGGGTGCAGCTCATGGAGGGTGG - Intergenic
1070319510 10:75343956-75343978 TGGCTTCAGCTGGTGGTGGCAGG + Intergenic
1071839124 10:89450607-89450629 TGGGGTCAGGGGATGGGGGAGGG + Intronic
1072357607 10:94626588-94626610 TGTGGTCAGCTGGTCTAGGCAGG + Intergenic
1075461641 10:122620444-122620466 CTGGGTCAGATGTTGGAGGCTGG + Intronic
1075486161 10:122823368-122823390 AGGTCTCAGCTCATGGAGGCAGG + Intergenic
1075549893 10:123384367-123384389 TGGTGTGTGCTGATGGAGTCAGG - Intergenic
1076036814 10:127205529-127205551 TGGCGTAAGTGGATGGAGGCAGG + Intronic
1076562134 10:131373915-131373937 TGGGGTCAGAGGATGGAGCAAGG - Intergenic
1076568227 10:131413209-131413231 CAGAGTCAGCTGGTGGAGGCTGG + Intergenic
1076731943 10:132443736-132443758 TGAGCTCAGCTGAGGGAGGGCGG + Intergenic
1076908076 10:133373127-133373149 TGGGGTCAGGTGGGGGATGCGGG + Intronic
1077872186 11:6271429-6271451 TGGGGCGAGCTCGTGGAGGCCGG - Exonic
1078422118 11:11221105-11221127 TGGGCTCAGCTGAGAGTGGCAGG - Intergenic
1078935683 11:15948189-15948211 TGGGGTGAGCTGGTGATGGCAGG - Intergenic
1079351365 11:19694664-19694686 TGGGGTCAGCTGGTGGTGTCTGG + Intronic
1080617269 11:33955571-33955593 AAGAGCCAGCTGATGGAGGCAGG - Intergenic
1080643628 11:34173106-34173128 TGGGGGCAGGTCATGGATGCCGG + Intronic
1081402261 11:42656966-42656988 TGTGATCAGCTGATGTAGGAGGG - Intergenic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1083852913 11:65378383-65378405 TGAGGGCCGCTGATGGAGCCTGG - Intronic
1084222190 11:67689271-67689293 TGGTGTCAGAAGATGGAGGCTGG - Intergenic
1084557229 11:69882308-69882330 TTGGGTCAGTGGATGGAAGCAGG - Intergenic
1084681639 11:70669838-70669860 TTGGGTGTGCTGATGGCGGCTGG + Intronic
1085076477 11:73597212-73597234 TGGGGTGGGCTGATGGAGGTTGG - Intronic
1085591916 11:77771013-77771035 TGGGGTCATCTGATTGGAGCTGG - Intronic
1085762353 11:79252848-79252870 TGGGGTCAGCTGATCTAAACTGG - Intronic
1088484346 11:110326195-110326217 TCAGCTCAGCTCATGGAGGCTGG + Intergenic
1089372752 11:117972872-117972894 TGGGGTGAGCAGATGGGAGCGGG + Intergenic
1089677217 11:120098124-120098146 TGGGGTCAGCTGCTGTGGGCTGG - Intergenic
1090776177 11:129968014-129968036 TGTGTGCAGCTGATGAAGGCAGG - Intronic
1091429042 12:416891-416913 TGGGGTCAGGAGTTCGAGGCCGG + Intronic
1091653395 12:2326038-2326060 TGGGGGCAGCAGGGGGAGGCAGG + Intronic
1091797781 12:3307067-3307089 TGGGCAGAGCTGAGGGAGGCTGG + Intergenic
1094846231 12:34362591-34362613 GGGGGCCAGCTGAAGGCGGCAGG - Intergenic
1096257294 12:50071208-50071230 TGGGGACAGGTGGTGGTGGCTGG + Intronic
1097158102 12:57027198-57027220 TGGGGGGAGCTGTTGGGGGCGGG + Intronic
1097243584 12:57592579-57592601 TGGGGAAGGCTGATGGAGGTAGG + Intronic
1097727631 12:63093146-63093168 TGGGGTAAGCAGCTGGAGGTGGG - Intergenic
1100430791 12:94530286-94530308 TGGGGTCAGCTGGAAGAGGAAGG - Intergenic
1100490658 12:95074667-95074689 TGGGGCCAGCAGTTGGAGACCGG + Intergenic
1101810523 12:108103843-108103865 TGGGGTCACCTGATCCAGGCTGG - Intergenic
1102692203 12:114770180-114770202 TTGAGTCAACTGATGGAGACTGG + Intergenic
1103389465 12:120560976-120560998 GGGGGTGAGATGATGGACGCTGG + Intronic
1103445568 12:120993000-120993022 TGGTACCAGCTGATGAAGGCTGG + Intronic
1103907716 12:124335905-124335927 TGGGTTCAGGTGGTGGAGGCCGG + Intronic
1105503334 13:20990534-20990556 TGAGGCCAGAGGATGGAGGCAGG - Intronic
1105923946 13:24989341-24989363 AGGGCTCAGCGGATGGAGGCGGG - Intergenic
1106606587 13:31234604-31234626 TGGGGCCAGCGGATGGGGGGTGG + Intronic
1109807156 13:67457839-67457861 TGGGGTGGGGTGATGGAGGAAGG + Intergenic
1113440198 13:110322661-110322683 TGGGGTCAGAAGATGGAGAGTGG + Intronic
1113813433 13:113155654-113155676 TGGGGTCAGTTGATTTAAGCTGG + Intergenic
1113829961 13:113287936-113287958 CTGAGTCTGCTGATGGAGGCTGG - Intergenic
1114645830 14:24255579-24255601 TGGGATCAGGGGAAGGAGGCCGG - Intronic
1114724446 14:24920678-24920700 TGGGGGCAGCTGAGGGAGACAGG - Intronic
1114740926 14:25096358-25096380 TGGGATCATCTGATGAAGCCAGG + Intergenic
1115123115 14:29960970-29960992 TGGGGTCTACAGATGCAGGCAGG + Intronic
1115859512 14:37668367-37668389 TGGAGTCAGCTAATCTAGGCTGG + Intronic
1116873285 14:50088037-50088059 TTGGCTCATGTGATGGAGGCTGG - Intronic
1117254459 14:53963778-53963800 TGGGGCGAGCTGTTGCAGGCAGG - Intergenic
1117341809 14:54798120-54798142 TGGGGACTGGGGATGGAGGCAGG + Intergenic
1117389491 14:55249518-55249540 GGGGGTCAGCTGATGTGGGCTGG - Intergenic
1119667619 14:76496548-76496570 TGGGGTCAGTACAGGGAGGCAGG + Intronic
1121215245 14:92242584-92242606 TGGGGTCCCCTGATTGAGCCTGG - Intergenic
1121255568 14:92528030-92528052 TGGGGGCAGCTCAGGGAGGGGGG + Intronic
1121797957 14:96751247-96751269 GGGGTTCAGCTGATGTAAGCAGG + Intergenic
1122438103 14:101712663-101712685 TGGGGTGAGATGATGGTGGGTGG - Intergenic
1122774135 14:104109812-104109834 TGCGGCCAGCAGGTGGAGGCGGG - Intronic
1122801583 14:104232971-104232993 TGGGGTCTGCTGATGGGGAGGGG + Intergenic
1122837217 14:104436190-104436212 TGGGCGGAGCTGAGGGAGGCAGG + Intergenic
1122858219 14:104570184-104570206 TGGGGACAGCTGCGGGGGGCTGG + Intronic
1122915576 14:104856853-104856875 GGGGGTCAGCTGTTGGGGGGAGG + Intergenic
1122972270 14:105157188-105157210 TGGGCTCAGATCATGGAGGCTGG - Intronic
1123940996 15:25216618-25216640 TGGGGTCACCTCAGGGTGGCAGG + Intergenic
1125672675 15:41485258-41485280 TGGAGTGGGCTGATGGAGGGCGG + Intergenic
1126378076 15:48016540-48016562 TGAGGTCAGGTGATGGAATCAGG + Intergenic
1126669223 15:51101144-51101166 TGGGGTCACCTCATGAAAGCTGG - Intronic
1126753851 15:51905199-51905221 TGGTATCAGCAGATTGAGGCCGG + Intronic
1127837397 15:62800801-62800823 TGGGGTCAGCTGTGGGACTCTGG - Intronic
1128072146 15:64804429-64804451 TAGGAGCTGCTGATGGAGGCAGG + Intergenic
1128262045 15:66239441-66239463 TGGGGCCAGGTGCTGGAGTCTGG - Intronic
1129234269 15:74214349-74214371 TGGGGTGAGTGGAGGGAGGCAGG - Intergenic
1129760380 15:78125799-78125821 TGGGGTCTGCTGAGGGATGGGGG - Intronic
1130263108 15:82375066-82375088 TGGTGTCAGTAGACGGAGGCTGG + Intergenic
1130278185 15:82494597-82494619 TGGTGTCAATAGATGGAGGCTGG - Intergenic
1130470514 15:84221782-84221804 TGGTGTCAATAGATGGAGGCTGG - Intergenic
1130478002 15:84336349-84336371 TGGTGTCAATAGATGGAGGCTGG - Intergenic
1130493763 15:84451781-84451803 TGGTGTCAATAGATGGAGGCTGG + Intergenic
1130592801 15:85226408-85226430 TGGTGTCAATAGATGGAGGCTGG - Intergenic
1131853928 15:96571852-96571874 AGGGGTCAGCTGATGTAGGATGG - Intergenic
1132186684 15:99806952-99806974 CGGGGCCAGCTGAGGGAGGAAGG - Intergenic
1132429003 15:101745759-101745781 CGGGGCCAGCTGAGGGAGGAAGG + Intergenic
1132516538 16:368653-368675 TGGGGCCAGGTGCTGGTGGCAGG + Intronic
1132579896 16:680013-680035 TGGGGCCGGCTGCTGGGGGCGGG + Intronic
1132826030 16:1906137-1906159 TGGGGTGGGGTGATGGAGGCTGG - Intergenic
1134225335 16:12385624-12385646 TGGGGACAGCTGATGCACACAGG - Intronic
1134836014 16:17361314-17361336 GGGGGTCGGCTGATCTAGGCGGG - Intronic
1136343849 16:29663067-29663089 GGGGCTCACCTGAGGGAGGCAGG - Intronic
1136411056 16:30077456-30077478 TTTGGCTAGCTGATGGAGGCAGG + Intronic
1137546255 16:49405723-49405745 TGCTGTCTGCTGATGGACGCTGG - Intergenic
1138546617 16:57723269-57723291 TCGGGTTTGCTGAGGGAGGCAGG - Intronic
1139338881 16:66254119-66254141 TGGGATCACCCAATGGAGGCTGG + Intergenic
1139447545 16:67007129-67007151 TGTGGTGAGCTGCTGGAGGATGG - Intronic
1139548171 16:67659501-67659523 TGGGGAGAGCTGCTGGAGGGCGG + Intronic
1139599511 16:67978154-67978176 AGGGGTCCGCAGAGGGAGGCTGG - Intronic
1140039539 16:71396986-71397008 TGGGTTCAGTGGATGTAGGCAGG - Intergenic
1140905101 16:79402875-79402897 TGGGCTCAGCTGAAGGATGTGGG - Intergenic
1141550053 16:84800840-84800862 TGGGGTCACCTGATCTATGCTGG + Intergenic
1141726768 16:85794809-85794831 TGGGGGGAGGTGCTGGAGGCTGG + Intronic
1141882739 16:86870598-86870620 TGCTGTCAGCTGAAGCAGGCAGG + Intergenic
1142147560 16:88498956-88498978 TGGGGTCTGGTGGTGCAGGCAGG - Intronic
1143092522 17:4457550-4457572 TGGTGGGAGCTGATGGGGGCTGG + Intronic
1143473516 17:7190657-7190679 AGGGCCCAGGTGATGGAGGCAGG + Exonic
1143802569 17:9396466-9396488 TGAGGTCAGCTGAGGTGGGCGGG + Intronic
1143863698 17:9908979-9909001 TGGGGACAGCTGTGGGAGGAGGG - Intergenic
1144806092 17:17968813-17968835 TAGGGACAGCTGAATGAGGCAGG - Intronic
1145256565 17:21327105-21327127 TGGGCTCAGCGGATGGACCCAGG - Intergenic
1145320043 17:21760848-21760870 TGGGCTCAGCGGATGGACCCAGG + Intergenic
1146103565 17:30009952-30009974 TGGGGTCGGGGGATGGAGGAGGG - Intronic
1146263399 17:31435982-31436004 TGGGGCCAGCTAATGGAACCAGG + Intronic
1147178486 17:38671188-38671210 TGGGGGCAGGTGATGCAGGGAGG + Intergenic
1147338177 17:39739257-39739279 TGGGGGGACCTCATGGAGGCGGG + Intronic
1148835419 17:50463378-50463400 TGGTGTCTGGTGATGGAGACAGG - Exonic
1149431050 17:56595899-56595921 TGGGGTCAGCTCCAGGGGGCCGG - Intergenic
1150074307 17:62179640-62179662 TGCTGTCACATGATGGAGGCAGG - Intergenic
1151460312 17:74250308-74250330 GGCGGTCAGCTGGTGAAGGCTGG - Exonic
1151803050 17:76388954-76388976 AGGAGACAGCTGAGGGAGGCTGG - Intergenic
1152207166 17:78980482-78980504 TGGGGTCAGGTGTTGGAGCAGGG - Intergenic
1152259747 17:79260540-79260562 AGGGGTCAGCTGCTGGGGCCAGG + Intronic
1152814007 17:82397017-82397039 AGGGAGCAGCTGAGGGAGGCAGG + Intronic
1153889012 18:9495203-9495225 TGGCGTCAGAAGTTGGAGGCGGG + Intronic
1154917587 18:20752015-20752037 TGGGGTCGGGGGATGGAGGGAGG + Intergenic
1154921916 18:20819580-20819602 TGGGGTCGGGGGATGGAGGAGGG + Intergenic
1155250770 18:23951391-23951413 TGAGTTGAGCTGATGGGGGCGGG + Intronic
1155924888 18:31645008-31645030 TAGGGACAGCTGCAGGAGGCAGG + Intronic
1160502710 18:79410294-79410316 TGGGGTCCGTTGGTCGAGGCCGG + Intronic
1160903370 19:1440288-1440310 TGGGGTCGCCTGATGCAGGCGGG + Intronic
1160996318 19:1883697-1883719 TGGTGAAAGGTGATGGAGGCAGG - Intronic
1161175800 19:2841645-2841667 TGGGGGGAGCTGAGGGACGCGGG + Intronic
1161265444 19:3361405-3361427 TGGGGGCAAGTGCTGGAGGCGGG - Intronic
1161362435 19:3858294-3858316 TGGGATCTGCAGATAGAGGCAGG + Intronic
1162319316 19:9961442-9961464 TGAGCTCAGGAGATGGAGGCTGG - Intronic
1162531664 19:11239685-11239707 TGGGGGCCGCTGAGGCAGGCCGG - Exonic
1162791678 19:13066276-13066298 TGGGGTCAGGGGATGGAGAGGGG + Intronic
1162913193 19:13860987-13861009 TGGGGAGAGATGATGGAAGCCGG + Intergenic
1163156326 19:15441634-15441656 TGGCATCCCCTGATGGAGGCAGG - Intronic
1163317978 19:16554604-16554626 TGAGGTCAGGAGTTGGAGGCTGG + Intronic
1163442198 19:17327944-17327966 TGGGATAATCTGAGGGAGGCGGG - Intronic
1165329476 19:35133665-35133687 TGAGGCCAGGGGATGGAGGCAGG - Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166209564 19:41297492-41297514 TGGGGTCCTCTGTTGGAGGTGGG + Intronic
1166383977 19:42370223-42370245 TGGGTTCAGCTGTCGGAGGCGGG + Exonic
1166445996 19:42857404-42857426 TGGGTTCCGCTGAGGGAGGTTGG + Intronic
1166453377 19:42919556-42919578 TGGGTTCCGCTGAGGGAGGTTGG + Intronic
1166455863 19:42938865-42938887 TGGGTTCCGCTGAGGGAGGTTGG + Intronic
1166471796 19:43084344-43084366 TGGGTTCCGCTGAGGGAGGTTGG + Intronic
1166485413 19:43207292-43207314 TGGGTTCCGCTGAGGGAGGTTGG + Intronic
1166492564 19:43271212-43271234 TGGGTTCCGCTGAGGGAGGTTGG + Intergenic
1166779175 19:45331480-45331502 TGCAGTCAGTTCATGGAGGCAGG + Intergenic
1167079156 19:47267448-47267470 TGGGCTGAGCTGATCCAGGCTGG + Intronic
1167197349 19:48039442-48039464 TGGAGTTAGCTGCTGGAGGGAGG - Intronic
1167840477 19:52113615-52113637 TGGGGCCTGCTGATGGGGGTGGG - Exonic
1168503705 19:56915427-56915449 TGTGGTCAGCTGATGTAGTCAGG + Intergenic
925135210 2:1522043-1522065 TGGGGTCAGGAGAGGGAGGAAGG - Intronic
925730834 2:6918286-6918308 TGGGGTCGGCGGCCGGAGGCTGG - Intronic
926124241 2:10262056-10262078 GGGGATCAGCTGATCCAGGCTGG + Intergenic
926142051 2:10373672-10373694 AGGGGGCAGCTGCTCGAGGCTGG - Intronic
926250509 2:11153221-11153243 GGGGGTCAGCTGGGTGAGGCAGG - Intergenic
926317354 2:11720728-11720750 TGTGGTCAGATGTTGGATGCTGG + Intronic
927047464 2:19294273-19294295 TGAGTTCAGATGATGGAGACAGG + Intergenic
927701338 2:25270714-25270736 TGAGATCAGCTGAAGGAGGTGGG + Intronic
928102940 2:28449984-28450006 TGGGGTCAGTGGGTGGGGGCAGG - Intergenic
928317051 2:30254766-30254788 TGAGGTCAGAGGGTGGAGGCAGG + Intronic
929030878 2:37649011-37649033 TGGGGTCAGCTGATGGAGGCAGG + Intronic
929047479 2:37804131-37804153 TGGGGTCAGGGGAAGGAGGAAGG - Intergenic
929997346 2:46836969-46836991 TGGGGGCAGCGGCTAGAGGCAGG + Intronic
931721736 2:65071939-65071961 GGCGGTCGGGTGATGGAGGCAGG - Exonic
932833664 2:75013917-75013939 TGGGGTTAAGTGATGGAAGCAGG + Intergenic
932859762 2:75277996-75278018 GGGTGTCAGCTGATCAAGGCTGG + Intergenic
934430192 2:93695322-93695344 TGGGGTCGGGGGATGGAGGGAGG + Intergenic
936427561 2:112434119-112434141 TGGGATGGGCAGATGGAGGCGGG - Intronic
936463072 2:112725824-112725846 TGGGGTCAGGTGCAGGAGGAAGG - Intronic
936663376 2:114567077-114567099 TGGAGCCAGCTGTTGGAGGATGG - Intronic
936738351 2:115474349-115474371 TGGGTTCAGCCCATGGAGGTAGG + Intronic
941715585 2:168760075-168760097 TGGGGGGATCTGAGGGAGGCTGG - Intronic
941853280 2:170205767-170205789 TTTGGTCAGCAGATGGAGGATGG - Intronic
941918620 2:170828383-170828405 TGGGGACAGCAGAGGGAGGAGGG - Intronic
941918768 2:170829023-170829045 TGAGGACAGCTGAGGGAGGAGGG - Intronic
943593142 2:189822465-189822487 TTGGGTCAGCTGATCGAGACTGG + Intronic
944120807 2:196238720-196238742 AGGAGACAGATGATGGAGGCAGG + Intronic
946411305 2:219516641-219516663 TGGGGCTGGCTGCTGGAGGCTGG - Intronic
947107958 2:226687315-226687337 TGGGGTCAACTTATAGTGGCAGG - Intergenic
948036706 2:234863756-234863778 TGGGGTGAGGTGGTGGGGGCGGG - Intergenic
948121974 2:235537380-235537402 TGGCGTCAGCTCAGGGAAGCAGG + Intronic
948210722 2:236191282-236191304 GTGGGTCAGCTGATGGAGCTGGG + Intergenic
948485835 2:238280174-238280196 TGGGGCCAGCTGTTGGAATCCGG - Intronic
948765734 2:240217755-240217777 TGGGTACAGCTGATGGTGGGTGG - Intergenic
1169121413 20:3098582-3098604 TGGGGGCACCTAATGGAGGCCGG - Intergenic
1169447172 20:5682201-5682223 GGGTGTCAGCTGATCTAGGCAGG + Intergenic
1169785503 20:9355435-9355457 TGGGGTCAGGGGATGGGGGAGGG - Intronic
1170158967 20:13293573-13293595 TGGGGTCAGGTAATGGGGTCAGG + Intronic
1170396267 20:15929109-15929131 ATGGTTCAGCTGATGTAGGCTGG + Intronic
1170433157 20:16295678-16295700 TCCGGTCACCTGATGGTGGCAGG + Intronic
1170825462 20:19790805-19790827 TGGGGTGAAGTGCTGGAGGCTGG - Intergenic
1171115715 20:22523311-22523333 TAGGGTCAGCTGCTTGGGGCTGG - Intergenic
1171266238 20:23774291-23774313 TGTGGGCAGCTCATGAAGGCAGG - Intergenic
1171275991 20:23856938-23856960 TGTGGGCAGCTCATGAAGGCAGG - Intergenic
1171767058 20:29296319-29296341 TGCGGTCAAGAGATGGAGGCGGG + Intergenic
1172882088 20:38208712-38208734 TGGGGCTAGAGGATGGAGGCTGG + Intergenic
1173005023 20:39133636-39133658 TGGGCTCAGCTCATCTAGGCTGG - Intergenic
1173143717 20:40506784-40506806 TGGGGTCACGTGATGCAGCCGGG + Intergenic
1173545491 20:43894685-43894707 GGGAGTGAGCTGAGGGAGGCTGG - Intergenic
1173753313 20:45493566-45493588 GGGGTTCAGCTGATCTAGGCTGG + Intergenic
1174152027 20:48492634-48492656 GGGGGACAGCTGTTGGGGGCAGG + Intergenic
1174865525 20:54131845-54131867 TGGGCTCAGCCAATGGAAGCAGG - Intergenic
1176374670 21:6081085-6081107 TGGGATGGGCAGATGGAGGCGGG + Intergenic
1178660546 21:34504065-34504087 TGAGCTCAGCTGACAGAGGCAGG - Intergenic
1178674055 21:34615465-34615487 TGGTGCCAGCTGAAGGACGCCGG + Intergenic
1178796539 21:35750040-35750062 TGAGCTCAGCTGATGTTGGCTGG - Intronic
1179565957 21:42249185-42249207 TGGGGACATCTGGTGAAGGCAGG + Intronic
1179725817 21:43340729-43340751 AGAGGTGAGCTGAGGGAGGCAGG + Intergenic
1179748805 21:43457160-43457182 TGGGATGGGCAGATGGAGGCGGG - Intergenic
1179792661 21:43764485-43764507 TGGGGACGGCAGATGGAGGGAGG + Intergenic
1181026415 22:20130296-20130318 AGGGTTCAGCTGGTGGAGGAAGG + Intronic
1181514097 22:23401738-23401760 TGGGGAGAGCTCCTGGAGGCAGG + Intergenic
1181722610 22:24787451-24787473 TTGTGTCAGCTGATAGAGCCAGG - Intergenic
1182143305 22:27981058-27981080 TGGGGGCAGCTCACAGAGGCAGG + Exonic
1182804208 22:33057176-33057198 TGGGGACAATGGATGGAGGCCGG - Intronic
1183335757 22:37244920-37244942 TGGGGTCCGCTGATGGAGAAGGG + Intergenic
1183361276 22:37384605-37384627 AGGGGTCAGGTGGGGGAGGCAGG - Intronic
1183545335 22:38452411-38452433 TGGGGGCAGCGGCTAGAGGCAGG - Intronic
1183706178 22:39476129-39476151 TGGGATCAGCTGATGGGGATGGG + Intronic
1183742292 22:39675478-39675500 TTGGGTCTCCTGCTGGAGGCTGG - Intronic
1184099183 22:42332897-42332919 TGGGGGCAGCTGCTGGCAGCAGG + Intronic
1184479897 22:44740281-44740303 TAGGGTCAGCAGATGGGGCCAGG - Intronic
1184561877 22:45268460-45268482 AGGGGTGAGCGGGTGGAGGCGGG - Intergenic
1184742539 22:46437421-46437443 TGAGGTCAGATGCTCGAGGCTGG - Intronic
1184829699 22:46976766-46976788 TGGGAACAACTGGTGGAGGCCGG - Intronic
950358575 3:12433634-12433656 TGTGGTCAGCTGAGGGAGCATGG - Intronic
950497834 3:13344850-13344872 TGGAGCCAGCAGGTGGAGGCTGG - Intronic
952557865 3:34553878-34553900 TGGGGTGTGGTGATGGAGGTGGG - Intergenic
952751315 3:36827171-36827193 TGGGATCAGCTGATGGCTGCTGG + Exonic
953505603 3:43482914-43482936 TGCAGTCAGCTGAGGGAGGAGGG + Intronic
954008962 3:47618056-47618078 TGGTGTCAGCTGTTTGTGGCAGG - Intronic
954669191 3:52278940-52278962 TCGGGTATGCTGCTGGAGGCCGG + Intronic
956485582 3:69718902-69718924 TGGGGCCATCTGCTGGAAGCTGG + Intergenic
956747479 3:72321163-72321185 GGGGTTCAGCTGATCTAGGCTGG + Intergenic
956911831 3:73826168-73826190 TGGGGTTAGGGGATGGAGGATGG + Intergenic
959614756 3:108334815-108334837 TGAGGTCACCTTATGGAAGCTGG + Intronic
961365629 3:126397767-126397789 TGGGGTCAGCTGCAGGAGCTGGG + Intronic
961391213 3:126553248-126553270 TGGGGTGACCTGGGGGAGGCAGG + Intronic
961402710 3:126658310-126658332 TGGAGCCAGCAGATGGAGGCCGG + Intergenic
961444130 3:126970989-126971011 TGGGGGCAGGTGCTGGAGGGAGG + Intergenic
961760056 3:129160804-129160826 TTGTGACAGCTAATGGAGGCAGG + Intronic
961936817 3:130593413-130593435 GGGGTTCAGCCGATTGAGGCTGG + Intronic
962975694 3:140443963-140443985 TGAGGGCAGCTTATGGGGGCTGG - Intronic
963583608 3:147156647-147156669 TGAGGTCAAGAGATGGAGGCTGG + Intergenic
966747863 3:183295578-183295600 GGGGGTCACCTGAGGGAGGTAGG - Intronic
967856281 3:194119913-194119935 TGGGGCCCGATGATGCAGGCTGG - Intergenic
967939772 3:194756867-194756889 TGCGGCCAGCTGCTGCAGGCAGG - Intergenic
968228784 3:196992211-196992233 AGGGATGTGCTGATGGAGGCTGG + Intronic
968722417 4:2217349-2217371 TAAGACCAGCTGATGGAGGCAGG - Intronic
968958995 4:3733375-3733397 AGGGGTCAGCTGCTGGGGCCTGG - Intergenic
970378301 4:15480700-15480722 TGGGGACAGCAGTTGGTGGCTGG - Exonic
972992600 4:44840391-44840413 TAGGGTCTGTTGATGGAGACAGG - Intergenic
975779155 4:77820293-77820315 TGGGGTGAGGGGAAGGAGGCGGG + Intergenic
978770840 4:112455239-112455261 AGGGGTCAGCTAATTGAGTCAGG + Intergenic
980217962 4:129876339-129876361 TGGAGTCAACTGAGGCAGGCAGG + Intergenic
980566749 4:134552323-134552345 TGGGGTCAGCTGGTGGAATTTGG + Intergenic
981182632 4:141763811-141763833 TGGGGCCAGGTGATGGAGGATGG + Intergenic
983343997 4:166502840-166502862 TGTGGCCAGCTCATGCAGGCAGG - Intergenic
984067932 4:175072748-175072770 ATGTGGCAGCTGATGGAGGCAGG + Intergenic
984165125 4:176296781-176296803 TGAGTACAGCTGAAGGAGGCGGG + Intergenic
985057136 4:186045922-186045944 TGAGTACAGCTGAAGGAGGCAGG + Intergenic
987157382 5:15103528-15103550 TGGCCTCAGCTGATAGAAGCAGG - Intergenic
989153051 5:38319139-38319161 GGGGGTCTGCTGAAGGAGACAGG - Intronic
989234879 5:39135237-39135259 TGGGGTCAGGAGAGTGAGGCAGG + Intronic
989843604 5:46111809-46111831 TGGAGTCTACTGATGCAGGCAGG + Intergenic
991017091 5:61943961-61943983 TGGGGTCTGCAACTGGAGGCTGG + Intergenic
991173122 5:63652108-63652130 TGGGGGCAGATAATGGAGGAAGG + Intergenic
991216326 5:64160527-64160549 TGGTGTCTGGAGATGGAGGCTGG - Intergenic
992961094 5:81957273-81957295 TGAGTTCAGCTGAAGGAGCCAGG - Intergenic
993023341 5:82618178-82618200 TGGGGTGAGGGGATGGAGGAGGG + Intergenic
993170388 5:84412024-84412046 GGGGTTCAGCTAATGTAGGCTGG - Intergenic
996776332 5:127136407-127136429 TGGGGTCAGCTGATGGGATTGGG + Intergenic
997380152 5:133429814-133429836 TGGAGTGAGCTGATGGATTCTGG - Intronic
998137407 5:139681504-139681526 TGGGGTCAGGGGATGGGGGTGGG - Intronic
999677842 5:154023136-154023158 TGGGGTCAGGGGATGGGGGAGGG + Intronic
1001031236 5:168264890-168264912 TGGGGTAAGTTGATGTAGTCTGG - Intergenic
1002465865 5:179408118-179408140 TGGGCTCAGGTGGGGGAGGCAGG - Intergenic
1002978133 6:2106646-2106668 TGAGGTCAGGAGATGGAGACCGG + Intronic
1003185179 6:3824156-3824178 TGGGGTCAGCTTCAGCAGGCTGG - Intergenic
1003429952 6:6029724-6029746 TGAGGACAGCTGAAGGAGCCGGG + Intergenic
1005928977 6:30466642-30466664 TGGAGCCAGCTGGGGGAGGCGGG - Intergenic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006096112 6:31657833-31657855 TGATGTCACCTGAGGGAGGCAGG + Intronic
1006774682 6:36583048-36583070 TGGGGTCAGCAAACGAAGGCTGG - Intergenic
1006789829 6:36692630-36692652 TGGAGTCAGTAGCTGGAGGCAGG + Intergenic
1007429495 6:41768551-41768573 AGGGGTCACCTGCTGCAGGCTGG - Intergenic
1008973603 6:57399181-57399203 TGGGGTCAGGGGATGGAGGAGGG - Intronic
1009162499 6:60300733-60300755 TGGGGTCAGGGGATGGAGGAGGG - Intergenic
1010171259 6:72978818-72978840 TGGGGTCAGGGGATGGGGGAGGG - Intronic
1011560115 6:88605686-88605708 AGAGGTCAGCGGATGGAGCCTGG + Intergenic
1012924115 6:105250357-105250379 TGGGGTCGGGGGATGGAGGAGGG + Intergenic
1012986719 6:105883806-105883828 AGGGGTCATATGATGCAGGCTGG + Intergenic
1015745983 6:136510257-136510279 TGGGCTCAGCTGATGGTGAGAGG + Intronic
1016265440 6:142227685-142227707 TGGGGCCTGCTGATGGTGGAAGG - Intergenic
1016316391 6:142792954-142792976 TGAGGTCTGCTGATGGGAGCAGG + Intronic
1016858166 6:148692882-148692904 TGGGATCAGCTGCTGGAGATGGG + Intergenic
1018387957 6:163321977-163321999 GGGGGTCAGCTGGGGGAGCCAGG - Intergenic
1018399778 6:163411414-163411436 TGGGGTAAGCAGATGGAAGAAGG + Intergenic
1018952658 6:168389246-168389268 TGGGGTCAGGTGAGGAGGGCAGG - Intergenic
1019268807 7:134416-134438 TGGGGTCAGCTGACGGAGACTGG - Intergenic
1019327388 7:445152-445174 TGGGGTCAGCTGATGTGGGCTGG + Intergenic
1019688842 7:2398387-2398409 GGGGATCAGCTGAAGGAGGAAGG - Intergenic
1020108190 7:5432440-5432462 TGGGGCCAGGTGAGGAAGGCAGG - Intronic
1021119099 7:16777795-16777817 TAGGGTCAGCTTCTGGAGGTTGG + Exonic
1021993216 7:26155975-26155997 TGGGGACAGGTGAAGGAGGGTGG - Intronic
1022501890 7:30887120-30887142 TGGGGGTAGCTGAGGGAGGCGGG - Intronic
1023131841 7:37011327-37011349 TGGGCACAGCTGGTGGAGGGAGG - Intronic
1024513409 7:50220952-50220974 TGGGGTAAGAAAATGGAGGCTGG - Intergenic
1025200136 7:56956814-56956836 TGTGGGCAGCAGCTGGAGGCAGG + Intergenic
1025671808 7:63620118-63620140 TGTGGGCAGCAGCTGGAGGCAGG - Intergenic
1026829868 7:73603882-73603904 TGTGGTCAGGAGAGGGAGGCAGG + Intronic
1026956141 7:74377447-74377469 TGGGTTCAGCTGAAGGAAGAAGG - Intronic
1026987241 7:74562218-74562240 TGGGGTCTGCTGGGGGAGGCAGG + Intronic
1027606466 7:80305825-80305847 AAGGGTGAGCTGTTGGAGGCAGG + Intergenic
1028244384 7:88459409-88459431 TGGTGTGAGATGAGGGAGGCAGG - Intergenic
1028638325 7:93015978-93016000 TGGGGTTGGTTGATGGAGGATGG - Intergenic
1028690397 7:93643633-93643655 TGGGTACAGCTGAAGGAGCCGGG - Intronic
1030650827 7:112114164-112114186 TGGGGATAGCTCAAGGAGGCAGG - Intronic
1031666186 7:124485342-124485364 GGGAGTCAGCTGATCTAGGCTGG + Intergenic
1032322468 7:130897627-130897649 GCGGGTCATCTGAGGGAGGCTGG + Intergenic
1032365306 7:131293284-131293306 TGGGCTCAGCTGATTTTGGCTGG - Intronic
1032597137 7:133253179-133253201 TGTGATCAGGTGAGGGAGGCAGG + Exonic
1033555027 7:142481828-142481850 TGGGGTCAGCTTCTGAAGGCAGG + Intergenic
1033888088 7:145972546-145972568 TGGGGTCGGGGGATGGAGGAGGG + Intergenic
1034386923 7:150747884-150747906 TGGGGTCAGGTGATGGGAGCGGG - Intronic
1035118461 7:156544986-156545008 AGGGGTCAGCCGATCTAGGCTGG + Intergenic
1035125359 7:156605045-156605067 TGGGTGCGGGTGATGGAGGCTGG - Intergenic
1035768317 8:2126687-2126709 TGAGGGAGGCTGATGGAGGCTGG + Intronic
1035768325 8:2126718-2126740 TGGGGGAGGCTGATAGAGGCTGG + Intronic
1036694963 8:10968232-10968254 TGGGGGCAGCTGACGGAGGACGG - Intronic
1037088347 8:14880803-14880825 TGGGGTCAGGGGATGGGGGTGGG + Intronic
1038713596 8:29972027-29972049 GGGGCTCAGCTGATGTAGGCTGG - Intergenic
1039162485 8:34638361-34638383 TGACCTCAGCTGATGGATGCTGG + Intergenic
1039825999 8:41174546-41174568 TGAGGTCAGATGTTGGAGACCGG - Intergenic
1041142972 8:54842782-54842804 TGGGGGCAGCAGGTGGTGGCGGG - Intergenic
1042001490 8:64127532-64127554 TGGAGTCTGATGATGGAGGGCGG + Intergenic
1044605855 8:94046643-94046665 TGGGGTTGTGTGATGGAGGCAGG - Intergenic
1044958744 8:97508478-97508500 GGGAGTCAGCTGATCTAGGCTGG + Intergenic
1045016240 8:98003820-98003842 TGGGGTCCACTCATGGGGGCGGG + Intronic
1045409916 8:101906553-101906575 TGGGGTCAGCAAACGGTGGCTGG - Intronic
1045491740 8:102675387-102675409 TGGGCTCAGATGAGGAAGGCAGG + Intergenic
1048573339 8:135672495-135672517 TGGGGCCAGCTGGTGCAGGTTGG - Intergenic
1048878833 8:138857142-138857164 TGGGGTCAGCAGATAGAGGTAGG - Intronic
1049687360 8:143944297-143944319 TGGGGACAGCAGGGGGAGGCTGG - Intronic
1049780228 8:144425503-144425525 TGGGGGCTGGTGAGGGAGGCGGG - Intronic
1053171794 9:35892308-35892330 TAGGGTCTGATGCTGGAGGCTGG + Intergenic
1055587395 9:77769453-77769475 TGGGCACAGCTGCTGGAGGAAGG + Intronic
1057553163 9:96066851-96066873 TGGGGACAGCTGAGGGGGGCTGG + Intergenic
1058342153 9:103911621-103911643 TGGGGTAAACTGATGGATTCAGG + Intergenic
1058632106 9:106999972-106999994 TGGGGTGAGCTCTTGAAGGCGGG + Intronic
1058869666 9:109191065-109191087 TGGGGGAAGCAGATGGAGGGAGG + Intronic
1059084582 9:111286416-111286438 TAGGATCAGCTGGTGGCGGCGGG + Intergenic
1059458047 9:114412152-114412174 TGGATTCAGCAGATGGAGTCTGG - Intronic
1059703397 9:116797471-116797493 TGAGGACAGCAGTTGGAGGCTGG - Intronic
1060102310 9:120851389-120851411 AGAGTGCAGCTGATGGAGGCTGG - Intergenic
1060677049 9:125524751-125524773 GGGAGTCAGCTGAAGGAGACAGG - Intronic
1061175436 9:128993183-128993205 TGGGGCCACCTGGTGGAGACCGG - Exonic
1061425131 9:130493784-130493806 TAGCCTCTGCTGATGGAGGCTGG - Intronic
1061536389 9:131252714-131252736 TGCGGTCATGTGACGGAGGCCGG - Intergenic
1061976572 9:134070997-134071019 TGAGGTTTGCAGATGGAGGCTGG - Intergenic
1062007655 9:134249317-134249339 TGGGGGCAGCTGATGGCTGGAGG + Intergenic
1062286882 9:135777314-135777336 TGGGGGCAGATGCTGGAGTCAGG - Intronic
1062623467 9:137432975-137432997 GGCGGTCAGGTGCTGGAGGCCGG - Intronic
1062703152 9:137918614-137918636 TGAGCACAGCTGCTGGAGGCTGG - Intronic
1203745069 Un_GL000218v1:36956-36978 AGGGGTCAGCTGTGGGAGGGTGG - Intergenic
1203565039 Un_KI270744v1:82528-82550 AGGGGTCAGCTGTGGGAGGGTGG + Intergenic
1186735840 X:12463070-12463092 TGTGGTAAGCTGAGGGAGGATGG + Intronic
1187675043 X:21707878-21707900 TGGGCTCAGCTGATCTTGGCTGG - Intronic
1187706330 X:22013172-22013194 GGGGTTCAGCTGATCTAGGCTGG + Intergenic
1187739828 X:22343546-22343568 TGGGGTCAGCTGATCTGGGCTGG + Intergenic
1188256391 X:27966361-27966383 TGGGTTCACCTAATGTAGGCTGG + Intergenic
1189799104 X:44675611-44675633 TGGGCTCAGCTGAGGTTGGCTGG - Intergenic
1189799108 X:44675631-44675653 TGGGGTCAGCTGGTGTGGGCTGG - Intergenic
1192709261 X:73563108-73563130 GGGGGGCGGCTGCTGGAGGCGGG - Intergenic
1193583610 X:83294269-83294291 TGGGGTCATGTGAAGGAGCCAGG - Intergenic
1195587211 X:106578741-106578763 TGGAGTCTACAGATGGAGGCAGG + Intergenic
1198066920 X:133107248-133107270 TGTGGTTAGCTGACTGAGGCAGG + Intergenic
1199849768 X:151717124-151717146 TGGGATCAGCTGATGGACAGTGG + Intronic
1201746053 Y:17375202-17375224 TGGGGTCAGGGGATGGGGGAGGG - Intergenic