ID: 929031014

View in Genome Browser
Species Human (GRCh38)
Location 2:37649779-37649801
Sequence GCTTCATGTCGGTGGCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 72}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929031005_929031014 12 Left 929031005 2:37649744-37649766 CCAACCAGAGGCTCACTCATCCT 0: 1
1: 0
2: 1
3: 11
4: 144
Right 929031014 2:37649779-37649801 GCTTCATGTCGGTGGCATGGAGG 0: 1
1: 0
2: 0
3: 8
4: 72
929031006_929031014 8 Left 929031006 2:37649748-37649770 CCAGAGGCTCACTCATCCTGCTT 0: 1
1: 0
2: 0
3: 23
4: 179
Right 929031014 2:37649779-37649801 GCTTCATGTCGGTGGCATGGAGG 0: 1
1: 0
2: 0
3: 8
4: 72
929031003_929031014 22 Left 929031003 2:37649734-37649756 CCAGGGGCCTCCAACCAGAGGCT 0: 1
1: 0
2: 2
3: 40
4: 305
Right 929031014 2:37649779-37649801 GCTTCATGTCGGTGGCATGGAGG 0: 1
1: 0
2: 0
3: 8
4: 72
929031004_929031014 15 Left 929031004 2:37649741-37649763 CCTCCAACCAGAGGCTCACTCAT 0: 1
1: 0
2: 0
3: 24
4: 230
Right 929031014 2:37649779-37649801 GCTTCATGTCGGTGGCATGGAGG 0: 1
1: 0
2: 0
3: 8
4: 72
929031001_929031014 28 Left 929031001 2:37649728-37649750 CCAGCACCAGGGGCCTCCAACCA 0: 1
1: 0
2: 0
3: 20
4: 232
Right 929031014 2:37649779-37649801 GCTTCATGTCGGTGGCATGGAGG 0: 1
1: 0
2: 0
3: 8
4: 72
929031010_929031014 -8 Left 929031010 2:37649764-37649786 CCTGCTTGAAGTGGGGCTTCATG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 929031014 2:37649779-37649801 GCTTCATGTCGGTGGCATGGAGG 0: 1
1: 0
2: 0
3: 8
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929031014 Original CRISPR GCTTCATGTCGGTGGCATGG AGG Intronic
900758172 1:4451865-4451887 GCTTCATGTGGATGGCCTGCAGG + Intergenic
900949304 1:5848937-5848959 ACTGCATGTCAGTGGCTTGGAGG + Intergenic
901037150 1:6343249-6343271 GCTGCATGTCGGTGCTTTGGGGG - Intronic
913478556 1:119262619-119262641 GCAGCATGTGTGTGGCATGGTGG - Intergenic
915785464 1:158606828-158606850 GATTCATGTGGCTGGCATAGTGG - Exonic
920179313 1:204122746-204122768 GCCTCATGGGAGTGGCATGGCGG + Intronic
922519143 1:226232094-226232116 TATTCATGTCGGTGGCAGTGTGG - Exonic
1064188293 10:13183058-13183080 GCTTCATGGGGTTGGCATTGAGG - Exonic
1069589421 10:69632639-69632661 GATTCTTATGGGTGGCATGGGGG + Intronic
1070712835 10:78695925-78695947 GCTCCACGTCGGTGGCAGGAGGG + Intergenic
1070716825 10:78728615-78728637 GCCTCATGTAGGTGGGATTGTGG - Intergenic
1074418251 10:113286211-113286233 CCCCCATGTCGGTGTCATGGGGG - Intergenic
1076202698 10:128570942-128570964 GCTTCGTGAAGATGGCATGGGGG + Intergenic
1076759665 10:132596220-132596242 GCTACATGGACGTGGCATGGCGG + Intronic
1079315965 11:19408073-19408095 GCTTCATTACAGTGGCATTGGGG - Intronic
1079874452 11:25839120-25839142 GGTACATGTCTGTGGCACGGGGG + Intergenic
1081781547 11:45716568-45716590 GAGTCATGGTGGTGGCATGGGGG - Intergenic
1092061370 12:5553660-5553682 GCTCCTAGTAGGTGGCATGGTGG + Intronic
1096079737 12:48825427-48825449 GCATCATGTCTGTGACCTGGGGG - Exonic
1096194413 12:49640544-49640566 GAGTCATGGAGGTGGCATGGGGG + Exonic
1099100959 12:78439743-78439765 GCTTCCTGTTGGGGGGATGGAGG + Intergenic
1102458642 12:113086916-113086938 GCTTCAGGTGGGGGGCAGGGTGG - Intronic
1102772920 12:115494198-115494220 GTTTCATGTAGGTGGCAAAGTGG + Intergenic
1113744110 13:112730850-112730872 GCAGCAGGTCGGTGGCAGGGTGG + Intronic
1122287877 14:100663050-100663072 GCTTCATGGCTTTGGCCTGGTGG + Intergenic
1130285786 15:82553353-82553375 GCTGCATGTTGGTAACATGGTGG - Intronic
1135502245 16:23006565-23006587 TCTTCATGTTGGTGGCAGGAGGG + Intergenic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1148343737 17:46889682-46889704 GCTTGGTGTCTGTGGCAAGGAGG - Intergenic
1151893361 17:76964110-76964132 GCTCCATGAGGGTGACATGGTGG + Intergenic
1155202887 18:23533034-23533056 CCTTCATCTCAGTGGCAGGGAGG + Intronic
1155582983 18:27332603-27332625 GCTTCACCTGGGTGGGATGGGGG - Intergenic
1157221321 18:45830062-45830084 GCTGCTTGTCGGTTTCATGGCGG - Intronic
1160624854 18:80196697-80196719 GCTTCATGTGGGCGCCCTGGAGG + Intronic
1166308103 19:41946655-41946677 GCTTCATGTCTATGACATGGAGG - Intergenic
1168126521 19:54286357-54286379 GCTTCATGTAGGTGGGATGTGGG - Intergenic
1168175372 19:54624506-54624528 GCTTCATGTAGGTGGGATGTGGG + Intronic
929031014 2:37649779-37649801 GCTTCATGTCGGTGGCATGGAGG + Intronic
929491498 2:42400541-42400563 GCTTCAGGTGGGTGACAAGGAGG - Intronic
933498538 2:83082746-83082768 GCTTCATTTCAGTTGGATGGTGG - Intergenic
945190020 2:207178344-207178366 CCTTCAGGTGGGTTGCATGGGGG - Intergenic
1171009616 20:21501668-21501690 GTTTCATGTCAGGGTCATGGTGG - Intergenic
1180191703 21:46168455-46168477 GCTTCCTGTCGGTGCCTCGGTGG + Exonic
1182341761 22:29628291-29628313 GATTCATGTATGTGGCATTGGGG + Intronic
1183313399 22:37123938-37123960 GCGTCAGGTCTGTGGCACGGAGG + Intergenic
1184094001 22:42306663-42306685 GCTCCATCCCAGTGGCATGGGGG - Intronic
1184637392 22:45844376-45844398 GCTTCATGCCTCTGTCATGGGGG + Exonic
1184656448 22:45944317-45944339 CCTTCCTGGGGGTGGCATGGAGG - Intronic
954540668 3:51391384-51391406 GCTTCATGGCGCTGGCGCGGCGG - Exonic
955049923 3:55400569-55400591 TCTTCCTGTTGTTGGCATGGAGG - Intergenic
955124075 3:56092265-56092287 TCTTCAAGTAGGTGGCATGTGGG - Intronic
961595210 3:128010425-128010447 GCATCATGTTGGTTGCATGTTGG + Intergenic
962288271 3:134106735-134106757 CCTTCATGCCAGGGGCATGGAGG - Intronic
972126177 4:35769254-35769276 GTTTCATGTAAGTGACATGGAGG - Intergenic
985024186 4:185723241-185723263 GCTTCTTGCTGGTAGCATGGTGG + Intronic
985776470 5:1846640-1846662 CCTTCATGTTGGGGGCCTGGAGG + Intergenic
991625205 5:68594049-68594071 GGTACCTGTCTGTGGCATGGTGG - Intergenic
1005665158 6:28045097-28045119 GCTTCAACTGGGTGCCATGGTGG + Intergenic
1006717922 6:36131843-36131865 GTTTCCTGTCTGTGACATGGGGG - Intronic
1006750496 6:36373691-36373713 GCTTCATGCCGATGGCAAAGGGG + Intronic
1007459914 6:42010404-42010426 GCTTCATGTGGCTGGGTTGGGGG + Intronic
1007733070 6:43962976-43962998 GATTCATGATGGTGGCCTGGGGG + Intergenic
1008483433 6:52009872-52009894 GGTTCATCTCTGTGCCATGGGGG - Intronic
1010685095 6:78845147-78845169 GCTTCATGGTGGTGGCATTGTGG - Intergenic
1019306373 7:337225-337247 GCTTCATGTCTGTGGCATTTAGG - Intergenic
1019348328 7:541359-541381 GCTTCCTGTGGGTGGGGTGGGGG - Intergenic
1024541734 7:50480296-50480318 GCTTCATGATGCTGGGATGGTGG + Intronic
1025218852 7:57086782-57086804 GCTACATGTCGGAGGCTGGGAGG + Intergenic
1025629773 7:63260370-63260392 GCTACATGTCGGAGGCTGGGAGG + Intergenic
1025936841 7:66044455-66044477 GCTTCATGCCGGGAGCTTGGCGG + Intergenic
1028112972 7:86965144-86965166 GCTTGGTGTGGGTGGGATGGGGG - Intronic
1030618156 7:111760226-111760248 GCTGCATGGCGATGGCATGGGGG + Exonic
1033588967 7:142795187-142795209 GCTCCATGCTGGTTGCATGGAGG - Intergenic
1034341264 7:150357553-150357575 GTTTCCTGTCGGTGGCATGTGGG - Intergenic
1041045231 8:53881366-53881388 GCTTCGCGTCGGTGTCTTGGTGG + Intronic
1045365958 8:101476459-101476481 GCAACAAGTCAGTGGCATGGGGG - Intergenic
1047567914 8:126066369-126066391 CGTTCGTGTCGGTGGCAGGGTGG + Intergenic
1050231993 9:3536303-3536325 GCTCCATGTGTGTGGCTTGGTGG - Intergenic
1055149777 9:72982536-72982558 GCTTCATGATGATGGCATAGAGG + Intronic
1058837857 9:108875605-108875627 ACTTAATGTGGGAGGCATGGTGG + Intronic
1189886665 X:45553509-45553531 GCTTCACGTTGGAGGCATGGAGG - Intergenic