ID: 929033351

View in Genome Browser
Species Human (GRCh38)
Location 2:37669560-37669582
Sequence CTGCTCAGATTGAGGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929033348_929033351 3 Left 929033348 2:37669534-37669556 CCATAGAGATACGTGAAACAATT 0: 1
1: 0
2: 0
3: 10
4: 136
Right 929033351 2:37669560-37669582 CTGCTCAGATTGAGGGAAAGAGG 0: 1
1: 0
2: 1
3: 28
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929033351 Original CRISPR CTGCTCAGATTGAGGGAAAG AGG Intronic
901790047 1:11649226-11649248 CTGCTCAGAGGGAGGGAGCGAGG + Intronic
902131834 1:14268501-14268523 CAGCACAGATTGAGAGGAAGGGG + Intergenic
903376167 1:22867524-22867546 CTGCTCAGATTGGGGTCCAGAGG + Intronic
903829282 1:26164913-26164935 GTTCTGAGATTGAGGGAAAGGGG + Intergenic
904299407 1:29544397-29544419 CTGCCCAGATTCAAGGTAAGGGG - Intergenic
905503729 1:38459821-38459843 CTGCTCAGGTAGTGGGAAGGAGG - Intergenic
906303765 1:44703220-44703242 CTACTCTGATTGGGGGAGAGAGG - Intronic
907603195 1:55790389-55790411 CTCTTCAGATTGAGGGAGAAAGG + Intergenic
908617325 1:65936763-65936785 CTGCTGAGAATAAGGGAAAGTGG + Intronic
909257839 1:73447707-73447729 CTGCTCAAAATGAGAGAAATTGG + Intergenic
910012769 1:82486116-82486138 TTGCTCAGACTGAAGGACAGTGG - Intergenic
911521689 1:98937371-98937393 CTGCTCAGATTCAGAGGGAGGGG - Intronic
912745354 1:112241302-112241324 CTGCTCAGAATGAGGGCTTGGGG - Intergenic
912802992 1:112733008-112733030 CTGCTCACATTGTGGGGAAGAGG - Intergenic
913563479 1:120047125-120047147 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
914284073 1:146206489-146206511 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914545104 1:148657228-148657250 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
915570486 1:156742900-156742922 CTGCCTAGATTCAGGGAAAGTGG - Intronic
915590092 1:156865782-156865804 CTGCTCATATTGGGGGACAGGGG - Intronic
915836268 1:159178371-159178393 TTGCTAAGGTTGAGGGAAAAGGG - Intronic
916062793 1:161112460-161112482 CTGCTCAGACTGGTGAAAAGTGG + Intronic
917198370 1:172490318-172490340 CTGCTCAGTTGGTGGGGAAGGGG + Intergenic
918119114 1:181522118-181522140 CTCCTCAGAATTAGGGAAATAGG + Intronic
920043032 1:203116245-203116267 CTGCTCAGACCGAGGGGAACAGG + Intronic
920160946 1:203997270-203997292 CTGATAAGATTGAGGGCAACTGG - Intergenic
920215316 1:204358613-204358635 GTGATCAGATTGAGGGTAAAGGG + Intronic
923339045 1:232992446-232992468 CTGCACAGATGGAGGGCAGGAGG + Intronic
924813149 1:247420877-247420899 CTGCTGAGATTCAGATAAAGAGG - Intronic
1063148022 10:3314071-3314093 CTTCACAGAGTGAGGGAAGGGGG + Intergenic
1063148033 10:3314125-3314147 CTTCACAGAGTGAGGGAAGGGGG + Intergenic
1063148047 10:3314211-3314233 CTTCACAGAGTGAGGGAAGGGGG + Intergenic
1063148053 10:3314240-3314262 CTTCACAGAGTGAGGGAAGGGGG + Intergenic
1063148097 10:3314498-3314520 CTTCACAGAGTGAGGGAAGGGGG + Intergenic
1063148103 10:3314527-3314549 CTTCACAGAGTGAGGGAAGGGGG + Intergenic
1063148124 10:3314639-3314661 CTTCACAGAGTGAGGGAAGGGGG + Intergenic
1063148140 10:3314726-3314748 CTTCACAGAGTGAGGGAAGGGGG + Intergenic
1063577911 10:7278556-7278578 CTGCCCAGCTTGCTGGAAAGGGG - Intronic
1065484797 10:26227379-26227401 CAGCTCTGAGTGAGAGAAAGAGG - Intronic
1065853905 10:29814324-29814346 CTGCTCATAAGGAGGCAAAGAGG + Intergenic
1067323267 10:45242398-45242420 CTGATCACATTGAGGTGAAGTGG + Intergenic
1067844420 10:49708624-49708646 CAGGACAGATTGTGGGAAAGGGG + Exonic
1070156102 10:73836562-73836584 ATGCAGAGAATGAGGGAAAGAGG + Intronic
1070315760 10:75310822-75310844 CTGCTCTGGTTGGGGGAGAGAGG - Intergenic
1070798424 10:79230635-79230657 CTGCACAGACGGCGGGAAAGTGG + Intronic
1071530301 10:86385889-86385911 CAGCCCAGATTCAAGGAAAGGGG - Intergenic
1071598434 10:86944206-86944228 CTGGTCACATTGAGGGGAGGAGG - Intronic
1074197695 10:111203743-111203765 CTGCTCTGAATGAGGAAGAGGGG + Intergenic
1075742008 10:124701691-124701713 CTGGCCAGAGTGGGGGAAAGGGG + Intronic
1075807574 10:125201287-125201309 ATGCACAGAGTGAGAGAAAGAGG + Intergenic
1077067125 11:646556-646578 CTGTGCAGATGGAGGGAGAGAGG + Intronic
1077528545 11:3083750-3083772 CTGAGCAGATTGGGGGACAGGGG + Intergenic
1077737898 11:4810756-4810778 CTGTTCAGATTGAGTGAAGAGGG - Intronic
1077986162 11:7353300-7353322 CTGCCCATATTGCAGGAAAGTGG - Intronic
1078137653 11:8665137-8665159 CTGCCCAGATTCACAGAAAGAGG + Intronic
1079981967 11:27160673-27160695 CTGCTCAGATTCAAGGGGAGGGG - Intergenic
1081740248 11:45434555-45434577 CTGCACAGTCTGAGAGAAAGTGG - Intergenic
1081940786 11:46939701-46939723 CTGGGCAGATGGAGGCAAAGGGG - Intronic
1084595988 11:70117434-70117456 ATGCTCAGAGTGAGGGGTAGAGG - Intronic
1084639477 11:70416005-70416027 CTGCCCAGATGAAGGGAAGGCGG - Intronic
1084977327 11:72809189-72809211 CAGCCCAGATTGAAGGAGAGGGG - Intergenic
1085237219 11:75024336-75024358 CTGCAGAAACTGAGGGAAAGTGG + Intergenic
1087848233 11:102997674-102997696 CTTCTCAGGTAGAAGGAAAGGGG + Intergenic
1088470574 11:110184521-110184543 CTGCTCTGACTGATGGAAATCGG + Intronic
1088950178 11:114560617-114560639 TTGCTCTGAGTTAGGGAAAGGGG + Intergenic
1090141778 11:124273031-124273053 CTGCTCACATTGTAGGGAAGGGG + Intergenic
1090238875 11:125167546-125167568 CTGCTCAGAATAAGGGGCAGGGG + Intronic
1090288816 11:125523903-125523925 GTGATCAGGCTGAGGGAAAGAGG - Intergenic
1091234505 11:134011846-134011868 ATGCCCAGATTCAGGGATAGGGG + Intergenic
1093436479 12:19140672-19140694 ATGTTCAGATTTAGGTAAAGAGG - Intronic
1096386013 12:51195961-51195983 CTGCTAAGAGTGAGGTACAGGGG - Exonic
1096672027 12:53205782-53205804 CTGCACAGAGTGTGGGAAAGGGG + Intronic
1097284732 12:57868755-57868777 AAGCTGAGATGGAGGGAAAGGGG - Intergenic
1098881103 12:75918442-75918464 CAGCTCAAAATGAGCGAAAGAGG - Intergenic
1099837130 12:87920953-87920975 TTGCTCAGATGCAGGGTAAGAGG - Intergenic
1101804327 12:108050412-108050434 CAGTTCAGATTGAGGGACAGTGG - Intergenic
1102200341 12:111053643-111053665 CAGCGCAGAGTCAGGGAAAGAGG - Intronic
1106987070 13:35366666-35366688 CTGCTTACATTGGGGGAAAGAGG - Intronic
1107224881 13:38036608-38036630 CTGCATAGACTGAGGGAGAGAGG - Intergenic
1110364832 13:74670040-74670062 CTGCAAAGAAAGAGGGAAAGGGG - Intergenic
1111121355 13:83855114-83855136 CTTCTCAGATGGAAGGAAAAGGG - Intergenic
1111197020 13:84888277-84888299 CTCCTGAGATTGAGGGAGTGCGG - Intergenic
1112385277 13:98933787-98933809 CAGCCCAGATTCAGGGAGAGGGG - Intronic
1117483609 14:56172437-56172459 CAGCCCAGATTTAGGGAGAGGGG + Intronic
1119078313 14:71667249-71667271 TTCATCAGATGGAGGGAAAGGGG - Intronic
1119628842 14:76208485-76208507 CTGCTAAGATTGAGAGAAGGTGG - Exonic
1124468997 15:29966849-29966871 CTTCTCAGATTGATGGTATGTGG - Intronic
1124722222 15:32120300-32120322 CAGCTCAGAGGGAGGGAAAGGGG - Intronic
1124783293 15:32656145-32656167 AAGCTCAGACTGAAGGAAAGAGG - Intronic
1126370392 15:47939747-47939769 CTGCTCAGATGCAAGGAGAGGGG + Intergenic
1127856909 15:62960824-62960846 TTTCTCAGATTGAGGGGAAGAGG + Intergenic
1128932337 15:71716741-71716763 CTGCTTGGTTTGAGGGAAAAAGG - Intronic
1128985853 15:72220790-72220812 TTCCTCAGATTTAGGGAAGGGGG - Intronic
1129598599 15:76983853-76983875 CTGCTCAGCTGCAGGGAGAGAGG - Intergenic
1129857990 15:78838625-78838647 CTGCTCAGGCTAAGGGAATGAGG - Intronic
1132793128 16:1704813-1704835 TGGCTCAGAATGGGGGAAAGGGG + Intergenic
1133083013 16:3338441-3338463 CTGGGCAGATTGGGGGAAAGGGG + Intergenic
1133125903 16:3645891-3645913 CTGCTCAGGTTGTGGGACATGGG + Intronic
1133338854 16:5023800-5023822 CAGCTCAGATTCAGGGAGAAGGG - Intergenic
1133699960 16:8299605-8299627 CTGCACAGGGTGGGGGAAAGGGG + Intergenic
1137434199 16:48442227-48442249 CTGCTCAGAGTGAGAGACTGCGG - Intronic
1137811058 16:51352885-51352907 CAGCTCACATTCAAGGAAAGGGG + Intergenic
1138587049 16:57977368-57977390 CTGCTCAGACTGAAGTACAGTGG - Intronic
1139734165 16:68973034-68973056 CTGCTCATATTCAGGGAAGAAGG + Intronic
1139749392 16:69100012-69100034 CTGCTCTGCTGGAGGCAAAGCGG - Intergenic
1140330961 16:74056429-74056451 CAGATCACATTGAAGGAAAGGGG - Intergenic
1141218482 16:82046955-82046977 GTGCTCCCCTTGAGGGAAAGGGG + Intronic
1141248070 16:82329334-82329356 CTGCTATGTTTGAGGGAAAGTGG + Intergenic
1143522894 17:7455588-7455610 CTGCTCACTTTGAGGGGAGGTGG + Intronic
1144054757 17:11530035-11530057 CTGCTCAGGGTGAGGGGAAATGG + Intronic
1144279886 17:13715600-13715622 CTGCCTAGTTTGAGGAAAAGAGG - Intergenic
1147288174 17:39419779-39419801 CTGATCAGATTTAGGATAAGAGG + Exonic
1147595084 17:41711921-41711943 GGGCTTAGATTCAGGGAAAGTGG - Intergenic
1147615535 17:41825157-41825179 CTGCTCTGATTCAGGGGATGTGG - Intergenic
1147907824 17:43834046-43834068 CTGCTGGGATTGAGGGAAGGGGG - Intergenic
1147996287 17:44362139-44362161 GAGCCCAGGTTGAGGGAAAGGGG - Intronic
1149063870 17:52457352-52457374 CTGCTGAGGTTGTGGGAAAATGG + Intergenic
1149098431 17:52872846-52872868 GTGCTCCGAGTGAGGGCAAGAGG - Intronic
1155937443 18:31768286-31768308 CAGCTCATATTCAAGGAAAGAGG + Intergenic
1156795230 18:41036618-41036640 CTGCTCAGAGTGAAGGACAGGGG + Intergenic
1157288176 18:46391605-46391627 CAGCTCAGGGTGAGGGAAGGTGG - Intronic
1157502542 18:48201611-48201633 CTGGAAAGATGGAGGGAAAGAGG - Intronic
1160068182 18:75597893-75597915 CTGCTCACATTGGTGGAAACTGG + Intergenic
1160914757 19:1491175-1491197 CGGCTCAGGCTGCGGGAAAGCGG + Exonic
1161575326 19:5051653-5051675 CTGCTCAGGCTTAGGGAAGGGGG + Intronic
1162011565 19:7819260-7819282 CTGCTCAGATTCAAGGGGAGGGG - Intergenic
1162250165 19:9435721-9435743 CTGCTCACCTTGAGGGATGGAGG + Intergenic
1162456293 19:10786911-10786933 GTGCTCAGAATGGGGGGAAGTGG + Intronic
1163642671 19:18470351-18470373 CTGCTCAGGTTGGGGTAGAGGGG + Intronic
1164286525 19:23822189-23822211 CTGCAATGATTGAGGGAAGGTGG - Intronic
1164712986 19:30372211-30372233 TTGGTCATTTTGAGGGAAAGGGG + Intronic
1165662828 19:37597268-37597290 CTCTTCTGATTGAGGGAAATGGG + Intronic
1167253449 19:48413968-48413990 CTGCCCAGGAGGAGGGAAAGGGG - Intronic
1167288016 19:48609810-48609832 CTGAGCACACTGAGGGAAAGTGG + Intronic
1167527505 19:49994181-49994203 CTGCTGTGATTGAGAGTAAGAGG - Intronic
1167884138 19:52486580-52486602 CTCATCAGAGTGAGGGAGAGAGG + Intronic
1167889581 19:52528623-52528645 CTCATCAGAGTGAGGGAGAGAGG + Intronic
1167915052 19:52734054-52734076 CTCATCAGAGTGAGGGAGAGAGG - Intronic
926669584 2:15563625-15563647 TTGTACAGATTGAGTGAAAGTGG - Intergenic
927020372 2:19010476-19010498 CTGCTTAGAATGAAGAAAAGAGG + Intergenic
929033351 2:37669560-37669582 CTGCTCAGATTGAGGGAAAGAGG + Intronic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
929545509 2:42852998-42853020 CTGCTCAGATTCAGTGAGCGTGG - Intergenic
930614453 2:53578959-53578981 GGGCACAGTTTGAGGGAAAGGGG + Intronic
932331738 2:70901719-70901741 AGGCCCAGATCGAGGGAAAGCGG - Intronic
932733215 2:74235073-74235095 ATGCCCAGAGCGAGGGAAAGGGG + Intronic
939585272 2:143996664-143996686 CTGCCAAGTTTGAGGGTAAGTGG + Intronic
942448022 2:176091451-176091473 TTGCTGAGATTGAGGGATGGTGG + Intergenic
943107648 2:183566518-183566540 CTGCTGAAAGTGAGGGAAACAGG + Intergenic
943683341 2:190790727-190790749 CTTCTCATCTTGAGAGAAAGGGG + Intergenic
946050398 2:216857450-216857472 CTGCTCAGATTGTGGGTGTGTGG + Intergenic
946139615 2:217678568-217678590 CTGCTCAGATTCAGAGAGAGGGG - Intronic
946713137 2:222526434-222526456 CTCCTGAGATGGAGGGAAGGAGG + Intronic
946822961 2:223648922-223648944 CAACCCAGATTGAGGGGAAGTGG + Intergenic
947192992 2:227528893-227528915 TTGATCAGATTGATAGAAAGTGG + Intronic
1168745666 20:237656-237678 GTGCTGAGGTTGTGGGAAAGAGG + Intergenic
1169972167 20:11279777-11279799 CAGCCCAGATTGAAGAAAAGAGG + Intergenic
1170931731 20:20774632-20774654 CTGCTCAGAATCAAGGAGAGAGG - Intergenic
1173998230 20:47356289-47356311 CTGCTCAGAGAGAGAGAGAGGGG + Intronic
1174291180 20:49509840-49509862 CTGCAGGGATTGAGGGAAAAGGG - Intronic
1174445559 20:50588466-50588488 CAGGTGAGGTTGAGGGAAAGCGG + Intronic
1175938320 20:62525379-62525401 CTGCTCAGGTGGAGATAAAGAGG + Intergenic
1176429683 21:6568041-6568063 CTGCTCAGACTCCAGGAAAGTGG - Intergenic
1177071514 21:16514504-16514526 CTGCTAAGACTGCGGGAAAAGGG - Intergenic
1179053011 21:37905318-37905340 CTGCTTTGATTGGGGGCAAGTGG - Intronic
1179460365 21:41530702-41530724 CTGCTGTCAGTGAGGGAAAGGGG + Intronic
1179705077 21:43175503-43175525 CTGCTCAGACTCCAGGAAAGTGG - Intergenic
1180593191 22:16957723-16957745 CTTCTCAGATGCAAGGAAAGAGG - Intergenic
1181184154 22:21089934-21089956 GTGGTCAGAAAGAGGGAAAGGGG + Intergenic
1181934930 22:26431373-26431395 CTTCTCAGATTCAGGAGAAGAGG - Intronic
1182765420 22:32754638-32754660 CAGATCAGAGTGAGGGGAAGGGG - Intronic
1183711380 22:39505759-39505781 CAGATCAGATTGAGGGACCGAGG + Intronic
1184453863 22:44598189-44598211 ATGCAGTGATTGAGGGAAAGAGG + Intergenic
953030983 3:39179705-39179727 CTGCCCAGATTGAAAGGAAGGGG - Intergenic
953077360 3:39582643-39582665 CTGCTAAGAGTGAGGGAGAAGGG + Intergenic
953187641 3:40653395-40653417 CATCTCAGACTGATGGAAAGGGG - Intergenic
956256743 3:67291320-67291342 CTCCTTCCATTGAGGGAAAGGGG - Intergenic
956473610 3:69595469-69595491 TTTCTCAGATTGAGGGAGAAAGG - Intergenic
957819433 3:85351631-85351653 CTGCACAGGCTGAGGGAATGTGG + Intronic
959007886 3:101041057-101041079 CTGCTCTGATGGAGGGAAGGAGG - Intergenic
960844679 3:121994752-121994774 CTGCTCAGAGTGAAGGAAAAAGG + Intronic
961438390 3:126935266-126935288 CTGCTCATCTTGAGGGAGGGAGG - Intronic
962167348 3:133063299-133063321 CTTCCCAGAATGAGGGAGAGTGG + Intronic
962241719 3:133755831-133755853 CTGCTGAGATTGAGGGAAGAGGG - Intronic
963852109 3:150219370-150219392 CTGCTCAGGTTGAGGGTTGGGGG - Intergenic
963943739 3:151122150-151122172 CTGCTCTGAATGAGGCAAAGTGG - Intronic
964430486 3:156600682-156600704 CTGCCTAGATTGATGGAAATGGG + Intergenic
965827438 3:172745180-172745202 CTGCTCAGAGTGGGGGGATGGGG - Intergenic
966546505 3:181155299-181155321 CTGGTAAGAGAGAGGGAAAGAGG - Intergenic
967904080 3:194486721-194486743 CGGCTCAGGGTGAGGGAAGGAGG + Intronic
968076997 3:195821489-195821511 CTGCTCACCTGGAGGGAATGCGG - Intergenic
968881971 4:3305604-3305626 CTGTTCAAAATGAGGGAAAATGG + Intronic
971924304 4:32987036-32987058 CTGATGAGATTGAAGGAAAGAGG - Intergenic
972353450 4:38259162-38259184 CTGATCACATTTAGGGAAATTGG + Intergenic
976610812 4:87028692-87028714 CTTCTCACACTGAAGGAAAGTGG + Intronic
977094485 4:92722431-92722453 CTCCTGAGAATGAGGAAAAGGGG + Intronic
977724538 4:100280166-100280188 CTGCTCAGATTGAAGGAGAGTGG + Intergenic
978391955 4:108236311-108236333 CTGCTGAGAGTGAGGGAAGCAGG + Intergenic
979501098 4:121440872-121440894 CTGCAAAAATTCAGGGAAAGGGG - Intergenic
983166343 4:164481748-164481770 CTGCTCAGCTTGGGGGAAAAAGG + Intergenic
986448666 5:7845504-7845526 CCCCTCAGCATGAGGGAAAGCGG + Intronic
988153109 5:27413313-27413335 CAGCTCACATTGATGAAAAGCGG + Intergenic
988182115 5:27809664-27809686 CTTCACAGAGTGAGAGAAAGAGG + Intergenic
990144407 5:52742803-52742825 GCCCTTAGATTGAGGGAAAGAGG - Intergenic
991974284 5:72171131-72171153 CTGCTCAGAATAAGGAAAAAGGG + Intronic
994931225 5:106188138-106188160 TTGCTCAGATTGGAGGAGAGTGG - Intergenic
997068071 5:130585943-130585965 CTGTTAAGATTAAGGGAAAAGGG - Intergenic
997580754 5:135015338-135015360 CTGCAGAGCTAGAGGGAAAGGGG + Intergenic
998014054 5:138718245-138718267 CTGTACAGATTCAAGGAAAGAGG + Intronic
999674336 5:153983804-153983826 CTGGGCAGGTTGAGGGATAGAGG - Intergenic
1001577730 5:172774992-172775014 TTGGTCAGCTTGAGGGCAAGGGG + Intergenic
1002777078 6:337482-337504 CTGCTGACATGGAGGGACAGGGG + Intronic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003328357 6:5109662-5109684 CTTCTCACAGTGAGGGAAACGGG - Intronic
1004134143 6:12950407-12950429 CTACTCAGATTCAGAGAGAGAGG + Intronic
1008593510 6:53017772-53017794 CCGCTTAGATGAAGGGAAAGGGG + Intronic
1008626993 6:53326560-53326582 GTGCACAGATAGAGGGGAAGTGG - Intronic
1011823861 6:91283586-91283608 CTGTTGAGTTTGAAGGAAAGAGG + Intergenic
1011960532 6:93083350-93083372 CCTCTCAGAATTAGGGAAAGAGG - Intergenic
1012368253 6:98469732-98469754 TTCCTCAGATTGAGAGAGAGAGG + Intergenic
1014266110 6:119279598-119279620 CTGCTGAGACTCAGGGGAAGAGG - Intronic
1014574000 6:123047027-123047049 TTGCACACATTGAGGGCAAGTGG + Intronic
1014614881 6:123587041-123587063 CTGCTCAGGGTGAAGGAAAAGGG + Intronic
1015343412 6:132128265-132128287 CTGTTCAAAATGAGGGAAGGAGG - Intergenic
1015606914 6:134967172-134967194 CTGCTCAGACTTAGTGAGAGAGG + Intronic
1015939431 6:138433037-138433059 CTGCTCAGAGTGCGGGACAGCGG - Exonic
1017937035 6:159014905-159014927 TTGCCCAGATTCAGAGAAAGGGG + Intergenic
1019165986 6:170097856-170097878 CTGCTCTGATAGAGGCAAGGAGG - Intergenic
1019632338 7:2056412-2056434 CTGCTCTGCTCTAGGGAAAGAGG + Intronic
1019961664 7:4465659-4465681 CTTCTCAAATCGAGGCAAAGTGG - Intergenic
1020469261 7:8517320-8517342 CTGATCAGAGTGAGGAGAAGAGG + Intronic
1021474924 7:21050091-21050113 CTGCTCAGATTCAAGGAGAGAGG + Intergenic
1021604521 7:22396659-22396681 CAGCTCAAAATGAGGTAAAGAGG - Intergenic
1023750613 7:43368667-43368689 CTGTTCAGTTTGAGGGGAAGAGG + Intronic
1024149135 7:46551818-46551840 CTGCTCACAGTAAGGGAAGGGGG - Intergenic
1027253069 7:76411173-76411195 ATGTGCAGATGGAGGGAAAGAGG - Intronic
1028842933 7:95448311-95448333 CTGGTAAGAATGAGGGGAAGAGG - Intergenic
1030109048 7:106010831-106010853 CTGATCTGAGTGAAGGAAAGAGG + Intronic
1031595535 7:123645769-123645791 CTTCTCAGATAGCTGGAAAGAGG - Intergenic
1031846377 7:126809963-126809985 CTGCTAAGACTGAGAGTAAGTGG - Intronic
1032446684 7:131990138-131990160 CTTCTCAAATTTAGGGCAAGTGG + Intergenic
1032463983 7:132132057-132132079 CTGCTCAGATGCAGGGAATTTGG + Intronic
1033584231 7:142762405-142762427 CTGTGGAGATTGTGGGAAAGAGG + Intronic
1033633364 7:143183851-143183873 CACCTCAGTTTGAGGAAAAGGGG - Exonic
1033649443 7:143329660-143329682 CTGTTCACATGGAGAGAAAGGGG + Intronic
1033808520 7:144982069-144982091 ATGCAAAGATTGAGGGGAAGAGG + Intergenic
1034317012 7:150142342-150142364 CTGCTCGGGTGGAGGGAATGAGG + Intergenic
1034789853 7:153958342-153958364 CTGCTCGGGTGGAGGGAATGAGG - Intronic
1036427743 8:8661807-8661829 CTGCTCACATTCAAGGGAAGGGG - Intergenic
1038387342 8:27161137-27161159 CTGCTCTGATTGAGGAGTAGGGG + Intergenic
1038778056 8:30548769-30548791 CTGCTCAGATACAGGGGAGGTGG - Intronic
1039504299 8:38040833-38040855 CAGCCCAGATTCAGGGAGAGGGG + Intronic
1040415949 8:47196328-47196350 CTGCTCAAATGGGGGGAAGGAGG - Intergenic
1041248511 8:55912043-55912065 CTGCTCAAATGGAAGGAGAGAGG + Intronic
1043167112 8:76916973-76916995 CTGCTCAGATATGGGAAAAGGGG - Intergenic
1043578304 8:81683174-81683196 CAGCTCAGATTAAGGGAAACAGG + Intronic
1044528272 8:93277092-93277114 CTGCTGAGTTTGAGGCAATGAGG + Intergenic
1047712482 8:127566494-127566516 CTGCCAAGATAGAAGGAAAGGGG - Intergenic
1051331568 9:16029516-16029538 CTGCTAAGGTTGAGGGAATAGGG + Intronic
1056074239 9:83022047-83022069 CTGCTTAGGTTGGGGGTAAGAGG - Intronic
1056971948 9:91212522-91212544 CTGCTCAGTTCAAGAGAAAGTGG + Intergenic
1057083241 9:92188298-92188320 CTGGGCAGATGGAGGGACAGTGG + Intergenic
1058595704 9:106613332-106613354 CTGCTCAGCATGAGGGACCGTGG + Intergenic
1059705639 9:116820784-116820806 CTGCTCAGAGAGAGGGCAACAGG + Intronic
1061238543 9:129356073-129356095 CTACTCAGATTGAAGGCAAGGGG + Intergenic
1187472114 X:19578864-19578886 CTCCTCAGATGGAGGGCAGGAGG + Intronic
1187681217 X:21769682-21769704 CTGCACAGATTCAAGGGAAGAGG + Intergenic
1188646252 X:32571057-32571079 CTGCCCAGATTCAAGGAAAAGGG - Intronic
1190113321 X:47609365-47609387 CAGCCCAGATTGAGGCAAGGAGG - Intronic
1193601934 X:83517739-83517761 CTGTTCAGATTGTGGGGGAGGGG + Intergenic
1194112511 X:89853016-89853038 CAGCTCAGATTTAAGGAATGGGG - Intergenic
1194416606 X:93619956-93619978 CTGCTGAAAGTGAGGGAAGGAGG + Intergenic
1195364754 X:104115155-104115177 CTGCTCATATTGTGGGGAGGAGG + Exonic
1196072852 X:111544805-111544827 CTGCTCAGAGTGAAGGAGAAGGG - Intergenic
1196990833 X:121326939-121326961 GTGCTCAGAGTGAGGGAATCTGG + Intergenic
1197313937 X:124940676-124940698 CTGCCAAGATTCAGGGAGAGAGG - Intronic
1198026167 X:132709512-132709534 CAGCTCAGAAACAGGGAAAGGGG - Intronic
1198719454 X:139600158-139600180 CTGCTTAGATTGGGGAAAAAAGG + Intronic
1199078389 X:143549593-143549615 CTGCTGAGATGGAGGGAAAAAGG + Intergenic
1199908063 X:152255799-152255821 CTGCTCAGATTGGTGGACAACGG - Exonic
1199974489 X:152884966-152884988 CTGCTCAGCTTGGGAAAAAGGGG - Intergenic
1200456813 Y:3404293-3404315 CTGCTCATACCAAGGGAAAGAGG - Intergenic
1200465164 Y:3507828-3507850 CAGCTCAGATTTAAGGAATGGGG - Intergenic
1201717322 Y:17060119-17060141 CTGTTCAGATTGCAGGAAAAGGG - Intergenic
1201914416 Y:19167185-19167207 CTACTCAGGATGTGGGAAAGAGG + Intergenic