ID: 929033748

View in Genome Browser
Species Human (GRCh38)
Location 2:37671974-37671996
Sequence GACCCGGAGGTGCTGCCGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929033740_929033748 20 Left 929033740 2:37671931-37671953 CCTAAGCACAAAGAAAGGTCGCC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 929033748 2:37671974-37671996 GACCCGGAGGTGCTGCCGCCCGG 0: 1
1: 0
2: 1
3: 15
4: 154
929033744_929033748 -1 Left 929033744 2:37671952-37671974 CCGGACGCTCGGTTTAAAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 21
Right 929033748 2:37671974-37671996 GACCCGGAGGTGCTGCCGCCCGG 0: 1
1: 0
2: 1
3: 15
4: 154
929033739_929033748 21 Left 929033739 2:37671930-37671952 CCCTAAGCACAAAGAAAGGTCGC 0: 1
1: 0
2: 0
3: 1
4: 63
Right 929033748 2:37671974-37671996 GACCCGGAGGTGCTGCCGCCCGG 0: 1
1: 0
2: 1
3: 15
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929033748 Original CRISPR GACCCGGAGGTGCTGCCGCC CGG Exonic
900192446 1:1357140-1357162 GCCCCTGAGGTGCTTCCGCAGGG + Intronic
900335442 1:2160813-2160835 GACTCGGGGGTGCTGTGGCCTGG + Intronic
900663158 1:3796127-3796149 GCGCTGGAGGCGCTGCCGCCGGG - Exonic
900687571 1:3958446-3958468 GGCCCGGAGGCGATGCAGCCTGG + Intergenic
900774700 1:4573831-4573853 GACCAGGAAGGGCTGCAGCCTGG - Intergenic
901809905 1:11761789-11761811 GACCCGGATGTCCTGCCCCTGGG + Exonic
902227894 1:15008199-15008221 GACTCCGAGGTGGTGCCGTCTGG - Intronic
902615905 1:17623424-17623446 GGCCAGGGGGTGCTGCCACCTGG - Intronic
903976765 1:27155058-27155080 GACCAGGAGGAGCTGCAGCTGGG - Intronic
906640665 1:47438847-47438869 CACCCGGAGCTGCTGCTGCGTGG + Exonic
910387896 1:86704835-86704857 GAGGCGGAGGTGCCGCGGCCGGG - Intronic
910499856 1:87877723-87877745 GACCCGTAGGTGCTCTCGACAGG - Intergenic
912318974 1:108692639-108692661 GAGCCGCAGCTGCAGCCGCCTGG - Exonic
915311829 1:155008949-155008971 GGCCAGGAGGAGTTGCCGCCAGG + Intronic
915572495 1:156751967-156751989 GCCCGGGAGGAGCTGGCGCCCGG + Intronic
921607472 1:217172825-217172847 GACCAGAAGGTGCTACAGCCAGG + Intergenic
922705412 1:227788003-227788025 GCCCCGCAGGTGCAGGCGCCGGG + Intergenic
1069504933 10:68989151-68989173 GACACGGAGGAGCTGTCGGCGGG + Exonic
1069544666 10:69319473-69319495 GCCCCGGAGAAGCTGTCGCCGGG + Intronic
1073061748 10:100737515-100737537 TTCCCGGAGCTGCTGCTGCCTGG - Intronic
1073287909 10:102399476-102399498 GCCCCGGAGATGCTGCAGCGAGG + Exonic
1075547792 10:123368496-123368518 CACCCAGAGCTGCTGCAGCCTGG - Intergenic
1076788969 10:132766923-132766945 GAGCCGGAGGTGCGGCCTCAGGG + Intronic
1077150706 11:1071877-1071899 GAGCAGGACGTGCTGCCTCCAGG - Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1080749538 11:35139426-35139448 CAGCCGGAGGGGCTGCCGCCGGG - Intronic
1081831879 11:46121443-46121465 GCGGCGGAGGTGCTGCGGCCCGG - Intergenic
1083773101 11:64879085-64879107 GAGGAGGAGGTGCCGCCGCCTGG - Intronic
1084115918 11:67042936-67042958 CACCAGGGGGTGCTGCCCCCAGG + Intronic
1084189919 11:67494216-67494238 GACCCAGAGGCCCTGTCGCCTGG - Intronic
1087013688 11:93536651-93536673 GACCTGGAGGAGCTGGCACCTGG + Intronic
1092229176 12:6767189-6767211 GGCCCGGAGGAGCAGCCTCCAGG - Intronic
1096204104 12:49707110-49707132 GTCCCGTTGTTGCTGCCGCCCGG - Exonic
1096551900 12:52378441-52378463 GACCCGGAGGTGCAGCCCAGGGG - Intronic
1099262540 12:80400871-80400893 GACCCGGACCTGCAGCCGCGCGG - Intergenic
1100793510 12:98155946-98155968 GACACTGAGGTGCAGCTGCCAGG - Intergenic
1104769736 12:131353905-131353927 GACCCTGAGTTGCTGCTGCAAGG - Intergenic
1104951353 12:132442014-132442036 GAGCCGGAGCTGCTGACGCCAGG - Intergenic
1106809953 13:33349998-33350020 TACCTGGAGGGGCTGCCCCCGGG - Intronic
1113888650 13:113725078-113725100 GACCTGGAGATGCTGCCGTCAGG + Intronic
1114049650 14:18912877-18912899 GTCCGGGAGCTGCAGCCGCCTGG + Intergenic
1114112911 14:19489054-19489076 GTCCGGGAGCTGCAGCCGCCTGG - Intergenic
1116886922 14:50231287-50231309 GATGCGGAGGCGCTGTCGCCGGG - Exonic
1116945186 14:50830282-50830304 AACCCAGCGGTGCTGCCGCGCGG + Intronic
1117226881 14:53670305-53670327 GGCCCAGAGGTGCTGCAGTCAGG + Intergenic
1119799338 14:77428903-77428925 GATCCTGAGGTGCTCCCACCAGG - Intronic
1121253009 14:92513635-92513657 GCCCCGGGGGCGCGGCCGCCCGG + Intergenic
1122984984 14:105207916-105207938 GGTGCGGAGGTGCTGCGGCCCGG - Intergenic
1123049253 14:105532697-105532719 GGCCCGCAGGTGCAGCAGCCTGG + Intergenic
1126863897 15:52916371-52916393 GGACCAGAAGTGCTGCCGCCAGG + Intergenic
1127094420 15:55498405-55498427 GACCCGGAAGGGCTGGCGCATGG - Exonic
1127267925 15:57376381-57376403 GACCCGCCGGGGCTGCCGGCGGG - Intronic
1127796776 15:62445160-62445182 CACCTGCAGGTGCTGCAGCCTGG - Intronic
1132233531 15:100201977-100201999 GACCCAGAGGGGCTGCAGCCAGG - Intronic
1132679096 16:1132444-1132466 GACCCGGCGGTTCTGCCCCACGG - Intergenic
1136579439 16:31142755-31142777 GCCCGGGAGCCGCTGCCGCCTGG - Exonic
1137368893 16:47886610-47886632 GGCCCGGAGGTGAGGCCCCCTGG - Intergenic
1139532041 16:67547149-67547171 GACGCGGATCTGCTGCCCCCTGG - Intergenic
1145246879 17:21275428-21275450 GACCCGTAGCTGCTGCACCCGGG + Intergenic
1147123845 17:38352350-38352372 GACCCCAAGGCCCTGCCGCCGGG + Exonic
1148478008 17:47941805-47941827 GACCGAGAGGTGCCGCCGCTAGG + Exonic
1148818131 17:50345625-50345647 GCCCCGCAGGTGCGGCCTCCAGG + Intergenic
1151736024 17:75940930-75940952 CCCCCGGAGGTGCGGCCGCTGGG + Exonic
1151767097 17:76138263-76138285 GTCCCAGAGCTGCAGCCGCCTGG - Intronic
1151824110 17:76514091-76514113 GACCTGGGGGTTCTGCCTCCAGG - Intergenic
1151833742 17:76570213-76570235 GACCCGGAGCCGCTGGCGGCTGG + Intronic
1152191546 17:78891293-78891315 GACCCAGAGATGCTGCCTGCCGG - Exonic
1152433366 17:80261197-80261219 GCCCCGGCAGTGCTGCCCCCGGG + Intronic
1152523389 17:80873407-80873429 AACCAGGACGTGCTGCCTCCTGG + Intronic
1152701612 17:81822544-81822566 GACCCTGAGGTGCTGCTGCTGGG - Exonic
1152739067 17:82011233-82011255 GACCTTGGGCTGCTGCCGCCCGG - Intronic
1153805414 18:8705700-8705722 GACGCGAAGCTGCAGCCGCCCGG + Intronic
1154303968 18:13217702-13217724 GACGCGGCGCTGCGGCCGCCGGG - Intronic
1158976690 18:62716435-62716457 GGCCCGGAGCCGCCGCCGCCCGG + Exonic
1159655683 18:71028537-71028559 GTCCCTGGGATGCTGCCGCCCGG + Intergenic
1160391736 18:78539240-78539262 GACCCTGGGGTGCCGGCGCCCGG + Intergenic
1160525661 18:79533912-79533934 GACCCGGAGGTGCTGGGACCCGG - Intergenic
1160741237 19:687049-687071 GACTTTGAGGAGCTGCCGCCTGG - Exonic
1161123101 19:2540923-2540945 GACCAGGAGCCGCCGCCGCCAGG + Intronic
1161222381 19:3123589-3123611 GGCCGGGGGCTGCTGCCGCCCGG - Exonic
1161654767 19:5507462-5507484 GATCCGGAGACGCTGCCGGCCGG - Intergenic
1162299322 19:9835351-9835373 GACGAGGAGAAGCTGCCGCCCGG + Exonic
1163446151 19:17347617-17347639 GACCCTGAGGTCCAACCGCCTGG - Intergenic
1164146577 19:22516290-22516312 GACACAGAGGTGCTGCCCACTGG + Intronic
1164159795 19:22618841-22618863 GACATGGAGGTGCTGCCCACTGG - Intergenic
1165309019 19:35019433-35019455 GACTCCGAGGTGCTGACGCAGGG + Exonic
925573154 2:5332725-5332747 TGCCCGGAGATGCTGCCTCCAGG + Intergenic
926846601 2:17147843-17147865 GACCCACAAGTGCTGCTGCCCGG + Intergenic
929033748 2:37671974-37671996 GACCCGGAGGTGCTGCCGCCCGG + Exonic
930028666 2:47045143-47045165 AACCGGGAGGTGCTGCCGTCTGG + Intronic
931727980 2:65129710-65129732 GACGCGGAGGGGCGGCCGCGCGG - Intronic
933613412 2:84459786-84459808 GACCCGGAAGGGTTGCCGCTGGG + Intronic
937917763 2:127107246-127107268 GACCTGGCGGTGCCGGCGCCCGG - Exonic
938421603 2:131151577-131151599 GACCAGGATGAGCTGCCGCTGGG + Intronic
939574055 2:143874735-143874757 GACACTTAAGTGCTGCCGCCTGG + Intergenic
942565887 2:177264548-177264570 GACTTGGAGCTGCCGCCGCCGGG - Exonic
946310576 2:218880667-218880689 GGCCCGGAGGTGCAGCGGGCTGG - Exonic
948258458 2:236585165-236585187 GCCCCGGAGCTGCTGCCTCCTGG - Intergenic
948715310 2:239857217-239857239 CACCTGGAGGTGATGCCCCCTGG - Intergenic
1170559126 20:17540693-17540715 CACCCGGAGGTGATGCAGTCTGG - Intronic
1170600362 20:17836870-17836892 GCCCCTGAGCTGCTGCCGCTGGG - Intergenic
1170798362 20:19569767-19569789 GACACGGAGTTGCTGCAGCCTGG - Intronic
1172015410 20:31870187-31870209 GACACGGAGATGCCGCCGCACGG + Intronic
1175736719 20:61392224-61392246 GACCCGGACATGCTGCCTCTGGG + Intronic
1175790107 20:61735566-61735588 GACCCTGAGGTTCTGCCTCCCGG + Intronic
1176059988 20:63168302-63168324 GACCAGGAGGTGCTGCTGCCTGG - Intergenic
1178943295 21:36925504-36925526 GAACTGGACGTGCTGCCCCCAGG - Intronic
1179621174 21:42617347-42617369 GCCCGGAAGGTGCCGCCGCCCGG + Intergenic
1179823805 21:43952611-43952633 GACCAAGATGTGCTGGCGCCAGG + Intronic
1179987807 21:44931168-44931190 GACCCAAGGGTGATGCCGCCAGG + Intronic
1180167787 21:46038988-46039010 GACCCTGATGTGGTGCGGCCTGG - Intergenic
1181026514 22:20130781-20130803 CACCCTGAGGAGCTGCGGCCGGG + Intronic
1183713339 22:39519738-39519760 GACACGGCGCTGCTGCCCCCGGG - Intronic
1184658822 22:45955927-45955949 TACAAGGAGGGGCTGCCGCCAGG + Intronic
950500195 3:13358852-13358874 GCCCAGGAGGAGCTGCAGCCTGG + Intronic
952974598 3:38683016-38683038 GACCAGGAGGTGCTGGAGCCAGG + Intergenic
953480367 3:43246348-43246370 GAACCTCAGCTGCTGCCGCCTGG - Intergenic
953891834 3:46756667-46756689 GACGCGGAGGAGGCGCCGCCAGG - Intronic
954406040 3:50345551-50345573 GACCTGGAACTGCTGCTGCCCGG - Exonic
955240160 3:57170701-57170723 GACCAGGAGTTGATGCAGCCAGG + Intergenic
961359336 3:126357269-126357291 GCCCCGGCGGTCCTGCGGCCGGG + Exonic
962754766 3:138458956-138458978 GACCCACAGGGGCTGCCTCCTGG + Intronic
964174292 3:153806659-153806681 GACCTGGAGGGGCTCCCACCTGG - Intergenic
966919347 3:184601968-184601990 TGCCCGGAGGTGCGGCCGCCAGG - Intronic
967390311 3:188948352-188948374 GGCCCGGAGGGGCTGGGGCCTGG - Intronic
968576371 4:1368070-1368092 CTCCTGGAGGTGCTGCAGCCGGG + Intronic
968644781 4:1735033-1735055 CACCTGGAGGTGCTGCTGGCAGG + Intronic
969649438 4:8455404-8455426 TGCCCGGAGGTGATCCCGCCAGG - Intronic
985887048 5:2687876-2687898 GAGCAGGAAGTGCTGCCGGCAGG - Intergenic
986384432 5:7217799-7217821 CACCCAGAGGAGCTGCAGCCTGG - Intergenic
990286977 5:54310257-54310279 GACTCGGAGGGGCAGCCTCCAGG - Intronic
999419821 5:151431301-151431323 CACCCGGAGCTCCTGCTGCCAGG - Intergenic
1001712829 5:173791857-173791879 GCCCTGGAGGTGCTGGCACCAGG - Intergenic
1001932204 5:175681222-175681244 TACCCGGAGGTTCAGCTGCCAGG + Intronic
1007655866 6:43450688-43450710 GACCCTGAGGGCCTGGCGCCGGG - Exonic
1018172665 6:161154167-161154189 GTCCCGGAGGTGCTGCAAACTGG + Exonic
1018229708 6:161663847-161663869 GACCACGAGGAGCAGCCGCCGGG + Intronic
1018612697 6:165660906-165660928 CACCCGGAGGTGCTCCTACCCGG + Intronic
1018804743 6:167249845-167249867 GCCCAGGAGGTGCTGGCACCGGG + Intergenic
1018992679 6:168686137-168686159 GACCCCGAGGTTCTGGAGCCGGG + Intergenic
1019460163 7:1154001-1154023 GGCCCGGAGGTGCTGCTGGGAGG + Intronic
1019610177 7:1932542-1932564 AACTCGGAGGTGCTGCTGCTAGG + Intronic
1020007047 7:4788659-4788681 GTCCCGGGTGTGCTGACGCCAGG + Intronic
1020022240 7:4876065-4876087 GAGCCGCAGATGCTGCAGCCAGG - Intronic
1031531925 7:122886388-122886410 GACCCGCGGGCGCAGCCGCCGGG - Intronic
1032548057 7:132759770-132759792 CACCAGGAGGTCCTGCGGCCAGG + Intergenic
1032841216 7:135714814-135714836 AACCCGCAGCCGCTGCCGCCTGG - Intronic
1034172267 7:149071681-149071703 GACACGGAGGCGCTGCAGCATGG - Exonic
1034802984 7:154064202-154064224 GACCAGGAGGTGCTGCTGTGTGG - Intronic
1034968383 7:155404938-155404960 TCCCGGGAGGTGCTGCCACCTGG + Intergenic
1034977530 7:155457259-155457281 GACCTGGCGGGGCTGTCGCCGGG + Intergenic
1036017106 8:4797151-4797173 GAGCCTGAGATGCTGCTGCCTGG - Intronic
1037334012 8:17774457-17774479 GAAGCGGAGGTGATGCCACCAGG + Intronic
1038447631 8:27614917-27614939 GACCCTGAGGTGCGGCCGCTCGG + Exonic
1039591964 8:38757104-38757126 GCCCCGCGGGTGCTGCCGCCTGG - Intronic
1041281192 8:56211934-56211956 GGCGCGGAGGCGCTCCCGCCAGG + Intronic
1049218298 8:141417686-141417708 GGGCCGGGGGCGCTGCCGCCCGG - Intronic
1049394936 8:142395570-142395592 GATCCGGCGGTGCCGCCCCCTGG - Intronic
1049604201 8:143521481-143521503 GGCCCGGAGCTGCTCCAGCCTGG - Intronic
1049820726 8:144631666-144631688 GACCCAGAGGTGCTTACACCAGG - Intergenic
1053517915 9:38747212-38747234 GAACGGAAGTTGCTGCCGCCAGG + Intergenic
1059251507 9:112891034-112891056 GCCCCGGGGGTGCTGGCGCCAGG - Intergenic
1060359423 9:122941032-122941054 GTCCCGGAGGCTCCGCCGCCTGG - Exonic
1061299909 9:129698324-129698346 GACCAGGCGGTGGTGCTGCCAGG + Intronic
1061884252 9:133583670-133583692 GGCCCAGAGGAGCTGCAGCCAGG - Intronic
1062408880 9:136411277-136411299 GGTGCGGAGGTGCTGCCTCCAGG + Intronic
1190332218 X:49242973-49242995 CACCTGGAGGTGCTGCAGCTTGG - Exonic
1192125745 X:68499208-68499230 GAGCCGGAGCTCCTTCCGCCCGG + Intronic
1193601338 X:83510727-83510749 GACCCGGAGACGCTGGCGACTGG + Intergenic
1196828559 X:119759073-119759095 GAGCCGGAGCTGCTGCTGCGGGG + Exonic
1196965131 X:121047475-121047497 GACCCGGAGGTCCGGCGCCCTGG + Intergenic